The Program RNAsubopt

Introduction

By default, RNAsubopt calculates all suboptimal secondary structures within a given energy range above the MFE structure [Wuchty et al., 1999].

Note

Be careful, the number of structures returned grows exponentially with both sequence length and energy range.

Suboptimal folding

• Generate all suboptimal structures within a certain energy range from the MFE specified by the -e option:

  $ RNAsubopt -e 1 -s < test.seq
  CUACGGCGCGGCGCCCUUGGCGA   -500    100
  ...........((((...)))).  -5.00
  ....((((...))))........  -4.80
  (((.((((...))))..)))...  -4.20
  ...((.((.((...)).)).)).  -4.10
  

The text output shows an energy sorted list (option -s) of all secondary structures within 1~kcal/mol of the MFE structure. Our sequence actually has a ground state structure (-5.70) and three structures within 1~kcal/mol range.

MFE folding alone gives no indication that there are actually a number of plausible structures. Remember that RNAsubopt cannot automatically plot structures, therefore you can use the tool RNAplot. Note that you can’t simply pipe the output of RNAsubopt to RNAplot using:

$ RNAsubopt < test.seq | RNAplot

You need to manually create a file for each structure you want to plot. Here, for example we created a new file named suboptstructure.txt:

> suboptstructure-4.20
CUACGGCGCGGCGCCCUUGGCGA
(((.((((...))))..)))...

The fasta header is optional, but useful (without it the outputfile will be named rna.ps).

The next two lines contain the sequence and the suboptimal structure you want to plot; in this case we plotted the structure with the folding energy of -4.20.

Then plot it with

$ RNAplot < suboptstructure.txt

Note that the number of suboptimal structures grows exponentially with sequence length and therefore this approach is only tractable for sequences with less than 100 nt. To keep the number of suboptimal structures manageable the option --noLP can be used, forcing RNAsubopt to produce only structures without isolated base pairs. While RNAsubopt produces all structures within an energy range, mfold produces only a few, hopefully representative, structures. Try folding the sequence on the mfold server at http://mfold.rna.albany.edu/?q=mfold.

Sometimes you want to get information about unusual properties of the Boltzmann ensemble (the sum of all RNA structures possible) for which no specialized program exists. For example you want to know all fractions of a bacterial mRNA in the Boltzmann ensemble where the Shine-Dalgarno (SD) sequence is unpaired. If the SD sequence is concealed by secondary structure the translation efficiency is reduced.

In such cases you can resort to drawing a representative sample of structures from the Boltzmann ensemble by using the option -p. Now you can simply count how many structures in the sample possess the feature you are looking for. This number divided by the size of your sample gives you the desired fraction.

The following example calculates the fraction of structures in the ensemble that have bases 6 to 8 unpaired.

Sampling the Boltzmann Ensemble

RNAsubopt also implements a statisctical sampling algorithm to draw secondary structures from the ensemble according to their equilibrium probability [Ding and Lawrence, 2003]:

• Draw a sample of size 10,000 from the Boltzmann ensemble

• Calculate the desired property, e.g. by using a perl script:

  $ RNAsubopt -p 10000 < test.seq > tt
  $ perl -nle '$h++ if substr($_,5,3) eq "...";
    END {print $h/$.}' tt
    0.391960803919608
  

A far better way to calculate this property is to use RNAfold -p to get the ensemble free energy, which is related to the partition function via \(F = -RT\ln(Q)\), for the unconstrained (\(F_u\)) and the constrained case (\(F_c\)), where the three bases are not allowed to form base pairs (use option -C), and evaluate \(p_c = \exp((F_u - F_c)/RT)\) to get the desired probability.

So let’s do the calculation using RNAfold:

$ RNAfold -p
Input string (upper or lower case); @ to quit
....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8
CUACGGCGCGGCGCCCUUGGCGA
length = 23
CUACGGCGCGGCGCCCUUGGCGA
...........((((...)))).
 minimum free energy =  -5.00 kcal/mol
....{,{{...||||...)}}}.
 free energy of ensemble =  -5.72 kcal/mol
....................... {  0.00 d=4.66}
 frequency of mfe structure in ensemble 0.311796; ensemble diversity 6.36

Now we have calculated the free ensemble energy of the ensemble over all structures \(F_u\), in the next step we have to calculate it for the structures using a constraint (\(F_c\)).

Following notation has to be used for defining the constraint:

• | : paired with another base

• . : no constraint at all

• x : base must not pair

• < : base i is paired with a base j<i

• > : base i is paired with a base j>i

• matching brackets ( ): base i pairs base j

So our constraint should look like this:

.....xxx...............

Next call the application with following command and provide the sequence and constraint we just created:

$ RNAfold -p -C

The output should look like this:

length = 23
CUACGGCGCGGCGCCCUUGGCGA
...........((((...)))).
 minimum free energy =  -5.00 kcal/mol
...........((((...)))).
 free energy of ensemble =  -5.14 kcal/mol
...........((((...)))). { -5.00 d=0.42}
 frequency of mfe structure in ensemble 0.792925; ensemble diversity 0.79

Afterwards evaluate the desired probability according to the formula given before e.g. with a simple perl script:

$ perl -e 'print exp(-(5.72-5.14)/(0.00198*310.15))."\n"'

You can see that there is a slight difference between the RNAsubopt run with 10,000 samples and the RNAfold run including all structures.