The Programs barriers and treekin

Introduction

The following assumes you already have the barriers and treekin programs installed. They are not part of the ViennaRNA Package but their latest releases can be found at https://www.tbi.univie.ac.at/RNA/Barriers/ and https://www.tbi.univie.ac.at/RNA/Treekin/, respectively. Installation proceeds as shown for the ViennaRNA Package.

Note

One problem that often occurs during treekin installation is the dependency on blas and lapack packages. For further information according to the barriers and treekin program also see the website.

A short recall on howto install/compile a program

  • Get the barriers source from https://www.tbi.univie.ac.at/RNA/Barriers/

  • extract the archive and go to the directory:

    $ tar -xzf Barriers-1.5.2.tar.gz
$ cd Barriers-1.5.2

  • use the --prefix option to install in your Progs/ directory:

    $ ./configure --prefix=$HOME/Tutorial/Progs/barriers-1.5.2

  • make install:

    $ make
$ make install

Now barriers is ready to use. Apply the same steps to install treekin.

Note

Copy the barriers and treekin binaries to your bin folder or add the path to your PATH environment variable.

Calculate the Barrier Tree

$ echo UCCACGGCUGUUAGUGGAUAACGGC | RNAsubopt --noLP -s -e 10 > barseq.sub
$ barriers -G RNA-noLP --bsize --rates < barseq.sub > barseq.bar

You can restrict the number of local minima using the barriers command-line option --max followed by a number. The option -G RNA-noLP instructs barriers that the input consists of RNA secondary structures without isolated basepairs. --bsize adds size of the gradient basins and --rates tells barriers to compute rates between macro states/basins for use with treekin. Another useful options is --minh to print only minima with a barrier \(> dE\). Look at the output file barseq.bar, its content should be like:

  UCCACGGCUGUUAGUGGAUAACGGC
1 (((((........))))).......  -6.90    0  10.00    115     0  -7.354207     23  -7.012023
2 ......(((((((.....)))))))  -6.80    1   9.30     32    58  -6.828221     38  -6.828218
3 (((...(((...)))))).......  -0.80    1   0.90      1    10  -0.800000      9  -1.075516
4 ....((..((((....)))).))..  -0.80    1   2.70      5    37  -0.973593     11  -0.996226
5 .........................   0.00    1   0.40      1    14  -0.000000     26  -0.612908
6 ......(((....((.....)))))   0.60    2   0.40      1    22   0.600000      3   0.573278
7 ......((((((....)))...)))   1.00    1   1.50      1    95   1.000000      2   0.948187
8 .((....((......)).....)).   1.40    1   0.30      1    30   1.400000      2   1.228342

The first row holds the input sequence, the successive list the local minima ascending in energy. The meaning of the first 5 columns is as follows

  • label (number) of the local minima (1=MFE)

  • structure of the minimum

  • free energy of the minimum

  • label of deeper local minimum the current minimum merges with (note that the MFE has no deeper local minimum to merge with)

  • height of the energy barrier to the local minimum to merge with

  • numbers of structures in the basin we merge with

  • number of basin which we merge to

  • free energy of the basin

  • number of structures in this basin using gradient walk

  • gradient basin (consisting of all structures where gradientwalk ends in the minimum)

barriers produced two additional files, the PostScript file tree.eps which represents the basic information of the barseq.bar file visually:

../_images/tree.png

and a text file rates.out which holds the matrix of transition probabilities between the local minima.

Simulating the Folding Kinetics

The program treekin is used to simulate the evolution over time of the population densities of local minima starting from an initial population density distribution \(p0\) (given on the command-line) and the transition rate matrix in the file rates.out.

$ treekin -m I --p0 5=1 < barseq.bar | xmgrace -log x -nxy -

kin dot

The simulation starts with all the population density in the open chain (local minimum 5, see barseq.bar). Over time the population density of this state decays (yellow curve) and other local minima get populated. The simulation ends with the population densities of the thermodynamic equilibrium in which the MFE (black curve) and local minimum 2 (red curve) are the only ones populated. (Look at the dot plot of the sequence created with RNAsubopt and RNAfold!)