RNAup provides two different modes: By default RNAup computes
accessibilities, in terms of the free energies needed to open a
region (default length 4). It prints the region of highest
accessibility and its opening energy to stdout, opening energies
for all other regions are written to a file.
In interaction mode the interaction between two RNAs is calculated.
It is invoked if the input consists of two sequences concatenated
with an "&", or if the options -X[pf] or -b are given. Unless
the -b option is specified RNAup assumes that the longer RNA is a
structured target sequence while the shorter one is an unstructured
small RNA.
Additionally, for every position along the target sequence we write
the best free energy of binding for an interaction that includes
this position to the the output file. Output to stdout consists of
the location and free energy, dG, for the optimal region of
interaction. The binding energy dG is also split into its
components the interaction energy dGint and the opening energy
dGu_l (and possibly dGu_s for the shorter sequence).
In addition we print the optimal interaction structure as computed
by RNAduplex for this region. Note that it can happen that the
RNAduplex computed optimal interaction does not coincide with the
optimal RNAup region. If the two predictions don't match the
structure string is replaced by a run of "." and a message is
written to stderr.
Each sequence should be in 5' to 3' direction. If the sequence
is preceded by a line of the form
> name
the output file "name_ux_up.out" is produced, where the "x" in "ux"
is the value set by the -u option. Otherwise the file name defaults
to RNA_ux_up.out. The output is concatenated if a file with the
same name exists.
RNA sequences are read from stdin as strings of characters. White space and newline within a sequence cause an error! Newline is used to separate sequences. The program will continue to read new sequences until a line consisting of the single character @ or an end of file condition is encountered.
the -noGU, -noCloseGU, -nsp, -S, -P, -noLP, -T, -4, and -d options work as in RNAfold, see there for description.
output
In Interaction mode RNAup prints the most favorable interaction energy between the two sequences to stdout. The most favorable interaction energy (dG) depends on the position in the longer sequence (region [i,j]) and the position in the shorter sequence (region[k,l]): dG[i,j;k,l]. dG[i,j;k,l] is the largest contribution to dG[i,j] = sum_kl dG[i,j;k,l] which is given in the output file: therefore dG[i,j;k,l] <= dG[i,j].
> franz GGAGUAGGUUAUCCUCUGUU > sissi AGGACAACCU dG = dGint + dGu_l (((((.((((&)))).))))) 6,15 : 1,10 (-6.66 = -9.89 + 3.23) AGGUUAUCCU&AGGACAACCU RNAup output in file: franz_sissi_w25_u3_4_up.outwhere the result line contains the following information
RNAduplex results [i,j] [k,l] dG = dGint + dGu_l (((((.((((&)))).))))) 6,15 : 1,10 (-6.66=-9.89+3.23)Output to file:
The line directly after the header gives the column names for the output:
position dGu_l for -u 3 dGu_l for -u 4 dG # pos u3S u3H u4S u4H dG
where all information refers to the target sequence. The dGu_l column contains information about the -u value (u=3 or u=4) and the contribution to the free energy to open all structures "S" or only hairpin loops "H", see option -c. NA means that no results is possible (e.g. column u3S row 2: no region of length 3 ending at position 2 exists).
# Thu Apr 10 09:15:11 2008 # RNAup -u 3,4 -c SH -b # 20 franz # GGAGUAGGUUAUCCUCUGUU # 10 sissi # AGGACAACCU # pos u3S u3H u4S u4H dG 1 NA NA NA NA -1.540 2 NA NA NA NA -1.540 3 1.371 NA NA NA -1.217 4 1.754 5.777 1.761 NA -1.393 5 1.664 3.140 1.811 5.800 -1.393If the -b option is selected position and dGu_s values for the shorter sequence are written after the information for the target sequence.
If you use this program in your work you might want to cite:
I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994) Fast Folding and Comparison of RNA Secondary Structures. Monatshefte f. Chemie 125: 167-188
U.Mueckstein, H. Tafer, J. Hackermueller, S.H. Bernhart, P.F. Stadler, and I.L. Hofacker (2006) Thermodynamics of RNA-RNA Binding. Bioinformatics. doi:10.1093/bioinformatics/btl024