SRP RNA ClustalW alignments

There are 2083 alignments in the test set.

#1

Mean pairwise ID: 29.18%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRI.AE_C        ------------------------------------------------------------
                                                                            

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGT-CCGTGCCAAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                    ** * * *  *** **  *   **

CAE.EL_B        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATG--CGAAAGTTGGGC--CTCACGGTCCATAATGTGGCA
                   **   * *  ****   *    ** *** *** *    *  *** ***** * *   

CAE.EL_B        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCG
TRI.AE_C        GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
                 * *  *     * * *     *   *****  * **    ****      * ****  *

CAE.EL_B        GACTGCG--CTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTG
TRI.AE_C        GATAACGGGCCGCTGCACTCCTAGGC-CGCTTGGGCCTCGTAGCCTACTCCAGCGACCAC
                **   **  *   **   *   * *    *   * * **  *      **   * **   

CAE.EL_B        TTTTT
TRI.AE_C        CATC-
                  *  

[Download ClustalW]

#2

Mean pairwise ID: 29.84%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
TRI.AE_C        ------------------------------------------------------------
                                                                            

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGT-CCGTGCCAAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                    ** * * *  *** **  *   **

CAE.EL_C        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATG--CGAAAGTTGGGC--CTCACGGTCCATAATGTGGCA
                   **   * *  ****   *    ** *** *** *    *  *** ***** * *   

CAE.EL_C        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCG
TRI.AE_C        GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
                 * *  *     * * *     *   *****  * **    ****      * ****  *

CAE.EL_C        GACAGCG--CTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTG
TRI.AE_C        GATAACGGGCCGCTGCACTCCTAGGC-CGCTTGGGCCTCGTAGCCTACTCCAGCGACC-A
                ** * **  *   **   *   * *    *   * * **  *      **   * **   

CAE.EL_C        TCACT
TRI.AE_C        CCATC
                 **  

[Download ClustalW]

#3

Mean pairwise ID: 30.42%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
TRI.AE_C        ------------------------------------------------------------
                                                                            

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGC-GTCCGCGCTAA
TRI.AE_C        -----------------------------------------GGTGGTCTGCCCGTTCCAA
                                                          * ** * * ***  * **

GAL.GAL.        GGCCGGCATCAATATGGT-GAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGG
TRI.AE_C        GTTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGG
                *    * *       * * * * **   *     *  *  *  ** * * * *** * **

GAL.GAL.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAAC
TRI.AE_C        CAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGA
                   * ****    ***  **    ** ******    **   ****   *   * **   

GAL.GAL.        GGGATCGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCTGTC
TRI.AE_C        AGGATAACGG--GCCGCTG--CACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCG
                 ****  **   *    *   **** *   *  ** *****  * ****     ** *  

GAL.GAL.        TCC------
TRI.AE_C        ACCACCATC
                 **      

[Download ClustalW]

#4

Mean pairwise ID: 31.05%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRI.AE_C        ------------------------------------------------------------
                                                                            

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGT-CCGTGCCAAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                    ** * * *  *** **  *   **

CAE.EL_D        CGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
TRI.AE_C        TAGTGGACCGCTTGGGGC---CTATGCGAAAGTTGGGCCTCACGG-TCCATAATGTGGCA
                   *    * *  ****    ** *  *** *  *    ** *** * ***** * * * 

CAE.EL_D        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCG
TRI.AE_C        GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
                 * *  *     * * *     *   *****  * **  * **** *    * ****  *

CAE.EL_D        GAC--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTA
TRI.AE_C        GATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAG--CGACCA
                **   ** **   *    *   *  *       ****  * *    ** ***  *    *

CAE.EL_D        TCATTT
TRI.AE_C        CCATC-
                 ***  

[Download ClustalW]

#5

Mean pairwise ID: 31.13%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
TRI.AE_C        ------------------------------------------------------------
                                                                            

DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAGC
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                    ** * * *  *** *  * *    

DRO.MEL.        TTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGAT
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGT---TGGGCCTCACGGTCCATAATGTGGCAG
                * *    *    ****  * ***    ***   ***   *** * *   *** * ** * 

DRO.MEL.        GAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGGG
TRI.AE_C        GCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGG
                * **** *  ***  **    *   ****** *  * * ****       * ** *  **

DRO.MEL.        ATAGCGTACCGGAGTGGACTGCCGTTA-TCAGCCCAACCGATATGGTTGGACCACAATCT
TRI.AE_C        ATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCACCA
                *** **  ***  *    *    *    *  * **        *  *    * ** * * 

DRO.MEL.        TT
TRI.AE_C        TC
                * 

[Download ClustalW]

#6

Mean pairwise ID: 31.37%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRI.AE_C        ------------------------------------------------------------
                                                                            

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGT-CCGTGCCAAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                    ** * * *  *** **  *   **

CAE.EL_A        CGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
TRI.AE_C        TAGTGGACCGCTTGGGGC---CTATGCGAAAGTTGGGCCTCACGG-TCCATAATGTGGCA
                   *    * *  ****    ** *  *** *  *    ** *** * ***** * * * 

CAE.EL_A        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCG
TRI.AE_C        GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
                 * *  *     * * *     *   *****  * **  * **** *    * ****  *

CAE.EL_A        GAC--CGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTA
TRI.AE_C        GATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAG--CGACCA
                **   ** **   **   *   *  *       ****  * *    ** ***  *    *

CAE.EL_A        TCATTT
TRI.AE_C        CCATC-
                 ***  

[Download ClustalW]

#7

Mean pairwise ID: 31.80%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
TRI.AE_C        ------------------------------------------------------------
                                                                            

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRI.AE_C        ----------------------------------------GGTGGTCTGCCCGTTCCAAG
                                                        * * *  ** ***  * ***

ORI.CUN.        TTCGGCATCAATATGGT--GACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRI.AE_C        TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTC-CATAATGTGG
                **  * *       * *  *  *    * **  *  ** ** *  ***  * *** * **

ORI.CUN.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
TRI.AE_C        CAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGA
                   * ****    ***  **    ** ******    **   ****     * * ** * 

ORI.CUN.        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTG
TRI.AE_C        AGGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCA
                 ****  ** ***  ** *   * *   * **   **** *    *    * **   *  

ORI.CUN.        TCTCC
TRI.AE_C        CCATC
                 *  *

[Download ClustalW]

#8

Mean pairwise ID: 31.91%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
TRI.AE_C        ------------------------------------------------------------
                                                                            

XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
TRI.AE_C        --------------------------------------GGTGGTCTGCCCGTTCCAAGTT
                                                      * * *  ** ***  * *****

XEN.LAE.        CGGTATCAATATGGT--GTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGG
TRI.AE_C        GAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGT--CCATAATGTGGC
                  ***       * *  *  ***  * **   * **  * *  ***  *  *** * ** 

XEN.LAE.        GTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTG
TRI.AE_C        AGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAA
                  * ****    ***  **    ** ******    **   ****   * * * ** *  

XEN.LAE.        GGAT--CGCGCCTGTGAATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGT
TRI.AE_C        GGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCAC
                ****  ** ***  ** *   *  *  *      ****      *    * **  **   

XEN.LAE.        TCT-
TRI.AE_C        CATC
                  * 

[Download ClustalW]

#9

Mean pairwise ID: 31.94%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
LYC.ES_D        ------------------------------------------------------------
                                                                            

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
LYC.ES_D        -----------------------------------TAGTTCTGGCCTGCCCTGTCCAAGC
                                                   *     * *  ** **   * *** 

FUG.RUB.        TCGGTATCGA--TATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGG
LYC.ES_D        ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT--CCTAAAGCGGG
                 * *  * *    * *  ** *    *  *    *** *       *  ***** * ***

FUG.RUB.        GTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTG
LYC.ES_D        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAA
                * *  ***    ***  **    **  *****   * *** ****  * *  **** *  

FUG.RUB.        GGAT--CGCGCCCGTG----AATAGACGCTGTAGTTCAACCTGAGTAACAC-AGCGGGAC
LYC.ES_D        GGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAAC
                ****   * * * ***    *  *    * ***   *    ** **  * * * *   **

FUG.RUB.        TCAGTCTTT-
LYC.ES_D        CACCACTTTT
                     **** 

[Download ClustalW]

#10

Mean pairwise ID: 32.03%


LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCTGG
LYC.ES_D        -----------------TAGTTCTGGCCTGCCCTGTCCAAGCACAGAGTAGGATCACGAG
                                 **    * *   **  *  ***     * **   * *  *  *

LEP.COL.        ACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGAGGCC
LYC.ES_D        GCCCAAATGAAA--------ATATGGGCTTCTTGATTCCTAAAGCGGGGCG--GACCGCA
                 **   **               * * * *  ** *       ** * * *  *   ** 

LEP.COL.        TCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAGGAACTGGGTCA
LYC.ES_D        TGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT--GTGCAGTGGAAGGATAATG
                *  ** ** *  *    ** ** *    ** *** *  *    * ** ****        

LEP.COL.        GGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGCAG-AACCACACCGCGGA
LYC.ES_D        GGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGG--GTTGCTCCAACTAAACCACCAC
                ** ***   *  * **       *  ***      *  *****   *** * *** *   

LEP.COL.        GCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT
LYC.ES_D        TTTT-------------------------------------
                   *                                     

[Download ClustalW]

#11

Mean pairwise ID: 32.03%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
TRI.AE_C        ------------------------------------------------------------
                                                                            

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRI.AE_C        ----------------------------------------GGTGGTCTGCCCGTTCCAAG
                                                        * * *  ** ***  * ***

RAT.RAT.        TTCGGCATCAATATGGT--GACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRI.AE_C        TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCC-TCACGGTCCATAATGTGG
                **  * *       * *  *  *    * **  *  ** **  ** * * * *** * **

RAT.RAT.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
TRI.AE_C        CAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGA
                   * ****    ***  **    ** ******    **   ****     * * ** * 

RAT.RAT.        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCG
TRI.AE_C        AGGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCG-TAGCCTACTCCAGCGACC
                 ****  ** ***  ** *   * *   * **   **** *  * * **      *  * 

RAT.RAT.        TCTCTT
TRI.AE_C        ACCATC
                 *  * 

[Download ClustalW]

#12

Mean pairwise ID: 32.03%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
TRI.AE_C        ------------------------------------------------------------
                                                                            

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRI.AE_C        ----------------------------------------GGTGGTCTGCCCGTTCCAAG
                                                        * * *  ** ***  * ***

HOM.SA_A        TTCGGCATCAATATGGT--GACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRI.AE_C        TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCC-TCACGGTCCATAATGTGG
                **  * *       * *  *  *    * **  *  ** **  ** * * * *** * **

HOM.SA_A        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
TRI.AE_C        CAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGA
                   * ****    ***  **    ** ******    **   ****     * * ** * 

HOM.SA_A        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCG
TRI.AE_C        AGGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCT-CGTAGCCTACTCCAGCGACC
                 ****  ** ***  ** *   * *   * **   ****  * * * **      *  * 

HOM.SA_A        TCTCTT
TRI.AE_C        ACCATC
                 *  * 

[Download ClustalW]

#13

Mean pairwise ID: 32.26%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
TRI.AE_C        ------------------------------------------------------------
                                                                            

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
TRI.AE_C        ---------------------------------------GGTGGTCTGCCCGTTCCAAGT
                                                       * * *  ** **** * ****

FUG.RUB.        TCGGTATCGA----TATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAG
TRI.AE_C        TGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCAC--GGTC-CATAATGTG
                *  ***  *       *** **   ** *  **   **  ****  **** * *** * *

FUG.RUB.        GGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAG
TRI.AE_C        GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG
                *   ** ***    ***  **    **  *****    **   ****   *   * ** *

FUG.RUB.        TGGGATCGCGCCCGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAGT
TRI.AE_C        AAGGATAACGG--GCCGCTGCACTCC-TAGGCCG-CTTGGGCCTCGTAGCCTACTCCAGC
                  ****  **   *    *  ** *  ***  *  * ** *   *  ***      *** 

FUG.RUB.        CTTT------
TRI.AE_C        GACCACCATC
                          

[Download ClustalW]

#14

Mean pairwise ID: 32.35%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
TRI.AE_C        ------------------------------------------------------------
                                                                            

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCG--TCCGTGCCAA
TRI.AE_C        ------------------------------------GGTGGTCTGCCCGTTCCAAGTTGA
                                                    ** *  *   *   ***  *   *

CAE.BRI.        GCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
TRI.AE_C        GTAGTGGACCGCTTGGGGCCT---ATGCGAAAGTTGGGCCTCACGGTC-CATAATGTGGC
                *   **   ***  **** **    *  *** * ***   ** *** * ***** * *  

CAE.BRI.        GTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCC
TRI.AE_C        AGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAA
                  **** **    *** *     *   *****  * **    ****      * ****  

CAE.BRI.        GGATAGCG--CTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTT
TRI.AE_C        GGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAG--CGACC
                ***** **  *   **   *      *  *    *****   *    ** ***  *    

CAE.BRI.        GTCATT
TRI.AE_C        ACCATC
                  *** 

[Download ClustalW]

#15

Mean pairwise ID: 32.47%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
TRI.AE_C        ------------------------------------------------------------
                                                                            

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRI.AE_C        ----------------------------------------GGTGGTCTGCCCGTTCCAAG
                                                        * * *  ** ***  * ***

RAT.NOR.        TTCGGCATCAATATGGT--GACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRI.AE_C        TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTC-CATAATGTGG
                **  * *       * *  *  *    * **  *  ** ** *  ***  * *** * **

RAT.NOR.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
TRI.AE_C        CAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGA
                   * ****    ***  **    ** ******    **   ****     * * ** * 

RAT.NOR.        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGG----CAACATAGCGAGAC
TRI.AE_C        AGGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCA
                 ****  ** ***  ** *   * *   * **   **** *      *    *****   

RAT.NOR.        CCGTCTCT
TRI.AE_C        CCATC---
                ** **   

[Download ClustalW]

#16

Mean pairwise ID: 32.47%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_D        ------------------------------------------------------------
                                                                            

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
LYC.ES_D        ----------------------------TAGTTCTGGCCTGCCC--TGTCCAAGCACAGA
                                            * **    * *  **    ****  **  ** 

CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
LYC.ES_D        GTAGGATCACGAGGCCCAAAT-----GAAAATATGGGCTTCTTGATTCCTAAAGCGGGGC
                *     **** ***    **      ***         * *  * * * *** * *  * 

CAE.EL_D        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGG
LYC.ES_D        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGG
                ***  *     * * *     *   *****  ** ***  ****   *********  **

CAE.EL_D        AC--CGCGCTTGTAAGTTGACACACATA-CACAGCCTTCTCGATACCTTCAGACCACTTA
LYC.ES_D        ATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCA
                *    * *   **   **  **     *  *  ****  * * *  ** **    *   *

CAE.EL_D        TCATTT--
LYC.ES_D        CCACTTTT
                 ** **  

[Download ClustalW]

#17

Mean pairwise ID: 32.68%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
TRI.AE_C        ------------------------------------------------------------
                                                                            

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRI.AE_C        ----------------------------------------GGTGGTCTGCCCGTTCCAAG
                                                        * * *  ** ***  * ***

CAN.SPE.        TTCGGCATCAATATGGT--GACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRI.AE_C        TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTC-CATAATGTGG
                **  * *       * *  *  *    * **  *  ** ** *  ***  * *** * **

CAN.SPE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
TRI.AE_C        CAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGA
                   * ****    ***  **    ** ******    **   ****     * * ** * 

CAN.SPE.        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAG-CGAGACCCC
TRI.AE_C        AGGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCT-CGTAGCCTACTCCAGCGACC
                 ****  ** ***  ** *   * *   * **   ****  * * * **  * **   **

CAN.SPE.        GTCTCT
TRI.AE_C        ACCATC
                  *   

[Download ClustalW]

#18

Mean pairwise ID: 32.74%


LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCTGG
TRI.AE_C        ---------------------------GGTGGTCTGCCCGTTCCAAGTTGAGTAGT--GG
                                           **   *   ** * *  *    ***  **  **

LEP.COL.        ACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGAGGCC
TRI.AE_C        ACC-GCTTGGGGCCTATGCGAAAGTTG---GGCCTCACGGTCCATAATGTGGCAGGCACC
                *** ** * ***    ****    *     **      * *      **** * *   **

LEP.COL.        TCCGGGTGCCCCCTT-GCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAGGAACTGGGTC
TRI.AE_C        GCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAAC
                 *  *  **   ***  ****   *   *  *  * *  **  *   * ****      *

LEP.COL.        AGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGCAGAACCACACCGCGGA
TRI.AE_C        GGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGAC-CACCATC--
                 *****          ** ** * * *  * ***   *   * ***   * ****     

LEP.COL.        GCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT
TRI.AE_C        -----------------------------------------
                                                         

[Download ClustalW]

#19

Mean pairwise ID: 32.79%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_D        ------------------------------------------------------------
                                                                            

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
LYC.ES_D        ----------------------------TAGTTCTGGCCTGCCC--TGTCCAAGCACAGA
                                            * **    * *  **    ****  **  ** 

CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
LYC.ES_D        GTAGGATCACGAGGCCCAAAT-----GAAAATATGGGCTTCTTGATTCCTAAAGCGGGGC
                *     **** ***    **      ***         * *  * * * *** * *  * 

CAE.EL_A        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGG
LYC.ES_D        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGG
                ***  *     * * *     *   *****  ** ***  ****   *********  **

CAE.EL_A        AC--CGCGCTTGTGAGTTGACACACATACGCA-GCCTTCTCGATACCTTCAGACCACTTA
LYC.ES_D        ATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCA
                *    * *   ***  **  **     *   * ****  * * *  ** **    *   *

CAE.EL_A        TCATTT--
LYC.ES_D        CCACTTTT
                 ** **  

[Download ClustalW]

#20

Mean pairwise ID: 32.79%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
LYC.ES_D        ------------------------------------------------------------
                                                                            

DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAGC
LYC.ES_D        -----------------------------------TAGTTCTGGCCTGCCCTGTCCAAGC
                                                   *  *   **   * **   * ****

DRO.MEL.        TTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGAT
LYC.ES_D        ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGC
                      *        * * *    * **     ***  ***  * *  **** * ***  

DRO.MEL.        GAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGGG
LYC.ES_D        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGG
                * ****    ***  **    *   *****  ** ** *****   *  ***** *  **

DRO.MEL.        ATAGCGTACCGGAGTGGACTGCCGTT-ATCA--GCCCAACCGATA----TGGTTGGACCA
LYC.ES_D        ATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCA
                ***  *   *** **    *   *** *  *  *** **  * *         *  ****

DRO.MEL.        CAATCTTT
LYC.ES_D        CCACTTTT
                * *  ***

[Download ClustalW]

#21

Mean pairwise ID: 33.01%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
LYC.ES_D        ------------------------------------------------------------
                                                                            

XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
LYC.ES_D        ----------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCA
                                                  *     * *  ** **   * ***  

XEN.LAE.        CGGTATCA-ATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGG
LYC.ES_D        CAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT--CCTAAAGCGGGG
                * *  *   **   * *  **    * *     **    *  * **   **** * ****

XEN.LAE.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGG
LYC.ES_D        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 * ****    ***  **    ** ******   * * * ****  * *  **** *  *

XEN.LAE.        GAT--CGCGCCTGTGAATAGCCG-GTGCAGAACAGCCTGAACAACA----CAGCGAGAC-
LYC.ES_D        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC
                ***   * * * ***  *   *  ** *** *  **** *          ** * * ** 

XEN.LAE.        ACAGTTCT-
LYC.ES_D        ACCACTTTT
                **   * * 

[Download ClustalW]

#22

Mean pairwise ID: 33.01%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
TRI.AE_C        ------------------------------------------------------------
                                                                            

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
TRI.AE_C        ----------------------------------------GGTGGTCTGCCCGTTCCAAG
                                                        * ***  ** ***  * ***

HOM.SA_B        TTCGGCATCAATATGGT--GACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRI.AE_C        TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTC-CATAATGTGG
                **  * *       * *  *  *    * **  *  ** ** *  ***  * *** * **

HOM.SA_B        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
TRI.AE_C        CAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGA
                   * ****    ***  **    ** ******    **   ****     * * ** * 

HOM.SA_B        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGAGCAACATAG-CGAGACCCC
TRI.AE_C        AGGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTC-GTAGCCTACTCCAGCGACC
                 ****  ** ***  ** *   * *   * **   ****  * * * **  * **   **

HOM.SA_B        GTCTCT
TRI.AE_C        ACCATC
                  *   

[Download ClustalW]

#23

Mean pairwise ID: 33.12%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
LYC.ES_D        ------------------------------------------------------------
                                                                            

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
LYC.ES_D        --------------------------------TAGTTCTGGCC---TGCCCTGTCCAAGC
                                                 *     * **    * **   ******

CAE.EL_C        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGGT
LYC.ES_D        ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGC
                 * * **        ** * *     *** **      * *  * * * *** * * ** 

CAE.EL_C        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGG
LYC.ES_D        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGG
                ***  *     * * *     *   *****  ** ***  **** * *********  **

CAE.EL_C        ACAGCGCTT--GTGAGTTGACACGTATA-CACAGCCTTCTCAATACCTTCAGACCACTTG
LYC.ES_D        ATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCA
                * *  *  *  ***  **  ** **  *  *  ****  *   *  ** **    *    

CAE.EL_C        TCACT---
LYC.ES_D        CCACTTTT
                 ****   

[Download ClustalW]

#24

Mean pairwise ID: 33.12%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
LYC.ES_D        ------------------------------------------------------------
                                                                            

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGT-CCGCGCTAA
LYC.ES_D        --------------------------------------TAGTTCTGGCCTGCCCTGTCCA
                                                        *  * *** * **  *   *

GAL.GAL.        GGCCGGCATCAATATGGTGAGCCCCGGG-GAGCCGAGGCACACCAGGTTGCCTAAGGAGG
LYC.ES_D        AGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGG
                 **    *  *  **   *** ***    **    * *  *  *  * * ***** * **

GAL.GAL.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAAC
LYC.ES_D        GGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGA
                ** * ****    ***  **    ** ******   * * ******  * *  ****   

GAL.GAL.        GGGAT--CGCGCCTGTGAATAGCCAC-TGCAGCGTAGCCT----GGGCAACATAGCGAGA
LYC.ES_D        AGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAA
                 ****   * * * ***  *   **  * ***    ****    **       * * * *

GAL.GAL.        CCCTGTCTCC-
LYC.ES_D        CCACCACTTTT
                **    **   

[Download ClustalW]

#25

Mean pairwise ID: 33.45%


LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
TRI.AE_C        ------------------------------------------------------------
                                                                            

LEI.MAJ.        CAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGCTGTGTGTCGGTGTGGC
TRI.AE_C        -----------------------GGTGGTCTGCCCGTTCCAAGTTGAGTAGTGGACCGCT
                                       *  *   *** * * *   * ** **   **   *  

LEI.MAJ.        TTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAACCGGGTCAGGCC
TRI.AE_C        TGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCACCGCGTGAGGCT
                * *  **  ***  * * ***  *       ** *      *  ** **** ** **** 

LEI.MAJ.        GGAA--ACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCA-GAATCACACCGCGGAGC
TRI.AE_C        GGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAACGGGCCGCTGC
                **    ** *******     *  * * * ***  ** ** * * ** **    **  **

LEI.MAJ.        ATGTCCG---CACTTGAGCCCCAC-GCTTCGTCGCGAAGCCTT----
TRI.AE_C        ACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCACCATC
                *   *     * **** *** *   ** *  **  *   **      

[Download ClustalW]

#26

Mean pairwise ID: 33.59%


SCH.POM.        CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCA-ATAGTGCATGTTCGGTGGTCTC
LYC.ES_D        -------------TAGTTCTGGCCTGCCCTGTCCAAGCACAGAGTAGGATCACGAGGCCC
                             * **    *  *    *   *    * ** * * * **    * * *

SCH.POM.        GGGTTCGAGTCTCGCTTTC--GATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTT
LYC.ES_D        AAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGACCGCATGAGGCTGGCTTCA
                   *   * * * *  ***  *** ***  * * *    * * *   ** *     *   

SCH.POM.        CGTGGCAACTGGCAGTTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCAC
LYC.ES_D        CAGAGCAGTGAACAGCTC--CCGCTCTGTGCAGTGGAAGGAT--AATGGGTCGGTGTC-T
                *   ***     *** *   ***    ** * *  * *** *  **    *     **  

SCH.POM.        TACCGGGTCTTGGGCAGTGCGATAGCGATGGGATTCACCTTCGCAGGATGTGCATGGAAG
LYC.ES_D        TATCAAG--TTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCACCACTTTT-------
                ** *  *  **  * *  **   *  * * *     **     **  *  *         

SCH.POM.        TATAAACACAACGGTCGTT
LYC.ES_D        -------------------
                                   

[Download ClustalW]

#27

Mean pairwise ID: 33.70%


YAR.LI_A        CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTTCGAGTC
TRI.AE_C        -------------------------------------------GGTGGTCTGCCCG--TT
                                                            ** **  *  **  * 

YAR.LI_A        TTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCT
TRI.AE_C        CCAAGTTGAGTAGTGGACCGCTTGG-----------GGCCTATGCGAAAGTTGGGCCTCA
                    * *  * * * * **  ****           *   * ****   * ***** ** 

YAR.LI_A        CGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGA
TRI.AE_C        CGGTCC--ATAATGTGGCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGC
                *****    ****  *    *        *      * ** ** * * * *  **   * 

YAR.LI_A        GCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATCGCAACCAAGTGGTAT
TRI.AE_C        CCGCTTC--CAACGGTGGAAGGATAACGGGC----CGCTGCACTCCTAGGCCGCT--TGG
                 *  * *  **  * *  *        ***     ** **   **  *  *   *  *  

YAR.LI_A        ATGTTATGGAAGATATTTACGATCACGATT
TRI.AE_C        GCCTCGTAGCCTACTCCAGCGACCACCATC
                   *  * *   *      *** *** ** 

[Download ClustalW]

#28

Mean pairwise ID: 34.08%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
LYC.ES_D        ------------------------------------------------------------
                                                                            

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
LYC.ES_D        -----------------------------------TAGTTCTGGCCTGCCCTGTCCAAGC
                                                     *     *   * **   ******

CAE.BRI.        GCTGCGTCG--CCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
LYC.ES_D        ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGC--TTCTTGATTCCTAAAGCGGG
                 * * ** *   ** * * * *   *   **    ***  * *  *   * *** * * *

CAE.BRI.        GTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCC
LYC.ES_D        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAA
                * * ** **    *** *     *   *****  ** ***  **** * *********  

CAE.BRI.        GGATAGCGCTT--GTGAGTTGTC--GCTCGCCCACAGCCTCTCTGATACCTTCAGACCAC
LYC.ES_D        GGATAATGGGTCGGTGTCTTATCAAGTTCAGTAAC-GCCTAATGGGTTGCTCCAACTAAA
                *****  *  *  ***  ** **  * **    ** ****    * *  ** **    * 

CAE.BRI.        TTGTCATT---
LYC.ES_D        CCACCACTTTT
                    ** *   

[Download ClustalW]

#29

Mean pairwise ID: 34.19%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
LYC.ES_D        ------------------------------------------------------------
                                                                            

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
LYC.ES_D        ------------------------------------TAGTTCTGGCCTGCCCTGTCCAAG
                                                    *     ***  ** **   * ***

HOM.SA_B        TTCGGCATCA-ATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
LYC.ES_D        CACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT-CCTAAAGCGGG
                  * *  *   **   * * **     * *     ** *  *  * ** ***** * ***

HOM.SA_B        GTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTG
LYC.ES_D        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAA
                * * ****    ***  **    ** ******   * * ******  ***  **** *  

HOM.SA_B        GGAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCTGAGCAACA----TAGCGAGAC
LYC.ES_D        GGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAAC
                ****   * * * ***  *   **  * ** *   **** *           * * * **

HOM.SA_B        CCCGTCTCT-
LYC.ES_D        CACCACTTTT
                * *  ** * 

[Download ClustalW]

#30

Mean pairwise ID: 34.29%


TRY.BR_A        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
TRI.AE_C        -----------------------------GGTGGTCTGCCCGTTCCAAGTTGA-GTAGTG
                                             ** * *   **** *    *  ** **  **

TRY.BR_A        GACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGG----TG
TRI.AE_C        GACCGCTTGGGGCCTA--TGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCACCG
                ***     ****      ****     * **  *   * *   *   *** * *     *

TRY.BR_A        T-TGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-TTAAAGTGGGGGGAACGGGTCA
TRI.AE_C        CGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAACG
                  *****  * *     ****  ***    *   *** **  *  ** ** *      * 

TRY.BR_A        GGCCGGTGACGGAGCAGCCCACCTTGCGCACGTT-CCCGTTCGAGAAGCACACCGAGGAG
TRI.AE_C        GGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGAC-CACCATC---
                ***** **       ** ** * * *  * ***  **   ** **   * ****      

TRY.BR_A        CATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
TRI.AE_C        ----------------------------------------
                                                        

[Download ClustalW]

#31

Mean pairwise ID: 34.30%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_D        ------------------------------------------------------------
                                                                            

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
LYC.ES_D        --------------------------------TAGTTCTGGCC---TGCCCTGTCCAAGC
                                                 *     * **    * **   ******

CAE.EL_B        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGGT
LYC.ES_D        ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGC
                 * * **        ** * *     *** **      * *  * * * *** * * ** 

CAE.EL_B        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGG
LYC.ES_D        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGG
                ***  *     * * *     *   *****  ** ***  **** * *********  **

CAE.EL_B        AC--TGCGCTTGTGAGTTGACACGTATA-CACAGCCTTCTCAATACCTTCAG----ACCA
LYC.ES_D        ATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCA
                *   ** *   ***  **  ** **  *  *  ****  *   *  ** **     ****

CAE.EL_B        CTTGTTTTT
LYC.ES_D        CCACTTTT-
                *   **** 

[Download ClustalW]

#32

Mean pairwise ID: 34.68%


COL.BLU.        CCGAACCTCATTACCTTGGCCTGTTACCCCA---AGTTGGGGGTCTTTAA-GGTTATTTG
MUS.MU_A        ------------------GCCTGTAGTTCCAGCTACTCGGGAGGCTGAGACAGGAGGATC
                                  ******    ***   * * *** * **   *  *     * 

COL.BLU.        ATKTTKGGCCTATGCTACCKGCCKGGCTCTGGTCCTGCTTATTCTGGCCCGCCCGTTCCA
MUS.MU_A        GCTTGAGTCCAAGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGG---TGTCCGCACTA
                   *  * ** *   * *  * * *      *   ***  **   *    * ***  * *

COL.BLU.        AGCCGGGAGTTGGCCCATGTGGTTTATGCGAAGGTATAGGCTTCGGTGGTTCC
MUS.MU_A        AGTTCGGCAACAATATG-GTGACCTCCCGGGAGCGGGGGACCACCAAGTTGC-
                **   **           ***   *    * **     * *  *   * * * 

[Download ClustalW]

#33

Mean pairwise ID: 34.95%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
LYC.ES_D        ------------------------------------------------------------
                                                                            

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_D        -----------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACAGAG
                                             *       ***   *  **    ****  **

RAT.NOR.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
LYC.ES_D        T--AGGATCA---CGAGGCCCAAATGAAAATATGGG-CTTCTTGATT-CCTAAAGCGGGG
                *   * ****    *  * **    *  *    *** *  *  * ** ***** * ****

RAT.NOR.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
LYC.ES_D        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 * ****    ***  **    ** ******   * * ******  ***  **** *  *

RAT.NOR.        GAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCT---GGGCAACATAGCGAGACCC
LYC.ES_D        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC
                ***   * * * ***  *   **  * ** *   ****   ***   *        * **

RAT.NOR.        GTCTCT---
LYC.ES_D        ACCACTTTT
                  * **   

[Download ClustalW]

#34

Mean pairwise ID: 35.14%


TRY.BR_B        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
LYC.ES_D        ------------TAGTTCTG--GCCTGCCCTGTCCAAGCACA--GAGTAGGATCACGAGG
                            * * ****   *** *   * *  * * *    **  **  *     *

TRY.BR_B        GACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGTGTTGA
LYC.ES_D        CCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGAC-CGCAT-GAGGCTGG
                  ***  *    *   *     **** *       * *   **   **  * *  * ** 

TRY.BR_B        GGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGGGTCAGGCCGG
LYC.ES_D        CTTCAC-AGAGCAGTGAACAGCTCCCGCTCTGT-GCAGTGGAAGGATAA---TGGGTCGG
                  ** * *  * ** **   * ** *** * **   *****  ***        ** ***

TRY.BR_B        TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCACACCGAGGAGCATCTCA
LYC.ES_D        TGTCTTATCAAGTTCAGTAACGCCTAATGG-GTTGCTCCAACTAAACCACCACTTTT---
                ** *  * **       *  ***    *   *****   * *  * * *  *   *    

TRY.BR_B        GGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT
LYC.ES_D        ------------------------------------
                                                    

[Download ClustalW]

#35

Mean pairwise ID: 35.18%


ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
LYC.ES_D        ------------------------------------------------------------
                                                                            

ZEA.MA_H        AATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAAGTTG
LYC.ES_D        ---------------------------------TAGTTCTGGCCTGCCCTGTCCAAGC-A
                                                  *  * *** *  ***  ******   

ZEA.MA_H        CGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCC--AACACTAAAGTGGCGGA
LYC.ES_D        CAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCG
                *  *** ** *   ** ***     ****   * *  * *   *   ****** ** *  

ZEA.MA_H        CATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGAAGGA
LYC.ES_D        GACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA
                 *  ** ************** ******* **  * * *****     ** *********

ZEA.MA_H        TAATGAGTCGCTATGCTAT-AGGCCCAAT-------------------------------
LYC.ES_D        TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCAC
                ***** **** * *  *** * *  ** *                               

ZEA.MA_H        -------
LYC.ES_D        CACTTTT
                       

[Download ClustalW]

#36

Mean pairwise ID: 35.23%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAGTCAGA
LYC.ES_D        ------------------------------------------------------------
                                                                            

TET.ROS.        GTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGAGTTGCT
LYC.ES_D        ------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACAGAGTAGG-
                                        *  *    *  *****  ***** **  **** *  

TET.ROS.        ATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAG-GAACCGCCTC
LYC.ES_D        ATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGACCGCATG
                **   *    ** * * * *  *          *  *   * *** * * * ***** * 

TET.ROS.        AGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATAACATACT
LYC.ES_D        AGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATGGGTC
                ********   ***** *** *** *  * *****   **  ************      

TET.ROS.        CATTAACTGTCAAGCTAATCGGTTCT------GCTATTCTGATCAGAC-ACT------
LYC.ES_D        GGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCACCACTTTT
                  *    * ***** * *      *       * *  **  *  * ** **       

[Download ClustalW]

#37

Mean pairwise ID: 35.28%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
LYC.ES_D        ------------------------------------------------------------
                                                                            

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_D        -----------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACAGAG
                                             *       ***   *  **    ****  **

CAN.SPE.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
LYC.ES_D        T--AGGATCA---CGAGGCCCAAATGAAAATATGGG-CTTCTTGATT-CCTAAAGCGGGG
                *   * ****    *  * **    *  *    *** *  *  * ** ***** * ****

CAN.SPE.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
LYC.ES_D        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 * ****    ***  **    ** ******   * * ******  ***  **** *  *

CAN.SPE.        GAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCT----GTGCAACATAGCGAGACC
LYC.ES_D        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC
                ***   * * * ***  *   **  * ** *   ****    *        * * * ***

CAN.SPE.        CCGTCTCT-
LYC.ES_D        ACCACTTTT
                 *  ** * 

[Download ClustalW]

#38

Mean pairwise ID: 35.53%


TRY.BR_A        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
LYC.ES_D        ------------TAGTTCTG--GCCTGCCCTGTCCAAGCACA--GAGTAGGATCACGAGG
                            * * ****   *** *   * *  * * *    **  **  *     *

TRY.BR_A        GACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGTGTTGA
LYC.ES_D        CCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGAC-CGCATGAG-GCTGG
                  ***  *    *   *     **** *       * *   **   **  *  * * ** 

TRY.BR_A        GGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGGGTCAGGCCGG
LYC.ES_D        CTTCAC-AGAGCAGTGAACAGCTCCCGCTCTGT-GCAGTGGAAGGAT---AATGGGTCGG
                  ** * *  * ** **   * ** *** * **   *****  ***        ** ***

TRY.BR_A        TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCGAGAAGCACACCGAGGAGCATCTCA
LYC.ES_D        TGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC----ACCACTTTT
                ** *  * **       *  ***    *    * *   **  * ***    * **  *  

TRY.BR_A        GGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
LYC.ES_D        ---------------------------------
                                                 

[Download ClustalW]

#39

Mean pairwise ID: 35.60%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAA-CACT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *     **    **** ***    *

ARA.TH_G        GGATCGGCCCACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAGCTG
SCH.POM.        TAGTACTCCCAATAGT-GCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCT
                   *   ****   ** * ** *   ** * *   ***  *     * *  ** *  *  

ARA.TH_G        TGAGTGAAC-CGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAGGG
SCH.POM.        CGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAG
                 **     * *** **  * *** * **  **  *    ** *    * **        *

ARA.TH_G        TATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACGGA
SCH.POM.        TACCGATGGAGGTTGGAAACAATGCACATC-ACTACCG--GGTCTTGGGCAGTGCGATAG
                **  *    *** ***   **  *  ** * ******    *   *  ******      

ARA.TH_G        CAACGG--TTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAAC
SCH.POM.        CGATGGGATTCACCTTCGCA-GGATGTGCATGGAAGTATAAACACAACGGTCGTT-----
                * * **  ***  *  * **   **   *   *         * *      ** *     

ARA.TH_G        CACCATTTT
SCH.POM.        ---------
                         

[Download ClustalW]

#40

Mean pairwise ID: 35.60%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
LYC.ES_D        ------------------------------------------------------------
                                                                            

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_D        -----------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACAGAG
                                             *       ***   *  **    ****  **

HOM.SA_A        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
LYC.ES_D        T--AGGATCA---CGAGGCCCAAATGAAAATATGGG-CTTCTTGATT-CCTAAAGCGGGG
                *   * ****    *  * **    *  *    *** *  *  * ** ***** * ****

HOM.SA_A        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
LYC.ES_D        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 * ****    ***  **    ** ******   * * ******  ***  **** *  *

HOM.SA_A        GAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCT----GTGCAACATAGCGAGACC
LYC.ES_D        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC
                ***   * * * ***  *   **  * ** *   ****    *        * * * ***

HOM.SA_A        CCGTCTCTT
LYC.ES_D        ACCACTTTT
                 *  ** **

[Download ClustalW]

#41

Mean pairwise ID: 35.76%


TRY.BR_B        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

TRY.BR_B        GACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCT--GCTTGGTTGCGTGTCGGTGTT
TRI.AE_C        --------------------GGTGGTCTGCCCGTTCCAAGTTGAGTAGTGGACCGCT--T
                                     ** * **    ****   * *  ** * *   ** *  *

TRY.BR_B        GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGGGTCAGGCC
TRI.AE_C        GGGGCCTATGCGAAAGTTGGGC-CTCACGGTCCATAATGTGGCAGGCACCGCGTGAGGCT
                * ** *    *   **   ***  ** **  ** * *    *  ** * ** ** **** 

TRY.BR_B        GG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCACACCGAGGAGCA-
TRI.AE_C        GGCTTCACAGAGCAGCGACAACTGCCCGC-TTCCAACGGTGGAAGGATAACGGGCCGCTG
                **  * ** *******      *** * * ****    *  **** * * ** *  **  

TRY.BR_B        ---TCTCAGGAC-TTTGCGCCCCA-AGTGTCGTCGCGAGGCGGTTT--
TRI.AE_C        CACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCACCATC
                   **  *** *  *** *** *  **  *  **  * * *       

[Download ClustalW]

#42

Mean pairwise ID: 35.76%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                      ***      **** *** * * 

CIN.HYB.        AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCGA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                   *   *  *         **  *  *    **     *  *  * * *** *   *  

CIN.HYB.        GAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGGGGGGC
SCH.POM.        GATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **   *   * * * * *  ** * ** **  *  *      **  *  ** ** *  * 

CIN.HYB.        AATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGAAGGAT
SCH.POM.        ACCGATGGAGGTTGG-------AAACAATGCACATCACTACCGG--GTCTTGGGCAGTGC
                *  *    *** ***        * *   * * * * *****    * **  ** **   

CIN.HYB.        TACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGCCCAACAGGACACCCAT
SCH.POM.        GATAG--CGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGT
                 * *   **  * *  * *   **  *  *   ** ***       ****  **   * *

CIN.HYB.        TT
SCH.POM.        T-
                * 

[Download ClustalW]

#43

Mean pairwise ID: 35.77%


SCH.POM.        CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCG
TRI.AE_C        -----------GGTGGTCTGCCCGTTC--CAAGTTGAGTAGTGGACCGCTTGGGGCCT-A
                             *****     ***    *     * ***** *      * ** **  

SCH.POM.        GGTTCGAGTCTCGCTTTCGATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGT
TRI.AE_C        TGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCA-GGCACCGCGTGAGGCTGGCTTCAC
                 *    ***   ** *      **   ** ** ** * *    **    *  * ****  

SCH.POM.        GGCAACTGGCAGTTAAACCGTGTAGTACCGATGGAGGTTGGA-AACAATGCACATCACTA
TRI.AE_C        AG--AGCAGCGAC--AACTGCCCGCTTCCAACGGTGGAAGGATAACGGGCCGCTGCACTC
                 *  *   **     *** *     * ** * ** **  *** ***    * *  **** 

SCH.POM.        CCGGGTC--TTGGGCAGTGCGATA-GCGATGGGATTCACCTTCGCAGGATGTGCATGGAA
TRI.AE_C        CTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCACCATC-----------------
                *  ** *  ******   *       *    *    **** **                 

SCH.POM.        GTATAAACACAACGGTCGTT
TRI.AE_C        --------------------
                                    

[Download ClustalW]

#44

Mean pairwise ID: 35.92%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
YAR.LI_B        ----AGC--TGTAATGGCATTTTGT---CGGAGTGG------TAAATCGCCTTCTTGTTG
                    ***  ***** *  *  ****   *  *****      ***   *         **

ARA.TH_G        GATCGGCCCACGGGTCGGATTTGTTGTTGGCATAGGTC--TGGACTGCCCAATCCAAGCT
YAR.LI_B        TGC--GTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCG
                     *  *  *    *** *      ***  **  *   **  **  ** *     ** 

ARA.TH_G        GTGAGTGAACCGTATGAACCAAGCGA--AGGTTTGATCCGTACGGTTGCTAAAGGTTGAG
YAR.LI_B        GTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                **   **  *     *  *  **  *   * *****    * ** *     *       *

ARA.TH_G        GGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACG
YAR.LI_B        GATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGT-----ATGGCGGTGG
                * ** * *  * *          *****   *   * **    *         * **  *

ARA.TH_G        GACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAAC
YAR.LI_B        GATAGCAA--CAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC------
                ** * *    * * *    * *  *     * ***        **   ** * *      

ARA.TH_G        CACCATTTT
YAR.LI_B        ---------
                         

[Download ClustalW]

#45

Mean pairwise ID: 35.92%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
LYC.ES_D        ------------------------------------------------------------
                                                                            

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_D        -----------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACAGAG
                                             *       ***   *  **    ****  **

RAT.RAT.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
LYC.ES_D        T--AGGATCA---CGAGGCCCAAATGAAAATATGGG-CTTCTTGATT-CCTAAAGCGGGG
                *   * ****    *  * **    *  *    *** *  *  * ** ***** * ****

RAT.RAT.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
LYC.ES_D        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 * ****    ***  **    ** ******   * * ******  ***  **** *  *

RAT.RAT.        GAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCT----GGGCAACATAGCGAGACC
LYC.ES_D        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC
                ***   * * * ***  *   **  * ** *   ****    **       * * * ***

RAT.RAT.        CCGTCTCTT
LYC.ES_D        ACCACTTTT
                 *  ** **

[Download ClustalW]

#46

Mean pairwise ID: 35.93%


YAR.LI_B        AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTCGAGTTCTG
LYC.ES_D        ------------------------------------TAGTTCTGGCCTGCCCTG--TCCA
                                                    *  ** * *   *  *    **  

YAR.LI_B        GACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCGG
LYC.ES_D        AGCACAGAGTAGGATCAC---GAGGCCCAAATGAAAATATG-GGCTTCTTGATTCCTAAA
                  * * *    **   **   *  * **      ** * ** ** *  * *    **   

YAR.LI_B        TCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA
LYC.ES_D        GCGGGGCGGACCGCAT-GAGGCTGGC-TTCACAGAGCAGT--GAACAGCTC--CCGCTCT
                 * * *    * ** * ***  *  * ***  ***  *    * * *  **    *  * 

YAR.LI_B        ATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATAGCAACAAAGTGGTATATG
LYC.ES_D        GTGCAGTGGAAGGATAATGG--GTCGGTGTCTTATCAAGTT--CAGTAACGCCTAATGGG
                 * ***  **     * * *  ** *** *        * *  **  ** *    **  *

YAR.LI_B        TTATGGAAGGTATTTGCAATCACGACTCTC
LYC.ES_D        TTGCTCCAACTA-----AACCACCACTTTT
                **     *  **     ** *** *** * 

[Download ClustalW]

#47

Mean pairwise ID: 36.10%


LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
LYC.ES_D        ----TAGTTCTGGCCTGCCCTGTCCAAGCACAGAGTAGGATCA-CGAGGCCCAAATGAA-
                     ** ****  ***     * *  *  *  *  *** * * ** **   *  ** * 

LEI.MAJ.        CAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGTGTGGCT
LYC.ES_D        -AATATGGGCTTCTTGATTC-CTAAAGCGGGGCG------GACCGCATG--AGGCTGGCT
                 *    ***    *** * *  * * * ** **       * * *  **   *  *****

LEI.MAJ.        TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAACCGGGTCAG-GCC
LYC.ES_D        T--CACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG-AAGGATAATGGGTCGGTGTC
                *  * *   **** *    ** *  *  *   *  *  *  ***  *  ***** * * *

LEI.MAJ.        GGAAACGGAGCAGCC-CACCCCACGCACGTCCGCCGTTGCAGAATCACACCGCGGAGCAT
LYC.ES_D        TTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCACCACTTTT--------
                  *    *  ***   * **  * *     *  *   *  *  * ***            

LEI.MAJ.        GTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT
LYC.ES_D        -------------------------------------
                                                     

[Download ClustalW]

#48

Mean pairwise ID: 36.30%


YAR.LI_A        CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTTCGAGTC
LYC.ES_D        -------------------------------------TAGTTCTGGCCTGCCCT---GTC
                                                     *  *  **   ***  *   ***

YAR.LI_A        TTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCT
LYC.ES_D        C-AAGCACAGAGTAGGATCACGAGG---CCCAAATGAAAATATG-GGCTTCTTGATTCCT
                    ** * *     *  **   **    **      ** * ** ** *  * *    **

YAR.LI_A        CGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGA
LYC.ES_D        AAAGCGGGGCGGACCGCAT-GAGGCTGGC-TTCACAGAGCAG-TGAACAGCTCCCGC---
                    * * *    * ** * ***  *  * ***  ***  *  **   * ** * *    

YAR.LI_A        GCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATCGCAACCAAGTGGTAT
LYC.ES_D        TCTGTGCAGTGGAAGGATAATGG--GTCGGTGTCTTATCAAGTTCAGTAACGCCTA--AT
                 *  * ***  **     * * *  ** *** *        * **   * *   *   **

YAR.LI_A        ATGTTATGGAAGATATTTACGATCACGATT
LYC.ES_D        GGGTTGCTCCAACTA--AACCACCACTTTT
                  ***     *  **   ** * ***  **

[Download ClustalW]

#49

Mean pairwise ID: 36.33%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
SCH.POM.        -------------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCC
                                           *   *  **     *  * *** *  * * ** 

ZEA.MA_D        TTGCGATG---GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
SCH.POM.        CAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCGATCTG--C
                      **   * *   *** * **** ***      ** ** *  *   *   * *  *

ZEA.MA_D        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
SCH.POM.        CACGTCTGT----TCGAAGAGTAGTCTTCGTGGCAACT---GGCAGTTAAACCGTGTAGT
                ** **  **     *     *  *  ** * ** * **   * *  *  *  * ** ***

ZEA.MA_D        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGT
SCH.POM.        ACCG---ATGG----AGGTTGGAA--ACAATGCA--CATCACTACCGGGTCTTGGGCAGT
                  *    ****    *** ***    ***  ***   ******  *  *  *    * **

ZEA.MA_D        GGGAGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAG
SCH.POM.        GCGATAGCGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGT
                * **     *  **   *  *    *  *     *   *    * *  * **     *  

ZEA.MA_D        ACCACCATCTT
SCH.POM.        T----------
                           

[Download ClustalW]

#50

Mean pairwise ID: 36.36%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAGTG
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAA--GTG
                                                   *    ***    **** ***  ***

ARA.TH_D        GTTCAATTCCTCGGGTCGGACCTGAT--GCTGACATATATCTGAGCTGCCCAGTCCAAGC
SCH.POM.        -TTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCC
                 ** * * *  *   * *  * ** *  *  * *     *  ***   * *  ** *  *

ARA.TH_D        TGTGAGTAATC-TGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGAG
SCH.POM.        CTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGT
                   **     *  ** **    * * * ** ***        * *    * **  **   

ARA.TH_D        GGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGATG
SCH.POM.        AGTACCGATGGAGGTTGGAAACAATGCACATC-ACTACCGGG-TCTTG-GGCAGTGCGAT
                 ***  *   **** ***   **  *  ** * *****     ****   ******    

ARA.TH_D        GATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACC
SCH.POM.        AGCGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT----
                    ** *     *   ** ***       ****     *      * *  ** *     

ARA.TH_D        ACCACTTT
SCH.POM.        --------
                        

[Download ClustalW]

#51

Mean pairwise ID: 36.49%


TET.THE.        -GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATA
SCH.POM.        CGCTGTAATGGCTTGGTCGAAGTGTTTA-GTACTCCCAATAGTGCATGTTCGGTGGTCTC
                 **     * **     *   ** * ** **      ** * ** * ***  *     * 

TET.THE.        GGATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGAGTTG
SCH.POM.        GGGTTCGAGTCTCGCTTTCGATCCCTCG------ATCTGCCACGTCTGTTCGAAGAGTAG
                ** *  ***  *    *  **    * *       * ****   **    * * **** *

TET.THE.        CTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAGGAAACGCCT
SCH.POM.        TCTTCGTGGCAAC-TGGCAGTTAAACCGTGT---AGTACCGATGGAGGTTGGAAACAATG
                   * **** *** * * * *   **         * *   * *      ******    

TET.THE.        CAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGG-ATAACATACT
SCH.POM.        CACATCACTACCGGGTCTTGGGCAGTGCGATAGCGATGGGATTCACCTTCGCAGGATGTG
                **       * * *  *  **  *    *       * *   *         *  **   

TET.THE.        CATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT
SCH.POM.        CATGGAAGTATAAACACAACGGTCGTT------------------
                ***  *     ****  * ****  *                   

[Download ClustalW]

#52

Mean pairwise ID: 36.49%


LEP.COL.        ----------GCCGGAGCCTTG--CTCTGTAACCTTCGGG---GGCTTTCACCAGCTGAA
LYC.ES_L        GTTGGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCCTGCCCTCTCCAAG
                           ** **   ***   ** ***  ***   *   *** * * *   *  * 

LEP.COL.        CAGGGAGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGC
LYC.ES_L        CATGGAG----TTGGATCA-CGTGGCTTAGTCGAAAGACC--TGGGTTGCT-TGATTCCT
                ** ****     **** ** * * *  *  * *          * * **** ** **   

LEP.COL.        TGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAA-G
LYC.ES_L        AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTG
                   ***  *  * *  *  *  **    **     **   **  *  * **** *    *

LEP.COL.        TAGAGGAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGCA
LYC.ES_L        CAGTGGAAGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTC
                 ** ****      * ** * *         ** ***  *  *** *   **   *    

LEP.COL.        GAACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT
LYC.ES_L        CAACTAAACCACCACTTT--------------------------------------
                 *** * *** *                                            

[Download ClustalW]

#53

Mean pairwise ID: 36.65%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGAT-G
YAR.LI_A        -----------------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCG
                                        * * * *    **     *   *  *** *  ** *

ORY.SA_B        CCTGGTCGTT-TGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTC
YAR.LI_A        TCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCACTTG-GCCATTTGGTT-GTCCTTTC
                 **  * *** **** * * *   ** **       ***  * **  **   * ** ***

ORY.SA_B        CAAGTTGCGTAGCGTGTGTGGGGC---GCCTGGGCGAA-GGCTCGAGCGTCCCTGCACCT
YAR.LI_A        CGAATTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTA
                * * **  *  *    ** * * *   * *** *  *  ****      *  * *  *  

ORY.SA_B        AGAGTGGC--GGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCC
YAR.LI_A        AGATTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCG--TGGGTAT
                *** *  *  **  * * *    *     *    *****   *   * ***   *  *  

ORY.SA_B        AACGGTGGAAGGATAACGGGCCGCTGCA-GCCCTGGCC--CGCTTCCGGCCCAAGTGCCT
YAR.LI_A        GGCGGTGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT---
                  ****** *    ***     * *  * *   ***       ** **  *    *    

ORY.SA_B        TCCATGGCAGACCACCACCTTT
YAR.LI_A        ----------------------
                                      

[Download ClustalW]

#54

Mean pairwise ID: 36.69%


LYC.ES_E        GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
SCH.POM.        -------------------------------CGCTGTAATGGCTTGGT--CGAAGTGTTT
                                                *  *  ***    ***   * * * ** 

LYC.ES_E        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGTACAG
SCH.POM.        AGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCG
                 *   *****   *     * * ***** **    *  *     * ** ** *      *

LYC.ES_E        AGTTGGATCATGTGGTCCAATTGAAAGAATGG-GCTACTAGATTCCTAAAGTGGGGTGGA
SCH.POM.        ATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTA
                *  **   * * ** ** **  * *    * * *  *   *     ****  * *  * *

LYC.ES_E        CCCGTG-AGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
SCH.POM.        CCGATGGAGGTTGGAAACAATGCACATCACTA---CCGGGTCTTGGGCAGTGCGATAGCG
                **  ** *** ***   **  *  ** *   *       *  *** ******  *     

LYC.ES_E        ACGGACCGGTGCCTTCCAAGTTC--CATTAATGCCTGATGGGCTGTTCTAGTTAAACTAC
SCH.POM.        ATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAA-ACACAACGGTCGTT-------
                * **       * *  ** * *   ***  * *  * *    *     * ***       

LYC.ES_E        CACATTTT
SCH.POM.        --------
                        

[Download ClustalW]

#55

Mean pairwise ID: 36.76%


YAR.LI_B        AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTCGAGTTCTG
TRI.AE_C        ----------------------------------------GGTGGTCTGCCC--GTTCCA
                                                         ** **  *  *  ****  

YAR.LI_B        GACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCGG
TRI.AE_C        AGTTGAGTAGTGGACCGCTTGG-----------GGCCTATGCGAAAGTTGGGCCTCACGG
                   *  * * *** *  *** *           *   * ****   * ***** ** ***

YAR.LI_B        TCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA
TRI.AE_C        TCCA--TAAT-----GTGGCAGGCACCGCGTGAGGCTGGCT------TCACAGAGCAGCG
                **    ****      **  *    *    * **  *  **         *** * *** 

YAR.LI_B        ATC-CAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATA-GCAACAAAGTGGTATA
TRI.AE_C        ACAACTGCCCGCTTCCAACGGTGGAAGG-ATAACGGGCCGCTGCACTCCTAGGCCGCTTG
                *   * **     ****   *  *  ** **  ***   * *   *  * * *  *  * 

YAR.LI_B        TGTTATGGAAGGTATTTGCAATCACGACTCTC
TRI.AE_C        GGCCTCGTAGCCTACTC-CAGCGACCACCATC
                 *    * *   ** *  **   ** **  **

[Download ClustalW]

#56

Mean pairwise ID: 36.82%


LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
LYC.ES_M        ---------------------CAAGTGGGGATGTTAAGGTGGTGGAATATTGGGCTGTCC
                                     *    **** *    ***    *       *   **  *

LEI.MAJ.        CAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGTGTGGCT
LYC.ES_M        CAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTGTCCAAGCACAGAGTTGGAT
                ***   *   *  *** ** * * *  *   **    * ** *   *    *   *** *

LEI.MAJ.        TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCG----TTGAAGCGAGG-GAACCGGGTCA
LYC.ES_M        CACGAGGCC-CAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGACCGCATGA
                  *    *  ** * *       ***      *     * *** * ** * ****  * *

LEI.MAJ.        GGCCGGAA--ACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAGAATCACACCGCG
LYC.ES_M        GGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATGGGTCG
                *** **    ** ******   **  * * * *     ** ** * ** ** *     **

LEI.MAJ.        GAGCATGTCCGCACTTGA----GCCCCACGCTTCGTCGCGAAGCCTT---------
LYC.ES_M        GTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCTTT
                * *  *   *    *       ***  * *  * *   * *               

[Download ClustalW]

#57

Mean pairwise ID: 36.86%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
SCH.POM.        -------------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCC
                                           *   *  **     *  * *** *  * * ** 

ZEA.MA_E        TTGCGATG---GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
SCH.POM.        CAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCGATCTG--C
                      **   * *   *** * **** ***      ** ** *  *   *   * *  *

ZEA.MA_E        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
SCH.POM.        CACGTCTGT----TCGAAGAGTAGTCTTCGTGGCAACT---GGCAGTTAAACCGTGTAGT
                ** **  **     *     *  *  ** * ** * **   * *  *  *  * ** ***

ZEA.MA_E        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTTCCAACGGT
SCH.POM.        ACCG---ATGG----AGGTTGGAA--ACAATGCA--CATCACTACCGGGTCTTGGGCAGT
                  *    ****    *** ***    ***  ***   ******  * **  *    * **

ZEA.MA_E        GGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAG
SCH.POM.        GCGATAGCGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGT
                * **     * ***   *  *    *  *     *   *    * *  * **     *  

ZEA.MA_E        ACCACCATCTTT
SCH.POM.        T-----------
                            

[Download ClustalW]

#58

Mean pairwise ID: 37.06%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATGC
SCH.POM.        ---------CGCTGTAATGGCTTG--GTCGAAGTGTTTAGTACTCC-CAATAGTGCATGT
                          *  *   *******    *  ** *      *        *  ** *** 

ORY.SA_B        CTGGTCGTTTGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTCCA
SCH.POM.        TCGGTGGTCTCGGGTTCGAGTCT-CGCTTTCGATCC-CTCGATCTGCCACGTCTGTTCGA
                  *** ** *  * ** * **** *** *  * *   * * **  * * ** * **** *

ORY.SA_B        AGTTGCGTAGCGTGTGTGGGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCACCTAGAGTG
SCH.POM.        AG---AGTAGTCTTCGTG--GCAACTGGCAGTTAAACCGTGTAGTACCG-ATGGAGGTTG
                **    ****  *  ***  **  ****  *      ** *     * * *   **  **

ORY.SA_B        GCGGGTATTGCGTGAGGCTGGTTTCACA-GAGCAGCGAG-TACCGCCCGCTTCCAACGGT
SCH.POM.        G-AAACAATGCACATCACTACCGGGTCTTGGGCAGTGCGATAGCGATGGGATTCACCTTC
                *     * ***      **       *  * **** * * ** **   *  * ** *   

ORY.SA_B        GGAAGGATAACGGGCCGCTGCAGCCCTGGCCCGCTTCCGGCCCAAGTGCCTTCCATGGCA
SCH.POM.        GCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT-----------------------
                * * *     *  *    *  *  *    *   * *                        

ORY.SA_B        GACCACCACCTTT
SCH.POM.        -------------
                             

[Download ClustalW]

#59

Mean pairwise ID: 37.10%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGG--TGGGACAC
SCH.POM.        ---------------------------------------CGCTGTAATGGCTTGGTCGAA
                                                       *  *   ****  ***   * 

ARA.TH_F        TGGTTCGGTTCCTCGGATCGGTTCTGAT--GTGGGCATGTTTCTGAGCTGCCCAGTCCAA
SCH.POM.        GTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGAT
                  ***  ** *  *  ** *    ** *  **** *  *  *  ***   * *  ** * 

ARA.TH_F        GCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGC--TTGCAGGTTCTAGAGTCGG
SCH.POM.        CCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGT
                 *   **      *    **     ** * ** *** *      * **   *  *  ** 

ARA.TH_F        AGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGA
SCH.POM.        GTAGTACCGATGGAGGTTGGAAACAATGCACATC-ACTAC--CGGGTCTTGGGCAGTGCG
                   ***  *   **** ***   **  *  ** * *****  *  *  *   ******  

ARA.TH_F        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAA
SCH.POM.        ATAGCGATGGGATTCACCTTCGCAGGATGTGCATGG-----AAGTATAAACACA-----A
                      * **  *       * *** *     ****       **   * * **     *

ARA.TH_F        CCACCATTTT
SCH.POM.        CGGTCGTT--
                *   * **  

[Download ClustalW]

#60

Mean pairwise ID: 37.10%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGG--TGGGACAC
SCH.POM.        ---------------------------------------CGCTGTAATGGCTTGGTCGAA
                                                       *  *   ****  ***   * 

ARA.TH_A        TGGTTCGGTTCCTCGGATCGGTTCTGAT--GTGGGCATGTTTCTGAGCTGCCCAGTCCAA
SCH.POM.        GTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGAT
                  ***  ** *  *  ** *    ** *  **** *  *  *  ***   * *  ** * 

ARA.TH_A        GCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGG
SCH.POM.        CCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGT
                 *   **      *    **     ** * ** *** *      * **   *  *  ** 

ARA.TH_A        AGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGA
SCH.POM.        GTAGTACCGATGGAGGTTGGAAACAATGCACATC-ACTAC--CGGGTCTTGGGCAGTGCG
                   ***  *   **** ***   **  *  ** * *****  *  *  *   ******  

ARA.TH_A        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAA
SCH.POM.        ATAGCGATGGGATTCACCTTCGCAGGATGTGCATGGA-----AGTATAAACACA-----A
                      * **  *       * *** *     ****       **   * * **     *

ARA.TH_A        CCACCATTTT
SCH.POM.        CGGTCGTT--
                *   * **  

[Download ClustalW]

#61

Mean pairwise ID: 37.22%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTT
                                     ******    * *  *     **** **** *   * * 

HUM.LU_D        GGTCAACCTAGTGGATC-GGGTCCAGTGTTAG-CTGCTTACTGGTCTGCCCATTCCAAGC
YAR.LI_B        GTTGTGCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTG
                * *   * *    * ** **   * *   * * ** ***  * ***    *         

HUM.LU_D        CGGGAGTTGGGCTGAGTGACCTGGGCGAA-GGCTGGGTTGCGCAGCTCCTAGAGTGGAGG
YAR.LI_B        CGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACT
                ***  * *****     *  *** *  *  ****  *         * ***   *  *  

HUM.LU_D        GCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGG
YAR.LI_B        GGGATACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGG
                *  ** * * **  ***    *   ***** **     *  *  *       * **  **

HUM.LU_D        ATAACGGGCCGGTGCTACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGGACC
YAR.LI_B        ATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC---------
                *** *      *** **  **            **  *      ******          

HUM.LU_D        ATTTCTTTT
YAR.LI_B        ---------
                         

[Download ClustalW]

#62

Mean pairwise ID: 37.22%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
LYC.ES_D        ------------------------------------------------------------
                                                                            

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_D        -------------TAGTTCTGGCCTGCCCTGT-CCAAGC--ACAGAGTAGGATCACGAGG
                              ******** *** * **  * * **  *  * **     *** * *

ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
LYC.ES_D        CCCAA-ATGAAAATATGGGCTTCTTGA-------------------TTCCTAAAGCGGGG
                  *   ** ** **   * * **  *                    * ***** * ****

ORI.CUN.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
LYC.ES_D        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 * ****    ***  **    ** ******   * * ******  ***  **** *  *

ORI.CUN.        GAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCT----GGGCAACATAGCGAGACC
LYC.ES_D        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC
                ***   * * * ***  *   **  * ** *   ****    **       * * * ***

ORI.CUN.        CTGTCTCC-
LYC.ES_D        ACCACTTTT
                    **   

[Download ClustalW]

#63

Mean pairwise ID: 37.25%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTT
                                     **** *      **  *    ** *  **  *       

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
YAR.LI_B        GTTGTGCGTTCGAGTTCT--GGACTCTGC--ACTGGGCTACTTTGTTGTCCTTTCCGAAT
                  **   *   **** **  **    **    *   *          **** * ** *  

CAE.BRI.        GCTGCG-TCGCCAGGGGTCTCCGGTCGGAAGGCTGGC-----GGTCCCGGGCGCATAAGG
YAR.LI_B        TCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                 ***** * *   ** ***** *   *       ***     * *  * *    *  *  

CAE.BRI.        AGTGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAA-AGCCACCGCGCGGTGCAGTGG
YAR.LI_B        AACTGGG-ATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGCGG
                *   * * *    **** *  * **  ******  *   **   *** * ***   * **

CAE.BRI.        CCGGATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTT
YAR.LI_B        TGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC-----
                  *******      * * * *   *     *  *  * *   **  *  *   *     

CAE.BRI.        GTCATT
YAR.LI_B        ------
                      

[Download ClustalW]

#64

Mean pairwise ID: 37.28%


YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTT
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGG--CAATAAGGTAGTGTGGATG
                          *  *  *  ** * *   * *** **     *       *  ****  * 

YAR.LI_B        CGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGG
ZEA.MA_H        TCAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAAGT
                  * ** ***    **  *  ** *    ** *      *  * *     *  *  * * 

YAR.LI_B        -GCGTCTCGG--TCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC-TGG--GA
ZEA.MA_H        TGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACACTAAAGTGGCGGA
                 ****   **  *  *  *     *     ** *** * * * ** * ***  ***  **

YAR.LI_B        TACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA--TGGCGGTGGGATAG
ZEA.MA_H        CATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGAAGGA
                 * * *    *           ****   *   * ***   *      ******* *   

YAR.LI_B        CAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC
ZEA.MA_H        TAATGAGTCGCTA--TGCTATAGGCCCAAT-----------------
                 **  *   * **  ** *** *     **                 

[Download ClustalW]

#65

Mean pairwise ID: 37.28%


LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCTGG
SCH.POM.        ----------------------------CGCTGTAATGGCTTGGTC---GAAGTGTTTAG
                                             *** * *     **  *   **  *** * *

LEP.COL.        ACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGAGGCC
SCH.POM.        TACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCGAT
                  *  *  *  **** **    ** * *  **      *  * *** *   **    *  

LEP.COL.        TCCGGGTGCCCCCTTGCAGAAGGGGC---GCGCCCCCT--CCGTTAAAGTA-GAGGAACT
SCH.POM.        CTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTACC
                       * *   * * ***   * *   * * *  **  * ******    *  * ** 

LEP.COL.        GGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGCAGAACCACACC
SCH.POM.        GATGGAGGTTGGAAACAATGCACATCACTACCGGGTCTTGGGCAGTGCGATAGCGATGGG
                *    ***  ** ***   ***   ***  *  *  * *  ** **   * * * *    

LEP.COL.        GCGGAGCCTGTCATCACCTGCGCCCCAG-GCGATCCTGTGAAGCTTT
SCH.POM.        ATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT
                    * * *  **  *  ***     **    * *        * **

[Download ClustalW]

#66

Mean pairwise ID: 37.33%


TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
LYC.ES_D        ------------------------------------------------------------
                                                                            

TET.THE.        GATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGAGTTGC
LYC.ES_D        -------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACAGAGTAGG
                                         *  *    *  *****  ***** **  **** * 

TET.THE.        TATGGTGGTAACCTAGTAATAGGACT--CCACCAGGGCATTAAAGAGCTAAGGAAACGCC
LYC.ES_D        -ATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGG-GGCGGACCGCA
                 **   *    ** * * * *  *    *  *  *     ***** *     * * *** 

TET.THE.        TCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGATAACATA
LYC.ES_D        TGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATGGG
                * ********   ***** *** *** *  * *****   **  ************    

TET.THE.        CTCATTAACTGTCAAA-----------CTAATCGGTTCTACTATCAAAGCCAG-ACATT-
LYC.ES_D        TCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCACCACTTTT
                    *    * ****            ***** ****   * * * ** ***  ** ** 

[Download ClustalW]

#67

Mean pairwise ID: 37.37%


TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
TRI.AE_C        ------------------------------------------------------------
                                                                            

TET.THE.        GATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAAC-----AATGA
TRI.AE_C        -----------------------------GGTGGTCTGCCCGTTCCAAGTTGAGTAGTGG
                                                 ** ****** *****       * ** 

TET.THE.        GTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAGGAAAC
TRI.AE_C        ACCGCT-TGGGGCCTATGCGAAAGTTGGGCCTCAC--GGTCCATAATGTGGCA-GGCACC
                   *** *** *   *      * * ** *  ***  ** *  *** * *  * ** * *

TET.THE.        GCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGATAAC
TRI.AE_C        GCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAAC
                ** * ********   ***** *** ** ****  ******     **************

TET.THE.        ATACTCATTAACTGTCAAACTAATCGGTTCTACTA-TCAAAGCCAGACATT------
TRI.AE_C        GGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCACCATC
                   *   *  ***   *  *   * **  **  **  * *  ****  *        

[Download ClustalW]

#68

Mean pairwise ID: 37.41%


LEI.MAJ.        ----GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAAC--CAGGCTTAGCGGGGAGGAC
YAR.LI_A        CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTTCGAGTC
                    ** * *       * ***     * *        *  *  * *  ***     * *

LEI.MAJ.        GTGGACCA---GCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTG-TGTGT
YAR.LI_A        TTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCT
                 *** *      *  **    ** * **   *  *    * **  * ***   *  ** *

LEI.MAJ.        CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAACCG
YAR.LI_A        CGGTCTGAGTAATCGGCTTTGAGAT-----TTCCGTTCTAAGATTAA--CTGGGAAACTT
                **** **  *   *  * *  ***        * * **     ** *  *  ** ***  

LEI.MAJ.        GGTCAGGCCGGAAACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCAGAATCACA-CC
YAR.LI_A        CAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCG--GTGGGATCGCAACC
                     *  *      * **    ***     **   **  * **  *  * *** ** **

LEI.MAJ.        GCGGAGCATGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT
YAR.LI_A        AAGTGGTATATGT---TATGGAAGATATTTACGATCACGATT----
                  *  * ** *       **      *       ** ***      

[Download ClustalW]

#69

Mean pairwise ID: 37.46%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTT
                                      *** *      **  *    ** *  **  *       

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
YAR.LI_B        GTTGTGCGTTCGAGTTCTGGACTCTGCACTGG----GCTACTTTGTTGTCCTTTCCGAAT
                  ** * *   **** ***       *  **     *          **** * ** *  

CAE.EL_B        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG-----TGCATAAGGA
YAR.LI_B        TCTGCGGTTGATGGGCGTCTCGGTCTGAG--TAATCGGCTTTGAGATTTCCGTTCTAAGA
                 *****      ***  *  * *** **   *  ** *    * *      *    * **

CAE.EL_B        GTGGT--GGATGGTTCAGGACCGAAAGGTAGCAGACAAA-AGCCACCGCGCGGTGCAGTG
YAR.LI_B        TTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGCG
                 *     ****  *****    * **   ****** *   **   *** * ***   * *

CAE.EL_B        GCCGGACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACT
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC----
                *  ***  **      * * *      ***  *  *  **  ****  *  *   *    

CAE.EL_B        TGTTTTT
YAR.LI_B        -------
                       

[Download ClustalW]

#70

Mean pairwise ID: 37.50%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGGATGCT
SCH.POM.        -------------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCC
                                           *   *  **     *  * *** *  * *  * 

ZEA.MA_C        TGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAGTT
SCH.POM.        CAATAGTGCATGTTCGGT--GGTCTCGGGTTCGAGTC---TCGCTTTCGATCCCTCGATC
                   **  *  * ** *    ***    ***  *  *    * ** * *     *    * 

ZEA.MA_C        GGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTG-GCA
SCH.POM.        TGCCACGTCTGTTCGAAG------AGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTA
                 *    * * *** ****       **** *   * *    ** * *  ** *  * * *

ZEA.MA_C        GGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAA-CGGTGGAA
SCH.POM.        GTACCGATG-GAGGTTGGAA--ACAATGCA--CATCACTACCGGGTCTTGGGCAGTGCGA
                * * **  * **** **     ***  ***   ****** **** * **   * ***  *

ZEA.MA_C        GGATAACAGG--CCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAG
SCH.POM.        TAGCGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT---
                     *  **   ***    *** *   *   *  * *  ** **   *   *       

ZEA.MA_C        ACCACCATTTTT
SCH.POM.        ------------
                            

[Download ClustalW]

#71

Mean pairwise ID: 37.62%


LYC.ES_O        GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
SCH.POM.        -------------------------------CGCTGTAATGGCTTGGT--CGAAGTGTTT
                                                *  *  ***    ***   * * * ** 

LYC.ES_O        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACAG
SCH.POM.        AGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCG
                 *   *****   *     * * ***** **    *  *     * ** ** *  *   *

LYC.ES_O        AGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGAC
SCH.POM.        ATCTG--CCACGT----CTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCA---GTTAAAC
                *  **   ** **    *  **  **** * * ** *  *    **       * *  **

LYC.ES_O        CGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATAA
SCH.POM.        CGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCACTACCGGGTCTTGGGCAG-TGC
                ** **    * * *        * *** *   ** **      * *   ***   * *  

LYC.ES_O        CGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCAC
SCH.POM.        GATAGCGATGGGATTCACCTTCGCAGGATG--TGCATGGAAGTATAAACACAACGGTCGT
                   * ** **   * **  ***     ***  **   **  *    **   ***   *  

LYC.ES_O        TTT
SCH.POM.        T--
                *  

[Download ClustalW]

#72

Mean pairwise ID: 37.70%


LYC.ES_G        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAA-TGTT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *  * * *    **** *** ****

LYC.ES_G        GGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                  *   * ***   *     * * ***** **    *  *     * ** ** *  *   

LYC.ES_G        GAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGA
SCH.POM.        GATCTG--CCACGT----CTGTTCGAAGAGTAGTCTTCGTGGCAACTGG---CAGTTAAA
                **  **   ** **    *  **  **** * * ** *  *    **       * *  *

LYC.ES_G        CCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
SCH.POM.        CCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCACTACCGGGTCTTGGGCAG-TG
                *** **    * * *        * *** *   ** **      * *   ***   * * 

LYC.ES_G        ACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCA
SCH.POM.        CGATAGCGATGGGATTCACCTTCGCAGGATG--TGCATGGAAGTATAAACACAACGGTCG
                    * ** **   * **  ***     ***  **   **  *    **   ***   * 

LYC.ES_G        CTTTT
SCH.POM.        TT---
                 *   

[Download ClustalW]

#73

Mean pairwise ID: 37.86%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGGTAA-ATCGCCTTCTTGTTGTGC--
                         **    *** ** * *   *   ****  * **     *  **     *  

ARA.TH_A        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
YAR.LI_B        GTTCGAGTTCTGGACTCTGCACTG----GGCTACTTTGTTGTCCTTTCCGAATTCTGCGG
                *****  * ** *  ** *  ***    **  *  **  **  **  **       ** *

ARA.TH_A        TGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGG--AG
YAR.LI_B        TTGATGGGC-GTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                *   *     ** * *   ****  *  *  *     **    ******   *      *

ARA.TH_A        GGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACG
YAR.LI_B        GATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGC--CGTGGGTATGGCGGTGGGAT
                * ** * *    *          *****   *   * *  *  *  **  ** ****   

ARA.TH_A        GATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGA-TCTCATATGAAC
YAR.LI_B        AGCAACAAAGTGGTATATGTTATGGAAGGTAT---TTGCAATCACGACTCTC--------
                    **    * *  *   * *       ***    ***     *** ****        

ARA.TH_A        CACCATTTT
YAR.LI_B        ---------
                         

[Download ClustalW]

#74

Mean pairwise ID: 37.99%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                                      *** *      **  *    ** *  **  **      

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
YAR.LI_A        GTTGTGCGTTCGAGTCTTGGGCTCTGCA----CTTGGCCATTTGGTTGTCCTTTCCGAAT
                  ** * *   ***** ** *     *     **  * *    *   **** * ** *  

CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGA--AGGCGGTT----AGTCCCGGGTGCATAAGG
YAR.LI_A        TCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                 ** **      ***  *  * *** **  *  *** *      *  * * *  *  *  

CAE.EL_A        AGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAA-AGCGACCGCGTGGTGCAGTGG
YAR.LI_A        AACTG-GGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGCGG
                *   * ***   *****    * **   ****** *   **   *** * ***   * **

CAE.EL_A        CCGGACCGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGAT-ACCTTCAGACCACT
YAR.LI_A        TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT--------
                  *** ***      * * *       **        **  **** **  *         

CAE.EL_A        TATCATTT
YAR.LI_A        --------
                        

[Download ClustalW]

#75

Mean pairwise ID: 38.04%


TRY.BR_A        AGCCGGAGCGCATTGCTCTGTAACCTTCGG-GGGCTGATCCCGCTTAGCGGGGACGTCTT
LYC.ES_L        -GTTGGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTAT--AGTCTGGCCTGCCCTCTCC
                 *  **   *         **    *****  **** **   *  * **  *  *     

TRY.BR_A        GGACAAGCGG--GGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGTGT
LYC.ES_L        AAGCATGGAGTTGGATCACGTGGC-TTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAAG
                   ** *  *  ** *   ** ** **        *  ***  * * *   *  *     

TRY.BR_A        TGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGGGTCAGGC
LYC.ES_L        TGGGGTGG--ACTGCGTGAGGCTGGTTTCACAGAGC--AACGAACAGCTTCCGCTCTGTG
                ** *** *  ****      *  * * ** *   *   **      *   * * ** *  

TRY.BR_A        CGGTGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCGAGAAGCACACCGAGGAGCATC
LYC.ES_L        CAGTGGAAGGATAACGGGTCA-GTGCTCAG-CGAGTCCAGTTAACGCCCTGATGGGCTGC
                * ***   *   * *    *  * ** *   *  ** *    * * * * ** * **  *

TRY.BR_A        TCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
LYC.ES_L        TCCAA---CTAAACCACCACTTT-------------
                **       *   ** * * * *             

[Download ClustalW]

#76

Mean pairwise ID: 38.11%


TRI.AE_B        NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGGCATTGAGGCGGTGTGGATGCTT
SCH.POM.        --------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAATAGTGC--ATGTTC
                         * **     *****       ***   *   *       ***   *** * 

TRI.AE_B        GGTGCGGTTTG--TTGGCCTGGGCTTGTGATGTAACCTTGCTGGCCTGCCCGTTCCAAGT
SCH.POM.        GGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCGAT-CTGCCACGTCTGTTCGAAG-
                ****   *  *  * *      ****  ***    *  * *** *  * * **** *** 

TRI.AE_B        TGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCA---GGCCTTAAGTGGCA
SCH.POM.        -AGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTACCGATGGAGGTTGGAAACAA
                  *****   *  **   ****     ** *   *   *  *    *   **       *

TRI.AE_B        GGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCCGCTTCCAACGGTGGAAGG
SCH.POM.        TGCACATCACTAC-CGGGTCTTGGGCAGT-GCGATAGCGATGGGATTCACCT-TCGCAGG
                 ****  *  **  * *** *     **  **** * *    *  * ** *  * * ***

TRI.AE_B        ATAACAGGCCGCTGCAGCATGGGCCCGCTCTGGGCCTCCTACCCCGCCATAGCAGACCAC
SCH.POM.        AT----GTGCATGGAAGTATAAACACAAC--GGTCGTT----------------------
                **    *  *   * ** **   * *     ** * *                       

TRI.AE_B        CATCTTT
SCH.POM.        -------
                       

[Download ClustalW]

#77

Mean pairwise ID: 38.11%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                                     **** *      **  *    ** *  **  **      

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
YAR.LI_A        GTTGTGCGTTCGAGTCTT--GGGCTCTGC--ACTTGGCCATTTGGTTGTCCTTTCCGAAT
                  **   *   ***** *  ***   **    *   * *    *   **** * ** *  

CAE.BRI.        GCTGCG-TCGCCAGGGGTCTCCGGTCGGAAGGCTGGC-----GGTCCCGGGCGCATAAGG
YAR.LI_A        TCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                 ***** * *   ** ***** *   *       ***     * *  * *    *  *  

CAE.BRI.        AGTGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAA-AGCCACCGCGCGGTGCAGTGG
YAR.LI_A        AACTGGGAA-ACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGCGG
                *   * * *    **** *  * **  ******  *   **   *** * ***   * **

CAE.BRI.        CCGGATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGAT-ACCTTCAGACCACT
YAR.LI_A        TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT--------
                  **** **      * * * *   *     *     * *  *** **  *         

CAE.BRI.        TGTCATT
YAR.LI_A        -------
                       

[Download ClustalW]

#78

Mean pairwise ID: 38.13%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
                 *** ** * ** *** * ** ****  ** ***              **   *** *  

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
ZEA.MA_H        AATTGTGGTGCATGTGCCTGGGTCTA--GTGCTACAAACTG-TGGACCACCCATTCCAAG
                   *   ** ** * *    ** **   ****   *  * * * *     **   * ***

ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
ZEA.MA_H        TTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACAC-TAAAGTGGCG
                **  * *      *   **   *  **     *     ** *      * *** * ** *

ORI.CUN.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
ZEA.MA_H        GACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC-ACCAGCGGTGGAA
                   *  *    ***  **   *  **     * *    * *  **  * ***  **** *

ORI.CUN.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGTCTCC
ZEA.MA_H        GGA------TAATGAGTCGCTATGCTATAGGCCCAAT----------------------
                         * *  ** * **   **  ** *                           

[Download ClustalW]

#79

Mean pairwise ID: 38.16%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAA-TATT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *    *      **** *** * **

LYC.ES_A        GGGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                  *   * ***  **     * * ***** **  * *  *     * ** ** *  *   

LYC.ES_A        GAGTTGGATCTCGAGGCCCAAATGAAAATATGG-GCTTCTTGATTCCTAAAGTGGGGCGG
SCH.POM.        GATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **  **   *    *  * **  * *    * * *     **     ****  * *  * 

LYC.ES_A        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCTGTGCAGTGGAAGGATA
SCH.POM.        ACCGATGGAGGTTGGAA--ACAATGCACATCACTACCGGGTCTTGGGCAGTGCGATAGCG
                ****   **** ***    ***  ***    **   *  *   ** ******  *     

LYC.ES_A        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
SCH.POM.        ATGGG----------ATTCACCTTCGCAGGATGTGCATGGAAGTATAAACA--CAACGGT
                *****          **  *  *  * *     *    **  *    ** *  ****   

LYC.ES_A        CTTT
SCH.POM.        CGTT
                * **

[Download ClustalW]

#80

Mean pairwise ID: 38.19%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                                      *** *      **  *    ** *   *  **      

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTG-TATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
YAR.LI_A        GTTGTGCGTTCGAGTCTTGGGCTCTGCACTTG-----GCCATTTGGTTGTCCTTTCCGAA
                  ** * *   ***** ** * * **   ***     * *    *   **** * ** * 

CAE.EL_C        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG-----TGCATAAGG
YAR.LI_A        TTCTGCGGTTGATGGGCGTCTCGGTCTGAG--TAATCGGCTTTGAGATTTCCGTTCTAAG
                  *****      ***  *  * *** **   *  ** *    * *      *    * *

CAE.EL_C        AGTGGT--GGATGGTTCAGGACCGAAAGGTAGCAGACAAA-AGCCACCGCGCGGTGCAGT
YAR.LI_A        ATTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGC
                * *     ***   *****    * **   ****** *   **   *** * ***   * 

CAE.EL_C        GGCCGGACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAAT-ACCTTCAGACCA
YAR.LI_A        GGTGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT------
                **  ***  **      * * *      ***  *     **  * ** **  *       

CAE.EL_C        CTTGTCACT
YAR.LI_A        ---------
                         

[Download ClustalW]

#81

Mean pairwise ID: 38.19%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGGTAA-ATCGCCTTCTTGTTGTGC--
                         **    *** ** * *   *   ****  * **     *  **     *  

ARA.TH_F        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
YAR.LI_B        GTTCGAGTTCTGGACTCTGCACTG----GGCTACTTTGTTGTCCTTTCCGAATTCTGCGG
                *****  * ** *  ** *  ***    **  *  **  **  **  **       ** *

ARA.TH_F        TGAGTAATTAGTGTTGAGTTGAGCGA--AGGCTTGGCTTGCAGGTTCTAGAGTCGG--AG
YAR.LI_B        TTGATGGGC-GTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                *   *     ** * *   ****  *   *  ***   *    ******   *      *

ARA.TH_F        GGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACG
YAR.LI_B        GATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGC--CGTGGGTATGGCGGTGGGAT
                * ** * *    *          *****   *   * *  *  *  **  ** ****   

ARA.TH_F        GATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGA-TCTCATATGAAC
YAR.LI_B        AGCAACAAAGTGGTATATGTTATGGAAGGTAT---TTGCAATCACGACTCTC--------
                    **    * *  *   * *       ***    ***     *** ****        

ARA.TH_F        CACCATTTT
YAR.LI_B        ---------
                         

[Download ClustalW]

#82

Mean pairwise ID: 38.19%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTT
                                     ******    * *  *     **** **** *   * * 

HUM.LU_A        GGTCAACCTAGTGGATC-GGGTCCAGTGTTAG-CTGCTTACTGGTCTGCCCATTCCAAGC
YAR.LI_B        GTTGTGCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTG
                * *   * *    * ** **   * *   * * ** ***  * ***    *         

HUM.LU_A        CGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCCTAGAGTGGAGG
YAR.LI_B        CGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACT
                ***  * *****     *  *** *  *  ****  *       *** ***   *  *  

HUM.LU_A        GCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGG
YAR.LI_B        GGGATACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGG
                *  ** * * **  ***    *   ***** **     *  *  *       * **  **

HUM.LU_A        ATAACGGGCCGGTGCTACCTGGGTCCACCATGCTTCACTAGGCTGACTCTTAATAGGACC
YAR.LI_B        ATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC---------
                *** *      *** **  **            **  * *    ******          

HUM.LU_A        ATTTCTTTT
YAR.LI_B        ---------
                         

[Download ClustalW]

#83

Mean pairwise ID: 38.20%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGG-TGGCTGCGGAT
SCH.POM.        -------------------------------------CGCTGTAATGGCTTGGTCGAAGT
                                                      **  *** ** * * *     *

ORY.SA_A        GTTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTG---CCC
SCH.POM.        GTTTAGTAC---TCCCAATAGTG-----CATGTT-CGGTGGTCTCG--GGTTCGAGTCTC
                **** **     * *  **  **     ******   **  *** *  ** * *   * *

ORY.SA_A        GTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCG
SCH.POM.        GCTTTCGATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAG
                * *     *  *    *  ***      * *         * *** *       *  * *

ORY.SA_A        GCCCTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCT
SCH.POM.        ---TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCAC--ATCACTACCGGGT
                    ****  *    * ** *   **** ***    ***  ***   ****** ** * *

ORY.SA_A        TCCATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCC
SCH.POM.        CTTG--GGCAGTGCGATAGCGATGGGATTCACCTTCG--CAGGATGTGCATGGAAGTATA
                      **  *   **** *     * * ****** *  * *  * **      ***   

ORY.SA_A        TCTACAACAGACCACCATCTTT
SCH.POM.        AACACAACGGTCGTT-------
                   ***** * *          

[Download ClustalW]

#84

Mean pairwise ID: 38.20%


ZEA.MA_A        ------NCCGAGCTCTGTAGC----GAGAGCTTGT-AACCCGAGCGGGGGCATTAAGG--
LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
                       *   ******** *    * * ***    *  *  *******       **  

ZEA.MA_A        TGGTGTGAATGCTTTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCT
LEI.MAJ.        CAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGTGTGGCT
                  * * *  ** *****   *      ***  *   *  * * ****   * *   ****

ZEA.MA_A        TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCA
LEI.MAJ.        TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAACCGGGTCAGGCCG
                *****  *   **  *** * *   *   *  * *  *****  *    *****    * 

ZEA.MA_A        GACCTGGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACT
LEI.MAJ.        GAAACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCAGAATCAC-ACCGCGGAGCATG
                **   ***** **        ** * * * * * *  ****    * * * * *   *  

ZEA.MA_A        CCCAACGGTGGGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCT
LEI.MAJ.        TCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT------------------------
                 **     ** *       *   * ***    * **                        

ZEA.MA_A        CACTAAGCAAACCACCATCTTT
LEI.MAJ.        ----------------------
                                      

[Download ClustalW]

#85

Mean pairwise ID: 38.24%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****   *   *** * *   *  * ***      ***   *      *****

LYC.ES_B        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
YAR.LI_A        ---TGCGTTCGAGTCTTGGGCTCTGCAC-TTGGCCATTTGGTTGTCCTTTCCGAATTCTG
                   **     **   *******  *     *      *   *** *** *** *  *  *

LYC.ES_B        AGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGAA
YAR.LI_A        CGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                 * * ***   * * * *  *   ** *** * **    ****       *  *    * 

LYC.ES_B        TGCGTGAGGCTGGTTTCACAG---AGCAACGATAAGTTTCCGCTCTAAGCGGTGGAAGGA
YAR.LI_A        TGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGA
                ** *  *     **    **    ****  ***    ** *  *      ** **  ***

LYC.ES_B        TAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAACCACC
YAR.LI_A        TCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-------------
                *  * *    *** * * **         **   *        * *              

LYC.ES_B        ACTTTT
YAR.LI_A        ------
                      

[Download ClustalW]

#86

Mean pairwise ID: 38.31%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAGTCAGA
TRI.AE_C        ------------------------------------------------------------
                                                                            

TET.ROS.        GTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGAGTTGCT
TRI.AE_C        ----------------------------GGTGGTCTGCCCGTTCCAAGTTGAGTAGTGGA
                                                ** ************   * *   **  

TET.ROS.        ATGGTGGAAACCTA----GTAATAGGACTTCACCAGGGCATTAAAGAGCTGAGGAACCGC
TRI.AE_C        CCGCTTGGGGCCTATGCGAAAGTTGGGCCTCAC--GGTCCATAATGTGGC-AGGCACCGC
                  * * *   ****      * * ** * ****  ** *  *** * *   *** *****

TET.ROS.        CTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATAACAT
TRI.AE_C        GTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAACGG
                 * ********   ***** *** ** ****  ******     **************  

TET.ROS.        ACTCATTAACTGTCAAGCTAATCGGTTCTGCTATTCTGATCAGACACT-------
TRI.AE_C        GCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCACCATC
                 *   *  ***   * **   * **  **  **  **  **   *          

[Download ClustalW]

#87

Mean pairwise ID: 38.31%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                                      *** *      **  *    ** *  **  **      

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
YAR.LI_A        GTTGTGCGTTCGAGTCTTGGGC---TCTGCACTTG-GCCATTTGGTTGTCCTTTCCGAAT
                  ** * *   ***** ** *    **  *   *  * *    *   **** * ** *  

CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGA--AGGCGGTT----AGTCCCGGGTGCATAAGG
YAR.LI_A        TCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                 ** **      ***  *  * *** **  *  *** *      *  * * *  *  *  

CAE.EL_D        AGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAA-AGCGACCGCGTGGTGCAGTGG
YAR.LI_A        AACTG-GGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGCGG
                *   * ***   *****    * **   ****** *   **   *** * ***   * **

CAE.EL_D        CCGGACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGAT-ACCTTCAGACCACT
YAR.LI_A        TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT--------
                  *** ***        * *       **  *     **  **** **  *         

CAE.EL_D        TATCATTT
YAR.LI_A        --------
                        

[Download ClustalW]

#88

Mean pairwise ID: 38.36%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAA-TATT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *    *      **** *** * **

LYC.ES_K        GGGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                  *   * ***  **     * * ***** **  * *  *     * ** ** *  *   

LYC.ES_K        GAGTAGGATCACGAGGCCCAAATGAAAATATGG-GCTTCTTGATTCCTAAAGCGGGGCGG
SCH.POM.        GATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **   *   *    *  * **  * *    * * *     **     **** ** *  * 

LYC.ES_K        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
SCH.POM.        ACCGATGGAGGTTGGAA--ACAATGCACATCACTAC-CGGGTCTTGGGCAGTGCGATAGC
                ****   **** ***    ***  ***    **  * *  *   ** ******  *    

LYC.ES_K        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCA
SCH.POM.        GATGGG----------ATTCACCTTCGCAGGATGTGCATGGAAGTATAAACA--CAACGG
                 *****          **  *  *  * *     *    **  *    ** *  ****  

LYC.ES_K        CCTTT
SCH.POM.        TCGTT
                 * **

[Download ClustalW]

#89

Mean pairwise ID: 38.36%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAA-TATT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *    *      **** *** * **

LYC.ES_J        GGGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                  *   * ***  **     * * ***** **  * *  *     * ** ** *  *   

LYC.ES_J        GAGTTGGATCACGAGGCCCAAATGAAAATATGG-GCTTCTTGATTCCTAAAGTGGGGCGG
SCH.POM.        GATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **  **   *    *  * **  * *    * * *     **     ****  * *  * 

LYC.ES_J        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
SCH.POM.        ACCGATGGAGGTTGGAA--ACAATGCACATCACTAC-CGGGTCTTGGGCAGTGCGATAGC
                ****   **** ***    ***  ***    **  * *  *   ** ******  *    

LYC.ES_J        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCA
SCH.POM.        GATGGG----------ATTCACCTTCGCAGGATGTGCATGGAAGTATAAACA--CAACGG
                 *****          **  *  *  * *     *    **  *    ** *  ****  

LYC.ES_J        CCTTT
SCH.POM.        TCGTT
                 * **

[Download ClustalW]

#90

Mean pairwise ID: 38.44%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGAT-G
YAR.LI_B        --------------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCG
                                          * * *    **     *   *  *** *  ** *

ORY.SA_B        CCTGGTCGTT-TGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTC
YAR.LI_B        CCTTCTTGTTGTGCGTTCGAGTTCTG-GACTCTGCACTGGGCTACTTTGTT-GTCCTTTC
                ***  * *** **** * * * **** * ** **   **  ***    *   * ** ***

ORY.SA_B        CAAGTTGCGTAGCGTGTGTGGGGC---GCCTGGGCGAA-GGCTCGAGCGTCCCTGCACCT
YAR.LI_B        CGAATTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTA
                * * **  *  *    ** * * *   * *** *  *  ****      *  * *  *  

ORY.SA_B        AGAGTGGC--GGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCC
YAR.LI_B        AGATTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCG--TGGGTAT
                *** *  *  ** ** * *    *     *    *****   *   * ***   *  *  

ORY.SA_B        AACGGTGGAAGGATAACGGGCCGCTGCA-GCCCTGGCCCGCTTCCGGCCCAAGTGCCTTC
YAR.LI_B        GGCGGTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC
                  ****** *    ***     * *  * *   ***   *  *  *     *   *  **

ORY.SA_B        CATGGCAGACCACCACCTTT
YAR.LI_B        --------------------
                                    

[Download ClustalW]

#91

Mean pairwise ID: 38.46%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATGC
LYC.ES_D        ------------------------------------------------------------
                                                                            

ORY.SA_B        CTGGTCGTTTGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTCCA
LYC.ES_D        -------------------------------------TAGT-TCTGGCCTGCCCTGTCCA
                                                      * * *  **** ****  ****

ORY.SA_B        AGTTGCGTAGCGTGTGTGGGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCACCTAGAGTG
LYC.ES_D        AGC-ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCG
                **   *  **   *     *  ***     ***     * ** **      **** ** *

ORY.SA_B        GCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCCAACGGTGG
LYC.ES_D        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
                * * * *  ** ********* ************ **  * * ******     * ****

ORY.SA_B        AAGGATAACGGGCCGCTGCAGC-CCTGGCCCGCTTCCGGCCCAAGTGCCTTCCATGGCAG
LYC.ES_D        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAA
                ******** *** ** **      *  *  *  *  ** *  * * *     *     * 

ORY.SA_B        ACCACCACCTTT
LYC.ES_D        ACCACCACTTTT
                ******** ***

[Download ClustalW]

#92

Mean pairwise ID: 38.51%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
YAR.LI_B        --------------AGCTGTAATGGCATTTT-GTCGGAGTGGTAAATCGCCTTCTTGTTG
                               ***    *   * *   **  * **   ***  *  *     ***

CIN.HYB.        AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCGA
YAR.LI_B        TGC---GTTCGAGTTCTGGACTCTGCACTGGGC-TACTTTGTTGTCCTTTCCGAATTCTG
                 **   * *    *  * *  **** *     *  ** * * *  **  * * ** **  

CIN.HYB.        GAGTGGGTTCATGTTTC---CTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGG--
YAR.LI_B        CGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACT
                  ** * *    ** **   *****  *  *     * *** *  * * **  **     

CIN.HYB.        GGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGA
YAR.LI_B        GGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTAT--GGCGGTGGG
                ***  * * *  * *     *    ***** * *     **          * * **** 

CIN.HYB.        AGGATTACAAGCCGGAGTGTCTTA-GGCTCATATAACCAGCC-TGGCTAGCCCAACAGGA
YAR.LI_B        ATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC---------
                *     ****   **  * * *** **    ***   **  *  * **  *         

CIN.HYB.        CACCCATTT
YAR.LI_B        ---------
                         

[Download ClustalW]

#93

Mean pairwise ID: 38.51%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                                      *** *      **  *    ** *  **  **      

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTG-TATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
YAR.LI_A        GTTGTGCGTTCGAGTCTTGGGCTCTGCACTTG-----GCCATTTGGTTGTCCTTTCCGAA
                  ** * *   ***** ** * * **   ***     * *    *   **** * ** * 

CAE.EL_B        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG-----TGCATAAGG
YAR.LI_A        TTCTGCGGTTGATGGGCGTCTCGGTCTGAG--TAATCGGCTTTGAGATTTCCGTTCTAAG
                  *****      ***  *  * *** **   *  ** *    * *      *    * *

CAE.EL_B        AGTGGT--GGATGGTTCAGGACCGAAAGGTAGCAGACAAA-AGCCACCGCGCGGTGCAGT
YAR.LI_A        ATTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGC
                * *     ***   *****    * **   ****** *   **   *** * ***   * 

CAE.EL_B        GGCCGGACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAAT-ACCTTCAGACCA
YAR.LI_A        GGTGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT------
                **  ***  **      * * *      ***  *     **  * ** **  *       

CAE.EL_B        CTTGTTTTT
YAR.LI_A        ---------
                         

[Download ClustalW]

#94

Mean pairwise ID: 38.52%


LEI.MAJ.        -GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAAC--CAGGCTTAGCGGGGAGGACGTG
YAR.LI_B        AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTCGAGTTCTG
                 ** * *       * ***     * *        *  *  * *  ***     *   **

LEI.MAJ.        GACCA---GCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTG-TGTGTCGG
YAR.LI_B        GACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCGG
                ***      *  ** *  **** **   *  *    * **  * ***   *  ** ****

LEI.MAJ.        TGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAACCGGGT
YAR.LI_B        TCTGAGTAATCGGCTTTGAGAT-----TTCCGTTCTAAGATTAA--CTGGGATACTTCAG
                * **  *   *  * *  ***        * * **     ** *  *  **  **     

LEI.MAJ.        CAGGCCGGAAACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCAGAATCA-CACCGCG
YAR.LI_B        TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATAGCAACAAAGTG
                  *  *      * **    ***     **   **  * ** **    * ** **  * *

LEI.MAJ.        GAGCATGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT
YAR.LI_B        GTATATGTTA-----TGGAAGGTATTTGCAATCACGACTCTC-
                *   ****       **      *       ** ***  *   

[Download ClustalW]

#95

Mean pairwise ID: 38.64%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_L        --------------------------------------------------GTTGGGTTGA
                                                                  **  ** ** 

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
LYC.ES_L        CCCAGATGGTTGGGTTCGGTAGGC-TTATAGTCTGGCCTGCCC---TCTCCAAGCATGGA
                       **  * ** * **     *  * ****     * **     ***  **   * 

CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
LYC.ES_L        GTTGGATCAC--GTGGCTTA--GTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGGGGT
                * *   ****  * ** * *  **** *** *      * *  * * * *** * *  **

CAE.EL_A        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGG
LYC.ES_L        GGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGG
                ***  *     * * *     *   ****   ** ***  ****   *********  **

CAE.EL_A        ACCGCGCTTGTGAGTT----GACACACATACGCAGCCTTCTCGATACCTTCAGACCACTT
LYC.ES_L        ATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAACC
                *   **  *  * * *    **  *   *   *  ***  * *    ** **    *   

CAE.EL_A        ATCATTT-
LYC.ES_L        ACCACTTT
                * ** ** 

[Download ClustalW]

#96

Mean pairwise ID: 38.64%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_L        --------------------------------------------------GTTGGGTTGA
                                                                  **  ** ** 

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
LYC.ES_L        CCCAGATGGTTGGGTTCGGTAGGC-TTATAGTCTGGCCTGCCC---TCTCCAAGCATGGA
                       **  * ** * **     *  * ****     * **     ***  **   * 

CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
LYC.ES_L        GTTGGATCAC--GTGGCTTA--GTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGGGGT
                * *   ****  * ** * *  **** *** *      * *  * * * *** * *  **

CAE.EL_D        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGG
LYC.ES_L        GGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGG
                ***  *     * * *     *   ****   ** ***  ****   *********  **

CAE.EL_D        ACCGCGCTTGTAAGTT----GACACACATACACAGCCTTCTCGATACCTTCAGACCACTT
LYC.ES_L        ATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAACC
                *   **  *    * *    **  *   *  **  ***  * *    ** **    *   

CAE.EL_D        ATCATTT-
LYC.ES_L        ACCACTTT
                * ** ** 

[Download ClustalW]

#97

Mean pairwise ID: 38.67%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
                 *** ** * ** ***   ** ****  ** ***              **    ** *  

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
ZEA.MA_H        AATTGTGGTGCATGTGC-CTGGG-TCTAGTGCTACAAACTG-TGGACCACCCATTCCAAG
                   *   ** ** * *  ***** * ******   *  * * * *     **   * ***

RAT.RAT.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
ZEA.MA_H        TTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACAC-TAAAGTGGCG
                **  * *      *   **   *  **     *     ** *      * *** * ** *

RAT.RAT.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
ZEA.MA_H        GACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC-ACCAGCGGTGGAA
                   *  *    ***  **   *  **     * *    * *  **  * ***  **** *

RAT.RAT.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTCTT
ZEA.MA_H        GGA------TAATGAGTCGCTATGCTATAGGCCCAAT-----------------------
                         * *  ** * **   **  ** *                            

[Download ClustalW]

#98

Mean pairwise ID: 38.76%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAGTG
YAR.LI_B        ----AGCT--GTAATGGCATTTTGT---CGGAGTGGTA--AATCGCCTTCTTGTTGTGCG
                    ****  **** *  *  ****   * ******    ***    *  * *    * *

ARA.TH_D        GTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAGCTG
YAR.LI_B        -TTCGAGTTCTGGACTCTGCACTGG-GCTACTTTGT---TGTCCTTTCCGAATTCTGCGG
                 *** * * ** *  ** *  ***  ***    * *   **  **  **       ** *

ARA.TH_D        TGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGG--AGG
YAR.LI_B        TTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGG
                *   *   *     **     *  *  *  *     *      ******  *      **

ARA.TH_D        GTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGATGG
YAR.LI_B        ATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGC--CGTGGGTATGGCGGTGGGATA
                 ** * *    *     *    *****   *   * *  *     **  ** ****    

ARA.TH_D        ATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACCA
YAR.LI_B        GCAACAAAGTGGTATATGTTATGGAAGGTAT---TTGCAATCACGA-CTCTC--------
                   * *    *   * * * *       ***     **     *** *****        

ARA.TH_D        CCACTTT
YAR.LI_B        -------
                       

[Download ClustalW]

#99

Mean pairwise ID: 38.77%


LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
LYC.ES_L        ------GTTGGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTA-TAGTCTGGCCTGCCCT
                      * *  * *     *  *    *** *    *******   *   ** *      

LEI.MAJ.        CAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGTGTGGCT
LYC.ES_L        CTCCAAGCATGG--AGTTG-GATCACGTGGCTTAGTCGAAAGACCTGGGTTGCT--TGAT
                *  * **  **    * ** * * ******     *     *   ** ** * *   * *

LEI.MAJ.        TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCG-AGGGAACCGGGTCAGGCC
LYC.ES_L        TCCTAAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTC
                * *     **  * **   *** * * * *   *   ** * *  **** *  ** *  *

LEI.MAJ.        GGAAACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCAGAATCACACCGCGGAGCATG
LYC.ES_L        TGTGCAGTGGAAGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCT
                 *    *  * **   * *        *  *  **   *    * ** **  *  *    

LEI.MAJ.        TCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT
LYC.ES_L        GCTCCAACTAAACCAC-CACTTT-------------
                 *  **  * * ** * * ***              

[Download ClustalW]

#100

Mean pairwise ID: 38.89%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAA-TATT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *    *      **** *** * **

LYC.ES_H        GGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                  *   * ***   *     * * ***** **    *  ** *  * ** ** *  * * 

LYC.ES_H        GAGTTGGATCATGTGGCCCAATTGAAGAAATGG-ACTACTTGATTCGTAAAGTGGGGCGG
SCH.POM.        GATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **  **   * * **  * **  * **   * *    *  **     ****  * *  * 

LYC.ES_H        AATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
SCH.POM.        ACCGATGGAGGTTGGA--AACAATGCACATCACTAC-CGGGTCTTGGGCAGTGCGATAGC
                *  *   **** ***    ***  ***    **  * *  *   ** ******  *    

LYC.ES_H        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCA
SCH.POM.        GATGGG----------ATTCACCTTCGCAGGATGTGCATGGAAGTATAAAC--ACAACGG
                 *****          **  *  *  * *     *    **  *    **   *****  

LYC.ES_H        CCTTTT
SCH.POM.        TCGTT-
                 * ** 

[Download ClustalW]

#101

Mean pairwise ID: 38.89%


YAR.LI_A        CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTTCGAGTC
LYC.ES_L        ----GTTGGGTTGAC-CCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCCTGCCCTCT
                    * **   ** *      * *  * * *   * * *** * **   ** * *     

YAR.LI_A        TTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCT
LYC.ES_L        CCAAGCATGGAGTTGGATCACGTGGCT---TAGTCGAAAGACCTGGGTTGCTTGATTCCT
                    **   *   * *  **  *** *      **  **  *   ***** * *    **

YAR.LI_A        CGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGA
LYC.ES_L        AAAGTGGGGTGGACTGCGT-GAGGCTGGT-TTCACAGAGCAAC-GAACAGCTTCCGCTCT
                      * **   * ** * ***  *    ***  ***  *** *   * **** *    

YAR.LI_A        GCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATCGCAACCAAGTGGTAT
LYC.ES_L        GTGCAGTGGAAGGATAACGGGT-CAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCT
                *       * **     * * * * ***   *  * *    * *  *  **   ***  *

YAR.LI_A        ATGTTATGGAAGATATTTACGATCACGATT
LYC.ES_L        GCTCCAACTAAACCACC-ACTTT-------
                     *   **   *   **  *       

[Download ClustalW]

#102

Mean pairwise ID: 38.92%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
YAR.LI_B        ------------------AGCTGTAATGGCATTTTG-----TCGGAGTGGTAAATCGCCT
                                  ****   *   *** * *     *     ****  * * *  

ARA.TH_E        GTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCAT---GTTTCTGGGCTGCCCAGTCCAAG
YAR.LI_B        TCTTGT-TGTGCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAA
                  * *  *   **  *  ******   *  ***    * * **  * ** **  *** * 

ARA.TH_E        CTGTGAGTAAGACGTGTGTGTCAAGCGAAG-GCTTGGCTCAAACGGCT----TCTAAAGT
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                 * ** *   ** * * ** **   *  **   * ****   *    *    *****  *

ARA.TH_E        TGG--AGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCA
YAR.LI_B        TAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGC--CGTGGGTATGGCG
                *     ** ** * *    *     *    *****   *   * *  *  *  **  ** 

ARA.TH_E        GTGGACGGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGA-TCTCA
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTAT---TTGCAATCACGACTCTC-
                ****       ***   * *  *   * *       ***    ***     *** **** 

ARA.TH_E        TATGAACCACCATTTT
YAR.LI_B        ----------------
                                

[Download ClustalW]

#103

Mean pairwise ID: 38.96%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGA-CGTT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *    ***     * * * *  ***

ARA.TH_C        GGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCCCGCCCATTCCAAGT
SCH.POM.        TAGT-ACTCCCAATAGTGCATGTTCGG--TGGTCTCGGGTTCGAGTCTCGCTTTCGATCC
                  **   ** ** * *  *  ******  *** **    *  *   * * * *** *   

ARA.TH_C        TGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCT-CGGGTCTCATGTCTTCTAGAGTGGGG
SCH.POM.        CTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGT
                   **  **   * *  * *   ** * ** ** ** * *   ** *   ** *  * * 

ARA.TH_C        GAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGA-CGGTGGAA
SCH.POM.        AGTACCGATGGAGGTTGGAAACAATGCACA----TCACTACCGGGTCTTGGGCAGTGCGA
                   ****   **** ***   **  *  **     ***  ** * *****  * ***  *

ARA.TH_C        GGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACC
SCH.POM.        TAGCGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAAC-ACAACGGTCGTT--
                     * ***      * *  *  *      ***     **** *  *  ** * *    

ARA.TH_C        ATCACTTT
SCH.POM.        --------
                        

[Download ClustalW]

#104

Mean pairwise ID: 39.02%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCAGTGTGGTGGAATGTTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTG-GTAAATCGCCTTCTTGTTGTGC-G
                         **  *    *** * *      **** *   ***    *  **   **  *

LYC.ES_C        AACATGCCCAGAAGGTAGGGCTTGTGTGACAATTCTCTGGCCTGCCCTGTCCAAGCAAAG
YAR.LI_B        TTCGAGTTCTGGACTCTGCACT---GGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTT
                  *  *  * * *    *  **   * *  * **   ** ***  **       **    

LYC.ES_C        AGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCCTAAAGTGGGGTGGAC
YAR.LI_B        GAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGA
                  * ***  *   ** *  **  *  *  *  *    *    * ****  *    ***  

LYC.ES_C        TGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGTGCAGTGGAAGGATAA
YAR.LI_B        TACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATAG
                * * * **  ***    *   ****  **     *  *  *  **   * **  ***** 

LYC.ES_C        CGAGCCAGTGTCATATAA-GTTCAACGAATGTCTGATGGGCTGTTCTAGTTAAACTACCA
YAR.LI_B        CAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCA-CGACTCTC------------
                * *   ****  ****    *  ** * ** *   **   *   ***             

LYC.ES_C        CATTT
YAR.LI_B        -----
                     

[Download ClustalW]

#105

Mean pairwise ID: 39.02%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTAGTTC
SCH.POM.        ------------------------CGCTGTAATGGCTTGGTCGAAGTG----TTTAGTAC
                                        *   **   *** **   *** **    ****** *

HUM.JA_B        GGCCCATTGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCATTCCAAGCCGAGAG
SCH.POM.        T-CCCAATAGTGCATGTTCGGTGGTCTCGGGTT--CGAGTCTCGCTTTCGATCCCTCGAT
                  **** * *  *   * * *** *  * * **   * *   * * *** *  **  ** 

HUM.JA_B        TTGAGCTGTGTGAGCCGGACGAAGGTCTGGCT-TGGTCAGCTCCTAAAGCGGAGGGCAAT
SCH.POM.        CTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTACC
                 **    ** **  *     * **   * *         **   **** **    * *  

HUM.JA_B        GCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGAAGGATAAC
SCH.POM.        GATGGAGGTTGGAA--ACAATGCA-CATCACTACCGGGTCTTGGGCAGTGCGATAGCGAT
                *   **** ***    ***  *** *  **    *  *   * *******  *     * 

HUM.JA_B        GGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGC-TGACTCTTAATAGGACCATTT
SCH.POM.        GGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT----------
                ***      ** *   *      *****     * * *   **  *   *          

HUM.JA_B        CTTTT
SCH.POM.        -----
                     

[Download ClustalW]

#106

Mean pairwise ID: 39.02%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
SCH.POM.        --------------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTC
                                            *  *   **     *   *  **  *  *** 

ARA.TH_E        GTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGTCCAAGCTG
SCH.POM.        CCAATAGTGCATGT-TCGGTGGTCTCGGGTTCGAGTCTC---GCTTTCGATCCCTCGATC
                      ** ** *   ****  * * *    *  ** **   ***  * *  **  * * 

ARA.TH_E        TGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAGGGT
SCH.POM.        TGCC----ACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **      **** ***   *** * ** *** *    *** *    * **   *    **

ARA.TH_E        AATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGAT
SCH.POM.        ACCGATGGAGGTTGGAAACAATGCACATC-ACTAC--CGGGTCTTGGGCAGTGCGATAGC
                *  *   **** ***   **  *  ** * *****  *  *  *   ******       

ARA.TH_E        CACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCACC
SCH.POM.        GATGGGATTCACCTTCGCAGGATGTGCATGGA-----AGTATAAACACA-----ACGGTC
                 *  *  *       * *** *     ****       **   * * **     **   *

ARA.TH_E        ATTTT
SCH.POM.        GTT--
                 **  

[Download ClustalW]

#107

Mean pairwise ID: 39.02%


LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
SCH.POM.        ----------------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTAC
                                             ***     ***** *  *    *    * **

LEI.MAJ.        CAGCGAGGGTG---ATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGTGTG
SCH.POM.        TCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCGATCTG
                   * *  ***    ** * **   *   **     ***   *  *  *   *** * **

LEI.MAJ.        GCTTGCCCCCCTGCAGAGGG----TGGCGCGGGTCCGCCGTTGAAGCGAG-GGAACCGGG
SCH.POM.        CCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTACCGAT
                 *  * *     * ****      * * *       ** *** ** ** *  * ****  

LEI.MAJ.        TCAGGCCGGAAACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCAGAATCACACCGCG
SCH.POM.        GGAGGTTGGAAACAATGCACATCACTAC---CGGGTCTTGGGCAGTGCGATAGCGATGGG
                  ***  ******   ***   ***  *   *  ***    *  *    **  *   * *

LEI.MAJ.        GAGCATGTCCGCACT-TGAGCCCC-ACGCTTCGTCGCGA-AGCCTT-
SCH.POM.        ATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT
                   **  * ****   ** **    * *  *   * * *  * * * 

[Download ClustalW]

#108

Mean pairwise ID: 39.05%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
YAR.LI_B        ----------------------AGCTGTAATGGCATTTTGTCGGAG-TGGTAAATCGCCT
                                      * *   * ***     *** ***  *** * ** *  *

HUM.LU_B        CAGCCCAGTG-GATCGGGTCCAGTGTTAGCTGCT----TACTGGTCTGCCCATTCCAAGC
YAR.LI_B        TCTTGTTGTGCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAAT
                       *** * *** ** * *   *     **    ****    ** ** **** *  

HUM.LU_B        ----CGGGAGTTGGGCTGAGTGACCTGGGCGAA-GGCCTGGGTTGCGCAGCTCCTAGAGT
YAR.LI_B        TCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                    ***  * *****     *  *** *  *  *** * *      * * **  *** *

HUM.LU_B        GG--AGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAG
YAR.LI_B        AACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGT--GGGTATGGCGG
                     **  * * *    *     *    *****   *   * **    *     *** *

HUM.LU_B        TGGAAGGATAACGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAAT
YAR.LI_B        TGGGATAGCAACAAAGTGGTA-TATGTTATGGAAGGTATTTGC-AATCACGACTCTC---
                *** *    ***     ***  **  *  *  *   * **  *   **  ******    

HUM.LU_B        CGGACCATTTCCTTT
YAR.LI_B        ---------------
                               

[Download ClustalW]

#109

Mean pairwise ID: 39.07%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  * * *    *  * *

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
TRY.BR_A        CGGGGACGTCTTGGACAAGCGGGGGT--TCTGTTGCGTTGACTTGGTGTTC-TGCTTGGT
                 * *   *     * *  * *   **  **   * *** ***   * ** * ***   * 

CAE.EL_D        GCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
TRY.BR_A        TGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGC-GTTCTCGCGCCGTTAAAGTGGGG
                     ***      * * *  *    * *  * **    ** ** *    *** * *  *

CAE.EL_D        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGGAC
TRY.BR_A        GGAACGGGTCAGGCCGGTGACGGAGCAGCCCACCTTG--CGCACGTTCCCGTTCGAGAAG
                 * * ** ***** * *  * * ***** * *    *  ***  * * * **    * * 

CAE.EL_D        CGCGCTTGTAAGT-TGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTATCAT
TRY.BR_A        CACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG--------
                * * *     **  *  **    *   *  **     *    *   ** *          

CAE.EL_D        TT
TRY.BR_A        --
                  

[Download ClustalW]

#110

Mean pairwise ID: 39.10%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
YAR.LI_A        --------------CTTAG--CTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                              * * *  ******    * *  *     **** **** *   * * 

HUM.LU_A        GGTCAAC-CTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGC-
YAR.LI_A        GTTGTGCGTTCGAGTCTTGGGCTCTGCACT---TGGCCATTTGGTTGTCCTTTCCGAATT
                * *   *  * * *  * ***  * *   *   **   * * *  ** ** **** *   

HUM.LU_A        ---CGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCCTAGAGTGG
YAR.LI_A        CTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTA
                   ***  * *****     *  *** *  *  ****  *       *** ***   *  

HUM.LU_A        AGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGA
YAR.LI_A        ACTGGGAAACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGT
                *  *  *  * * **  ***    *   ***** **     *  *  *       * ** 

HUM.LU_A        AGGATAACGGGCCGGTGCTACCTGGGTCCACCATGCTTCACTAGGCTGACTCTTAATAGG
YAR.LI_A        GGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT---------
                 ****  *   *  *** **  **            ** ** *    ** *         

HUM.LU_A        ACCATTTCTTTT
YAR.LI_A        ------------
                            

[Download ClustalW]

#111

Mean pairwise ID: 39.12%


TRY.BR_B        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
LYC.ES_L        --------------------------------GTTGGGTTGACCCAG-ATGGTTGGGTTC
                                                * **      *  **   **  *  ** 

TRY.BR_B        GACAAGCGGGGGTTCTG--TTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGTGTT
LYC.ES_L        GGTAGGCTTATAGTCTGGCCTGCCCTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTC
                *  * **      ****   ***  *  *   *  *   * * * *  **** *   ** 

TRY.BR_B        GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGG-GTCAGGC
LYC.ES_L        GAA-----------AGACCTGGGTTGCTTGATTCCTAAAGTGGGGTGGACTGCGTGAGGC
                **            ***   * ***          ********** * ** * ** ****

TRY.BR_B        CGGTG--ACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGAAGCACACCGAGGAG
LYC.ES_L        TGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGGATAACGGGTCAGTG
                 ***   ** ***** *  **  *** *** *  * * ** * ** *  **      * *

TRY.BR_B        CATCTCAGGAC---TTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT--------
LYC.ES_L        CTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAACCACCACTTT
                *    *  * *   **  *****  *  * *  * * *                

[Download ClustalW]

#112

Mean pairwise ID: 39.14%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAA-TGTT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *   *  *    **** *** ****

LYC.ES_N        GGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                  *   * ***   *     * * ***** **    *  ** *  * ** ** *  * * 

LYC.ES_N        GAGTTGGATCATGTGGCCCAATTGAAGAAATGG-ACTACTTGATTCGTAAAGTGGGGCGG
SCH.POM.        GATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **  **   * * **  * **  * **   * *    *  **     ****  * *  * 

LYC.ES_N        AATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGATA
SCH.POM.        ACCGATGGAGGTTGGAAACAATGCACATCACTA--CCGGGTCTTGGGCAGTGC---GATA
                *  *   **** ***   **  *  ** *  **      *   *  ** ***    ****

LYC.ES_N        ACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCAT
SCH.POM.        GCGA--TGGGATTCACC----TTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGT
                 ***   **  *** *        * *     **   **  *    **   ***   * *

LYC.ES_N        TTTT
SCH.POM.        T---
                *   

[Download ClustalW]

#113

Mean pairwise ID: 39.14%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAG-G
                          * * *   *   ***** *   * **    * **   *    *   *  *

LYC.ES_J        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCG
                   *  *****   *   *  *** ** * * *  *   **    * ** *   *    *

LYC.ES_J        AGTTGGATCACGAGGCC-CAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGA
LEI.MAJ.        GTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCG----TTGAAGCGAGG-GAA
                   *** *  *    *  ** * *       ***      *     * *** * ** * *

LYC.ES_J        CCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATA
LEI.MAJ.        CCGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACG-TCCGCCGTTGCAGAATC
                ***  * **** **    ** ******   **  * * * *  *  ** ** * ** ** 

LYC.ES_J        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
LEI.MAJ.        ACACCGCGGAGCATGTCCGCACTTGA----GCCCCACGCTTCGTCGCGAAGCCTT-----
                *     *** *  *   *    *       ***  * *  * *   * *           

LYC.ES_J        CTTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#114

Mean pairwise ID: 39.22%


TRI.AE_B        NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGG--CATTGAGGCGGTGTGGATGC
YAR.LI_B        --------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTC
                        ** **     ** * *   *   ****     *        * ****  * *

TRI.AE_B        TTGGTGCGGTTTGTTGGCCTGGGCTTGTGATGTAACCTTGCTGGCCTGCCCGTTCCAAGT
YAR.LI_B        GAGTTCTGGACT-CTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGG
                  * *  **  *  **  *******  *    *  **** * *   *   ** *  * * 

TRI.AE_B        TGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGCCTTAAGTGGCAGGC
YAR.LI_B        GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTC-CGTTCTAAGA--TTAACTGG--GAT
                  **   ** *** **    **     *   *** * **** **   **** ***  *  

TRI.AE_B        ACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCCGCTTCCAACGGTGGAAGGATA
YAR.LI_B        ACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTAT-GGCGGTGGGATAGCA
                **  *  * *     *    *****   *     * *  * *     ****** *    *

TRI.AE_B        ACAGGCCGCTGCAG--CATGGGCCCGCTCTGGGCCTCCTACCCCGCCATAGCAGACCACC
YAR.LI_B        ACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC---------------
                ***    * *  *    ****      * **      * ** *                 

TRI.AE_B        ATCTTT
YAR.LI_B        ------
                      

[Download ClustalW]

#115

Mean pairwise ID: 39.22%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAGTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAA----ATCGTCTTCTTGTTGTG
                      ** **     *  ** * *   * ******  *    *  **  *      ***

ARA.TH_D        -GTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAGCT
YAR.LI_A        CGTTCGAGTCTTGGGCTCTGCACTTG----GCCATTTGGTTGTCCTTTCCGAATTCTGCG
                 **** * ** * ** ** *  **      * *** *   **  **  **       ** 

ARA.TH_D        GTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGAGGG
YAR.LI_A        GTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                **   *   *     **     *  *  *  *     *      ******  *     **

ARA.TH_D        TAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGATGGA
YAR.LI_A        GAA-ACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGA
                 **  * * **  ***    *   ***** **     *  *  *       * **  ***

ARA.TH_D        TCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACCAC
YAR.LI_A        TCGCAACC--AAGTGGT----ATATGTTATGGAAGATATTTACGATCACGATT-------
                **  *     ****       **    *****        * ***** *   *       

ARA.TH_D        CACTTT
YAR.LI_A        ------
                      

[Download ClustalW]

#116

Mean pairwise ID: 39.27%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
                 *** ** * ** ***   ** ****  ** ***              **   *   *  

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
ZEA.MA_H        AATTGTGGTGCATGTGCCTGGGTCT--AGTGCTACAAACTGTG-GACCACCCATTCCAAG
                   *   *  ** * *    ** **  *****   *  * * * *  *  **   * ***

GAL.GAL.        GCCGGCA-TCAATATGGTGAGCCCCGG-GGAGCCGAGGCACACCAGGTTGCCTAAGGAGG
ZEA.MA_H        TTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAA---CACTAAAGTGG
                    * * *   * * *   ***  ** * *  *   ***  ***      **** * **

GAL.GAL.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAAC
ZEA.MA_H        CGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGA
                 *   *  *    ***  **    *  ******     * * ****   *   * **   

GAL.GAL.        GGGATCGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCTGTC
ZEA.MA_H        AGGATAATG---------AGTCGCTATGCTATAGGCCCAAT-------------------
                 ****   *         ** * **      *** *                        

GAL.GAL.        TCC
ZEA.MA_H        ---
                   

[Download ClustalW]

#117

Mean pairwise ID: 39.29%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
LYC.ES_L        --------------------------------------------------GTTGGGTTGA
                                                                  **  ** ** 

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
LYC.ES_L        CCCAGATGGTTGGGTTCGGTAGGC-TTATAGTCTGGCCTGCCC---TCTCCAAGCATGGA
                       **  * ** * **     *  * ***      * **     ***  **   * 

CAE.EL_C        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGGT
LYC.ES_L        GTTGGATCAC--GTGGCTTA--GTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGGGGT
                * **  ****  * ** * *  **** ****       * *  * * * *** * * ***

CAE.EL_C        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGG
LYC.ES_L        GGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGG
                ***  *     * * *     *   ****   ** ***  **** * *********  **

CAE.EL_C        ACAGCGCTTGTGAGTT----GACACGTATACACAGCCTTCTCAATACCTTCAGACCACTT
LYC.ES_L        ATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAACC
                * * **  *  * * *    **  *   *  **  ***  *      ** **    *   

CAE.EL_C        GTCACT--
LYC.ES_L        ACCACTTT
                  ****  

[Download ClustalW]

#118

Mean pairwise ID: 39.29%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
YAR.LI_A        --------------CTTAG--CTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                              * * *  ******    * *  *     **** **** *   * * 

HUM.LU_D        GGTCAAC-CTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCC
YAR.LI_A        GTTGTGCGTTCGAGTCTTGGGCTCTGCACT---TGGCCATTTGGTTGTCCTTTCCGAATT
                * *   *  * * *  * ***  * *   *   **   * * *  ** ** **** *   

HUM.LU_D        GGGAGTTGGGCTGAGTGACCTGGGCGAAG-GCTGGGTTGCGCAGCTCCTAGAGTGGAGGG
YAR.LI_A        CTGCGGTTGA-TGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                  * * * *  ** * * *  ** *  **   * ** *  *    * *     *      

HUM.LU_D        CAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGA
YAR.LI_A        AACTGGGAAACTTCAGTGGAGCAATCCAGCAG--AGATCCAGTTGCCGTGGGTATGGCGG
                 * ** *  *     *     **   ****    *  *** * *  **   **     * 

HUM.LU_D        TAACGGGCCGGTGCTACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGGACCA
YAR.LI_A        TG--GGATCGCAACCAAGTGG------TATATGTTATGGAA--GATATTTACGATCACGA
                *   **  **   * *  ***       **   * *  *    **   ***  *  ** *

HUM.LU_D        TTTCTTTT
YAR.LI_A        TT------
                **      

[Download ClustalW]

#119

Mean pairwise ID: 39.33%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAA--ATCGCCTTC
                                     ***** *  **  *  ****   * * *  *  *     

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_B        TTGTTGTGCGTTCGAGTTCTGGACT---CTGCACTGGGCTACTTTGTTGTCCTTTCCGAA
                   *** *     ********* **    *** **  **   *  * *****   *  * 

RAT.RAT.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATT-TCCGTTCTAAGA
                *** **        ** * *       ***     * *    ** **  *        * 

RAT.RAT.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_B        TTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

RAT.RAT.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTCTT
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTA---TGGAAGGTATT-TGCAATCACGACTCTC
                  * *   *  *  *     *  *    *   ***     **   *  * * ** **** 

[Download ClustalW]

#120

Mean pairwise ID: 39.33%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATC-GCCTTCT
                                     ***** *  **  *  ****   * * *  * ***   *

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
YAR.LI_B        TG-TTGTGCGTTCGAGTTCTGGACTC---TGCACTGGGCTACTTTGTTGTCCTTTCCGAA
                 * *** **    ********* **    *** **  **      *  ****   *  * 

GAL.GAL.        GCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGGG
YAR.LI_B        TTCTGCGGTTG-ATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGA
                  * **      ****    * * *        *    *     * *  *        * 

GAL.GAL.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACGGGA
YAR.LI_B        TTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGG
                * *** **   *  ** *    * *      ** *  *** **  * **  ***  * * 

GAL.GAL.        TCGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCTGTCTCC-
YAR.LI_B        TGGGA--TAGCAACAA--AGTGGTATATGTTATGGAAGGTATT-TGCAATCACGACTCTC
                * *    *   ** *   * **     *    ***     **   *  * *  * ***  

[Download ClustalW]

#121

Mean pairwise ID: 39.33%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAA--ATCGTCTTC
                                *    ***** *  **  *  ****   * * *  *  *     

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_A        TTGTTGTGCGTTCGAGTCTTGGGCT---CTGCACTTGGCCATTTGGTTGTCCTTTCCGAA
                   *** *     ****  ******    *** **  ***  * ** *****   *  * 

RAT.RAT.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_A        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATT-TCCGTTCTAAGA
                *** **        ** * *       ***     * *    ** **  *        * 

RAT.RAT.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_A        TTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

RAT.RAT.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTCTT
YAR.LI_A        GTGGGATCGCAACCAAGTGGTATATGTTA---TGGAAGATATT-TACGATCACGATT---
                  * *   *  *  *     *  *    *   ***   * **     ** * **  *   

[Download ClustalW]

#122

Mean pairwise ID: 39.40%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAG-G
                          * * *   *   ***** *   * **    * **   *    *   *  *

LYC.ES_A        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCG
                   *  *****   *   *  *** ** * * *  *   **    * ** *   *    *

LYC.ES_A        AGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGAC
LEI.MAJ.        GTGTGG--CTTGCCCCCCTGCAGAGGGTG-GCGCGGGTCCGCCGTTGAAGCGAGG-GAAC
                   ***  ** *   ***    **   *  * **   *       * *** * ** * **

LYC.ES_A        CGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCTGTGCAGTGGAAGGATAAT
LEI.MAJ.        CGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCAGAATCAC
                **  * **** **    ** ******   ** *  *     *  ** ** * ** ** * 

LYC.ES_A        GGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCT
LEI.MAJ.        ACCGCGGAGCATGTCCGCACTTGA----GCCCCACGCTTCGTCGCGAAGCCTT-------
                    *** *  *   *    *       ***  * *  * *   * *             

LYC.ES_A        TT
LEI.MAJ.        --
                  

[Download ClustalW]

#123

Mean pairwise ID: 39.44%


YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTT
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGG--CAATAAGGTAGTGTGGATG
                      **  *  *  *  ** * *   * *** **     *       *  ****  * 

YAR.LI_A        CGAGTCTTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGG
ZEA.MA_H        TCAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAAGT
                  * *  ***    **  * ***   *   * *      *  * *     *  *  * * 

YAR.LI_A        -GCGTCTCGG--TCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC-TGGGAAA
ZEA.MA_H        TGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACACTAAAGTGGCGGA
                 ****   **  *  *  *     *     ** *** * * * ** * ***  ***   *

YAR.LI_A        CTTCA-GTGGAGC-AATCCAGCAGAGATCCAGTTGCCGTGGGTA--TGGCGGTGGGATCG
ZEA.MA_H        CATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGAAGGA
                * *   ***  **         ****   *   * ***   *      ******* *   

YAR.LI_A        CAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT
ZEA.MA_H        TAAT-GAGTCGC-TATGCTATAGGCCCAAT--------------
                 **   *** *  **** *** *     **              

[Download ClustalW]

#124

Mean pairwise ID: 39.46%


TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
SCH.POM.        ---------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAATAGTGCATGTTCG
                          * **  *  *****      * **   *   *   * *  **      * 

TRI.AE_A        GTTGTAGCGC-TGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGTTG
SCH.POM.        GTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCGATCTGCCACGTCTGTTCGAAG---
                ** **  **  * ** * ** *  *  *    **    *** * ** * **** ***   

TRI.AE_A        CGTAGTGGACCGCCTGGGGCTTATGCGAAAGCTGGGTCTCACGGTCCATAATGTGGCAGG
SCH.POM.        ---AGTAGTCTTCGTGGCAACT----GGCAGTTAAACCGTGTAGTAC-CGATG-------
                   *** * *  * ***    *    *  ** *    *     ** *   ***       

TRI.AE_A        CACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGA
SCH.POM.        --------GAGGTTGGAAACAATGCACATCACTACCGG---GTCTTGGGCAGTGCGATAG
                        **** ***   **  *  ** *   * * *   *  *    * ***  *   

TRI.AE_A        TAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCAGACCACC
SCH.POM.        CGATGGG-----ATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT
                  *****        * ***  **    ** ** * * **  **  *     *  *   

[Download ClustalW]

#125

Mean pairwise ID: 39.47%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAA-TGTT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *  * * *    **** *** ****

LYC.ES_I        GGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                  *   * ***   *     * * ***** **    *  ** *  * ** ** *  * * 

LYC.ES_I        GAGTTGGATCATGTGGCCCAATTGAAGAAATGG-ACTACTTGATTCGTAAAGTGGGGCGG
SCH.POM.        GATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **  **   * * **  * **  * **   * *    *  **     ****  * *  * 

LYC.ES_I        AATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGATA
SCH.POM.        ACCGATGGAGGTTGGAAACAATGCACATCACTA--CCGGGTCTTGGGCAGTGC---GATA
                *  *   **** ***   **  *  ** *  **      *   *  ** ***    ****

LYC.ES_I        ACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCAT
SCH.POM.        GCGA--TGGGATTCACC----TTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGT
                 ***   **  *** *        * *     **   **  *    **   ***   * *

LYC.ES_I        TTTT
SCH.POM.        T---
                *   

[Download ClustalW]

#126

Mean pairwise ID: 39.47%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAG-G
                          * * *   *   ***** *   * **    * **   *    *   *  *

LYC.ES_H        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCG
                   ** *****   *   *  *** ** * * *  *    **   * *  *   *  * *

LYC.ES_H        AGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGAA
LEI.MAJ.        GTGTGGCT----TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAAC
                   *** *    ** ***  *  *     ***      *    ***  *   * * * * 

LYC.ES_H        TGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAA
LEI.MAJ.        CGGGTCAGGCCGGA--AACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAGAATCA
                 * ** **** **    ** ******   **  * * * *     ** ** * ** ** *

LYC.ES_H        TGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACC
LEI.MAJ.        CACCGCGGAGCATGTCCG----CACTTGAGCCCCACGCTTCGTCGCGAAGCCTT------
                     *** *  *   *     ** *   ***  * *  * *   * *            

LYC.ES_H        TTTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#127

Mean pairwise ID: 39.48%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCAGTGTGGTGGAA-TGTT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                      * *   *  **** *** ****

LYC.ES_C        GAACATGCCCAGAAG-GTAGGGCTTGTGTGACAATTCTCTGGCCTGCCCTGTCCAAGCAA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCT-CGCTTTCGATCCCT
                 *  *  ****  ** * * *    ***         **  * ** * ** ** *  *  

LYC.ES_C        AGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGG-GCTGCTGGGCTCCTAAAGTGGGGTG
SCH.POM.        CGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAG
                 **  **   * * **  * *** * ** *** * *      ***   ****  * *  *

LYC.ES_C        GACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGTGCAGTGGAAGGA
SCH.POM.        TACCGATGGAGGTTGGAAACAATGCACATC-ACTA--CCGGGTCTTGGGCAGTGCGATAG
                 ** *   **** ***   **  *  ** * * **   *  *   ** ******  *   

LYC.ES_C        TAACGAG--CCAGTGTCATATAAGTTCAACGAATGTCTGATGGGCTGTTCTAGTTAAACT
SCH.POM.        CGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAA-ACACAACGGTCGTT-----
                  * * *   **   **  *  *  *  * * * ** * *    *     * ***     

LYC.ES_C        ACCACATTT
SCH.POM.        ---------
                         

[Download ClustalW]

#128

Mean pairwise ID: 39.48%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTT
                                      *** *      **  *    ** *  **  *       

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTG-TATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAG
YAR.LI_B        GTTGTGCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTT-----GTCCTTTCCGAA
                  ** * *   **** ***   * **   * * **** * *       **** * ** * 

CAE.EL_D        CGCTACGTCACCAGGGGATAACTGTCGGA--AGGCGGTT----AGTCCCGGGTGCATAAG
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                  ** **      ***  *  * *** **  *  *** *      *  * * *  *  * 

CAE.EL_D        GAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAA-AGCGACCGCGTGGTGCAGTG
YAR.LI_B        TAACTG-GGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGCG
                 *   * ****  *****    * **   ****** *   **   *** * ***   * *

CAE.EL_D        GCCGGACCGCGCTTGTAAGTTGACACACAT-ACACAGCCTTCTCGATACCTTCAGACCAC
YAR.LI_B        GTGGGATAGCA---ACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC-
                *  ***  **      **  **  * *  * *   *   *  * *  * *   *  *   

CAE.EL_D        TTATCATTT
YAR.LI_B        ---------
                         

[Download ClustalW]

#129

Mean pairwise ID: 39.48%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTT
                                      *** *      **  *    ** *  **  *       

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTG-TATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAG
YAR.LI_B        GTTGTGCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTT-----GTCCTTTCCGAA
                  ** * *   **** ***   * **   * * **** * *       **** * ** * 

CAE.EL_A        CGCTACGTCACCAGGGGATAACTGTCGGA--AGGCGGTT----AGTCCCGGGTGCATAAG
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                  ** **      ***  *  * *** **  *  *** *      *  * * *  *  * 

CAE.EL_A        GAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAA-AGCGACCGCGTGGTGCAGTG
YAR.LI_B        TAACTG-GGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGCG
                 *   * ****  *****    * **   ****** *   **   *** * ***   * *

CAE.EL_A        GCCGGACCGCGCTTGTGAGTTGACACACAT-ACGCAGCCTTCTCGATACCTTCAGACCAC
YAR.LI_B        GTGGGATAGCA---ACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC-
                *  ***  **       *  **  * *  * * * *   *  * *  * *   *  *   

CAE.EL_A        TTATCATTT
YAR.LI_B        ---------
                         

[Download ClustalW]

#130

Mean pairwise ID: 39.48%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTT------GTCGGAGTGGTAAATCGTCTTCTTGTTG
                      *** *      * *  * *       **  * **   ***  *  *     ***

CIN.HYB.        AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCGA
YAR.LI_A        TGC---GTTCGAGTCTTGGGCTCTGCACTTGGC-CATTTGGTTGTCCTTTCCGAATTCTG
                 **   * *    *  * ** **** *     * **  *** *  **  * * ** **  

CIN.HYB.        GAGTGGGTTCATGTTTC---CTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGG--
YAR.LI_A        CGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACT
                  ** * *    ** **   *****  *  *     * *** *  * * **  **     

CIN.HYB.        GGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGA
YAR.LI_A        GGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTAT--GGCGGTGGG
                ***  * * *  * *     *    ***** * *     **          * * **** 

CIN.HYB.        AGGATTACAAGCCGGAGTGTCTTA-GGCTCATATA-ACCAGCCTGGCTAGCCCAACAGGA
YAR.LI_A        ATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT------------
                *     ** *   **  * * *** **   ****  ** * *  *  *            

CIN.HYB.        CACCCATTT
YAR.LI_A        ---------
                         

[Download ClustalW]

#131

Mean pairwise ID: 39.48%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
SCH.POM.        ----------------------------CGCTGTAATGGCTTGGTCGAAGTG-----TTT
                                            *   **   *** **   *** **     ** 

HUM.LU_D        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
SCH.POM.        AGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTT-CGAGTCT-CGCTTTCGATCCCT
                 **   ** * * *  *  ** * *** *  * * ** *  **** * * *** *  ** 

HUM.LU_D        GGAGTTGGGCTGAGTGACCTGGGCGAAGGCTGGGTTGCG--CAGCTCCTAGAGTGGAGGG
SCH.POM.        CGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAG
                 **  **    *  **  *   * * ** **  ** **     **   ** *  *    *

HUM.LU_D        CAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGA
SCH.POM.        TACCGATGGAGGTTGGAAACAATGCACATC-ACTACCGG--GTCTTGGGCAGTGCGATAG
                 *  *   **** ***   **  *  ** * ******    *   * *******  *   

HUM.LU_D        TAACGGGCCGGTGCTAC-CTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGGACC
SCH.POM.        CGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT------
                  * ***      ** * * ****   *   *    *        **  *   *      

HUM.LU_D        ATTTCTTTT
SCH.POM.        ---------
                         

[Download ClustalW]

#132

Mean pairwise ID: 39.52%


LYC.ES_M        -----------------CAAGTGGGGATGTTAAGGTGGTGGAATATTGGGCTGTCCCAGA
YAR.LI_A        CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGC-GTTCGAGT
                                    ** **  ** ***   *      * *** ** ** * ** 

LYC.ES_M        TGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTGTCCAAGCACAGAGTTGGATCACG
YAR.LI_A        C--TTGGGCTCTGCAC-TTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTGAT-GGG
                    ******  *     *      * *  ** *** *** *   * * * * ***   *

LYC.ES_M        AGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGACCGCATGAGGCTG
YAR.LI_A        CGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCA
                 * * *      *   ** *****   **** *     *  *    ** *    *     

LYC.ES_M        GCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATGGGTCGGTGTC
YAR.LI_A        GTGGAGCAATCCAGCAGAGA--TCCAGTT----GCCGTGG--GTATGGCGG-TGGGATCG
                *     **   ***   * *  *** * *    ** ****  * **   ** * **    

LYC.ES_M        TTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCTTT
YAR.LI_A        CAACCAAGTGGTATATGTTATGGAAGATATTTACGATCA-CGATT------
                  * *****    **     *    * *   * * ** * * *        

[Download ClustalW]

#133

Mean pairwise ID: 39.55%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGCT
YAR.LI_B        ------AGCTGTAATGGCATTTTGT---CGGAGTGGT-------AAATCGCCTTCTTGTT
                        *****  *  *  ****   * *** **        *  * **     ** *

ZEA.MA_B        TTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCCCAAGTT
YAR.LI_B        GTGCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTT-GTTGTCCTTTCCGAATTCTGCG
                 **** * *  *   ** **  ** *   *  *** * *  * * *  **       *  

ZEA.MA_B        GGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGGCAGG
YAR.LI_B        GTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                * *  **   * *  **    **  *  *  ** *   * * *   *  * *    * **

ZEA.MA_B        AATGGCGTAAGGCTGGCTTCACAGAGCAGCGATC-ACTCGCC-CACTTCCAACGGTGGGA
YAR.LI_B        GATACTTCAG---TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGA
                 **     *    ***    *   ***** **** * * ***     *    ********

ZEA.MA_B        GGATAACAAGCCGCTGCACTTTGAGCCCAACACA---GACCCAGATCCTCTCTTAGCAAA
YAR.LI_B        TAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC----------
                    *****   * *  *  **  *      *      * *  **  ***          

ZEA.MA_B        CCACCATCTTT
YAR.LI_B        -----------
                           

[Download ClustalW]

#134

Mean pairwise ID: 39.56%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGCT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGT-------AAATCGTCTTCTTGTT
                      **  *  *  *  ** * *   * *** **        *  * ** *   ** *

ZEA.MA_A        TTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCCAAG
YAR.LI_A        GTGCGTTCGAGTCTTGGGCTCTGCACTTG-------GCCATTTGG-TTGTCCTTTCCGAA
                 **** * *  *  ***** ***  ** *        *     ** *** ** * ** * 

ZEA.MA_A        TTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCGGC
YAR.LI_A        TT--CTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAG
                **    * *  ** **** *     *    **   * **  *    *   * *       

ZEA.MA_A        AGGAATGGCGTAAGGCTGGCTTCACAG---AGCAGCGATC--ACTGCCG-ACTCCCAACG
YAR.LI_A        ATTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCG
                *  **  * * **     *     **    ***** ****    *****         **

ZEA.MA_A        GTGGGAGGATAACGAAGCCGC-TGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAA
YAR.LI_A        GTGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-------
                ******    *** ***  *  *    * **      * * * * ***  *         

ZEA.MA_A        GCAAACCACCATCTTT
YAR.LI_A        ----------------
                                

[Download ClustalW]

#135

Mean pairwise ID: 39.60%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATC--GTCTTC
                                *    ***** *  **  *  ****   * * *  *  *     

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_A        TTGTTGTGCGTTCGAGTCTTGGGCTCT---GCACTTGGCCATTTGGTTGTCCTTTCCGAA
                   *** *     ****  ****** *   ** **  ***  * ** *****   *  * 

RAT.NOR.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_A        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **     * *  

RAT.NOR.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_A        T-AACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

RAT.NOR.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGTCTCT
YAR.LI_A        GTGGGATCGCAACCAAGTGGTATATGTTA---TGGAAGATATTTACGATCACGATT--
                  * *   *  *  *     *  *    *   ***   * **       * **  *  

[Download ClustalW]

#136

Mean pairwise ID: 39.60%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
SCH.POM.        ----------------------------------------CGCTGTAATGGCTTGGTCGA
                                                        ** *  *   *  ***  * 

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGA--CCGAGCGTCCGTGCCAA
SCH.POM.        AGTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGA
                ****    *      *    * *  *  ****      **    ****  **  *  * *

CAE.BRI.        GCGCTGCGTC-GCCAGGGGTCTCCGGTCGGAAGGCTG-GCGGTCCCGGGCGCATAAGGAG
SCH.POM.        TCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCG
                 * **   ** **** *  * * **    * ** **  * **   * ***   ***   *

CAE.BRI.        TGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCCG
SCH.POM.        TGTAGTACCGATGGAGGTTGGAAA-CAATGCACATCA-CTACCGGGTCTTG-GGCAGTGC
                **  * ** * *   **  * **  **     **  * * **** *   **  *  *   

CAE.BRI.        GATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTTGTC
SCH.POM.        GATAGCG---ATGGGAT-TCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTC
                *******    ** * * ** *   * **     *   **  *   * *   **   ***

CAE.BRI.        ATT
SCH.POM.        GTT
                 **

[Download ClustalW]

#137

Mean pairwise ID: 39.61%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
LYC.ES_L        --------------------------------------------------GTTGGGTTGA
                                                                  **  ** ** 

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
LYC.ES_L        CCCAGATGGTTGGGTTCGGTAGGC-TTATAGTCTGGCCTGCCC---TCTCCAAGCATGGA
                     * **  * ** * ** **  ** * * *      * **     ***  **   * 

CAE.BRI.        GCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTGGT
LYC.ES_L        GTTGGATCACGTGG----CTTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGGGGT
                * **  ** *  **        **** *** *  * * * *  *   * *** * * ***

CAE.BRI.        GCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCCGG
LYC.ES_L        GGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGG
                * ** **    *** *     *   ****   ** ***  **** * *********  **

CAE.BRI.        ATAGCGCTTGTGAGTT----GTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTT
LYC.ES_L        ATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAACC
                *** **  *  * * *    *   *  *   **  ***    *    ** **    *   

CAE.BRI.        GTCATT--
LYC.ES_L        ACCACTTT
                  ** *  

[Download ClustalW]

#138

Mean pairwise ID: 39.67%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
ZEA.MA_H        ---NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGAT
                       ** *  * ***   **     *  *      * **    *  ** *  ***  

DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTTGACGGAACGTCCGCACTAA
ZEA.MA_H        GTCAATTGTGGTGCA-TGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAA
                      ** * *  * ** *    ** * **  **         *** *  **   * **

DRO.MEL.        GCT-TGCCATCAATAT-GGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAG
ZEA.MA_H        GTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCT-TTGCATCCCAAC--ACTAAAGTG
                * *  *   *   * * ** **** *** * *  *  * **** *       **** * *

DRO.MEL.        GGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
ZEA.MA_H        GCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGG
                *     *  * *  ***  **    *   ****** *  *   ****      ** ** *

DRO.MEL.        TGGGATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCACAA
ZEA.MA_H        AAGGATAATGAGTCGCTAT--------GCTATAGGCCCAAT-------------------
                  *****  *   **   *        * ***  ******                    

DRO.MEL.        TCTTT
ZEA.MA_H        -----
                     

[Download ClustalW]

#139

Mean pairwise ID: 39.67%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAA-TGTT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *  * * *    **** *** ****

LYC.ES_B        GGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTA
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTC
                  *   * ***   *     * * ***** **    *  ** *  * ** ** *  * * 

LYC.ES_B        GAGTTGGATCATGTGGCCCAATTGAAGAAATGG-ACTACTTGATTCGTAAAGTGGGGCGG
SCH.POM.        GATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGT
                **  **   * * **  * **  * **   * *    *  **     ****  * *  * 

LYC.ES_B        AATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTGGAAGGAT
SCH.POM.        ACCGATGGAGGTTGGAAACAATGCACATCACTA---CCGGGTCTTGGGCAGTGC---GAT
                *  *   **** ***   **  *  ** *  **       *   *  ** ***    ***

LYC.ES_B        AACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAACCACCA
SCH.POM.        AGCGA--TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATA----AACACAACGGTCG
                * ***   **  *** *     *  *   *** **   *  *     **   ***   * 

LYC.ES_B        CTTTT
SCH.POM.        TT---
                 *   

[Download ClustalW]

#140

Mean pairwise ID: 39.67%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCAGTGTGGTGGAATGTTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTG-GTAAATCGTCTTCTTGTTGTGC-G
                      ** **  *    *** * *      **** *   ***    *  **   **  *

LYC.ES_C        AACATGCCCAGAAGGTAGGGCTTGTGTGACAATTCTCTGGCCTGCCCTGTCCAAGCAAAG
YAR.LI_A        TTCGAGTCTTGGGCTCTGCACTTG---GCCATTTGGTTGTCCTTTCCGAATTCTGCGGTT
                  *  * *  *      *  ****   * ** **   ** ***  **       **    

LYC.ES_C        AGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCCTAAAGTGGGGTGGAC
YAR.LI_A        GAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGA
                  * ***  *   ** *  **  *  *  *  *    *    * ****  *    ***  

LYC.ES_C        TGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGTGCAGTGGAAGGATAA
YAR.LI_A        AACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATCG
                  * * **  ***    *   ****  **     *  *  *  **   * **  ****  

LYC.ES_C        CGAGCCAGTGTCATATAAGTTCAACGA-ATGTCTGATGGGCTGTTCTAGTTAAACTACCA
YAR.LI_A        CAACCAAGTGGTATATGTTATGGAAGATATTTACGATCA-CGATT---------------
                * * * ****  ****    *  * ** ** *  ***   *  **               

LYC.ES_C        CATTT
YAR.LI_A        -----
                     

[Download ClustalW]

#141

Mean pairwise ID: 39.68%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
SCH.POM.        ----------------------------CGCTGTAATGGCTTGGTCGAAGTG-----TTT
                                            *   **   *** **   *** **     ** 

HUM.LU_A        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
SCH.POM.        AGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTT-CGAGTCT-CGCTTTCGATCCCT
                 **   ** * * *  *  ** * *** *  * * ** *  **** * * *** *  ** 

HUM.LU_A        GGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTC--CTAGAGTGGAGG
SCH.POM.        CGATCTGCCACGTCTGTTCGAAGAGTAGT-CTTCGTGGCAACTGGCAGTTAAACCGTGTA
                 **  **    *  **  *   * * **  **  ** **    * *   ** *  *    

HUM.LU_A        GCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGG
SCH.POM.        GTACCGATGGAGGTTGGAAACAATGCACATC-ACTACCGG--GTCTTGGGCAGTGCGATA
                * *  *   **** ***   **  *  ** * ******    *   * *******  *  

HUM.LU_A        ATAACGGGCCGGTGCTACCTGGGTCCACCATGCTTCACTAGGC-TGACTCTTAATAGGAC
SCH.POM.        GCGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT-----
                   * ***      ** *   **     ****      **  *   **  *   *     

HUM.LU_A        CATTTCTTTT
SCH.POM.        ----------
                          

[Download ClustalW]

#142

Mean pairwise ID: 39.68%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGG-GCATTAAGGTGGTGTGGATGT
YAR.LI_B        ------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTCGA
                        *****  *  *  ****       *      ** **   ** *** *   * 

ZEA.MA_F        TTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCCAAG
YAR.LI_B        GTTCTG---GACTCTGCAC-TGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATG
                 * ***   ** ****  * ******  * ***    **  ***   *   ** *  * *

ZEA.MA_F        TTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGACCTGAAGCGGCAG
YAR.LI_B        GGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTT---CCGTTCTAAGATT-AACTGGGAT
                   **   **   * *      *     **   *   **  * **    * **  ** * 

ZEA.MA_F        GCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTGGGAG
YAR.LI_B        ACTTCA-GTGGAGC-AATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGAT
                 * *   ***  **        *****   *  *  *   *  *  *    ******** 

ZEA.MA_F        GATAACAGGCCGCTGCAT----TGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGAC
YAR.LI_B        AGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC-----------
                   ****    * *  **    ** ***       *  **  **  ***           

ZEA.MA_F        CACCATCTTT
YAR.LI_B        ----------
                          

[Download ClustalW]

#143

Mean pairwise ID: 39.68%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_L        --------------------------------------------------GTTGGGTTGA
                                                                  **  ** ** 

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
LYC.ES_L        CCCAGATGGTTGGGTTCGGTAGGC-TTATAGTCTGGCCTGCCC---TCTCCAAGCATGGA
                       **  * ** * **     *  * ***      * **     ***  **   * 

CAE.EL_B        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGGT
LYC.ES_L        GTTGGATCAC--GTGGCTTA--GTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGGGGT
                * **  ****  * ** * *  **** ****       * *  * * * *** * * ***

CAE.EL_B        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGG
LYC.ES_L        GGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGG
                ***  *     * * *     *   ****   ** ***  **** * *********  **

CAE.EL_B        ACTGCGCTTGTGAGTTGA-CACGTATACACAGCCTTCTCAATACCTTC-------AGACC
LYC.ES_L        ATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAACC
                *   **  *  * * * * *  **  *   * *   ** *    ** *       * ***

CAE.EL_B        ACTTGTTTTT
LYC.ES_L        ACCACTTT--
                **   ***  

[Download ClustalW]

#144

Mean pairwise ID: 39.72%


LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCTGG
YAR.LI_B        -----AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTCGAG
                     ***  *  *         **** *   *  * *  **       * **  **  *

LEP.COL.        ACCAGCATAGGGTGCTTG-CGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGAGGC
YAR.LI_B        TTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGT
                  * * *    *  ** * *  * ***  **  *   *   **    *  **  **  * 

LEP.COL.        CTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAGGAACTGGGTC
YAR.LI_B        CTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTG
                *** *  **     * *     * *     *   **  * * ** * *   *  *  ** 

LEP.COL.        AGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGCAG-AACCACACCGCGG
YAR.LI_B        GAGCAATCCA-GCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATAGCAACAAAGTGG
                  **   * * * **    ***  *  **   ** ** ** **    * * ***  * **

LEP.COL.        AGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT
YAR.LI_B        TATATGTTATGGAAGGTATTT---GCAATC--ACGACTCTC-
                    *** **     *        ** ***    **  **  

[Download ClustalW]

#145

Mean pairwise ID: 39.73%


LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCTGG
YAR.LI_A        ---------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTG
                                 ** *  *   **  ***   * *      *    *   *** *

LEP.COL.        ACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTG----TCGGA
YAR.LI_A        TTGTGCGTTCGAGTCTTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGC
                    ** *  *   **** *   *  ** ***   * ** *** *  *       ** * 

LEP.COL.        GGCCTCCGGGTGCCCC--CTTGCAGAAGGGGCGC-GCCCCCTCCGTTAAAGTAGAGGAAC
YAR.LI_A        GGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTA--AGATTAAC
                **     *** * * *    **   **  ***   *     ******  *  ***  ***

LEP.COL.        TGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGCAGAACCACAC
YAR.LI_A        TGGGAAA---CTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGG--GTATGGCGG
                ****  *   *  **  ******  *** *       *   ****** *  * *   *  

LEP.COL.        CGCGGAGCCTGTCA--TCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT---
YAR.LI_A        TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT
                 * *    *   **  *    *  *     *  ***  *    * *      

[Download ClustalW]

#146

Mean pairwise ID: 39.74%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAA-ATCGTCTTCTTGTTGTGC--
                      ** **    *** ** * *   *   ****  * **     *  **     *  

ARA.TH_A        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
YAR.LI_A        GTTCGAGTCTTGGGCTCTGCACT----TGGCCATTTGGTTGTCCTTTCCGAATTCTGCGG
                *****  ** * ** ** *  **    *** *** *   **  **  **       ** *

ARA.TH_A        TGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGGAGGG
YAR.LI_A        TTGATGGGC-GTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                *   *     ** * *   ****  *  *  *     **    ******   *     **

ARA.TH_A        TAATGCGTGAGGCTGGCTTCACAGAGCAGCGA-CTACTTCCCGCTTACAGCAGTGGACGG
YAR.LI_A        GAA-ACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCGGTGGG
                 **  * * **  ***    *   ***** ** * * ** ***     *   * **  **

ARA.TH_A        ATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCA
YAR.LI_A        ATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT------------
                *** *     ** *         *           * *     ****             

ARA.TH_A        CCATTTT
YAR.LI_A        -------
                       

[Download ClustalW]

#147

Mean pairwise ID: 39.74%


HUM.LU_C        GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTGGGT
YAR.LI_A        -----------CTTAG--CTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTT
                           *** *  ******    * *  *     **** **** *   * * * *

HUM.LU_C        CAAC-CCAGTGGTNCGGGNCCAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAAGC----
YAR.LI_A        GTGCGTTCGAGTCTTGGGCTCTGCACT---TGGCCATTTGGTTGTCCTTTCCGAATTCTG
                   *    * *    ***  * *  **   **   *   ** ** ** **** *      

HUM.LU_C        CGGGAGGTGGGCTGAGGGACCTGGGCGAA-GGCTNNNGGNGCGCACTCCTAGACTGGAGG
YAR.LI_A        CGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACT
                ***  * *****     *  *** *  *  ****    *    *  * ***   *  *  

HUM.LU_C        GCAATGCGTGAGGCTGGCTTCACAGAGCAGCGA-CTACCTCCCGCT--CTCGGCAGTGGA
YAR.LI_A        GGGAAACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGG
                *  *  * * **  ***    *   ***** ** * *  * ***       *** **** 

HUM.LU_C        AGGATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGG
YAR.LI_A        ATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT------------
                *    ***     ***     **  *  *    * * * *    * *             

HUM.LU_C        ACCATTTCTTTT
YAR.LI_A        ------------
                            

[Download ClustalW]

#148

Mean pairwise ID: 39.74%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAG---GAG
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCG----GGGGCAATAAGGTAGTGTGGA
                 *** ** * ** *** * ** ****  ** ***     ***    * *** **   *  

CAN.SPE.        GATCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACT
ZEA.MA_H        TGTCAATTGTGGT-GCATGTGCCTGGGTCTAGTGCTACAAACTG-TGGACCACCCATTCC
                  **  *** *       ** *  ** *  *****   *  * * * *     **   * 

CAN.SPE.        AAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
ZEA.MA_H        AAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACAC-TAAAGTG
                *****  * *      *   **   *  **     *     ** *      * *** * *

CAN.SPE.        GGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTG
ZEA.MA_H        GCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC-ACCAGCGGTG
                * *   *  *    ***  **   *  **     * *    * *  **  * ***  ***

CAN.SPE.        GGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCT
ZEA.MA_H        GAAGGA------TAATGAGTCGCTATGCTATAGGCCCAAT--------------------
                * *         * *  ** * **   **  ** *                         

CAN.SPE.        CT
ZEA.MA_H        --
                  

[Download ClustalW]

#149

Mean pairwise ID: 39.80%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATC--GCCTTC
                                     ***** *  **  *  ****   * * *  *  *     

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_B        TTGTTGTGCGTTCGAGTTCTGGACTCT---GCACTGGGCTACTTTGTTGTCCTTTCCGAA
                   *** *     ********* ** *   ** **  **   *  * *****   *  * 

RAT.NOR.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **     * *  

RAT.NOR.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_B        T-AACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

RAT.NOR.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGTCTCT-
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTA---TGGAAGGTATTTGCAATCACGACTCTC
                  * *   *  *  *     *  *    *   ***     **    *  * ** **** 

[Download ClustalW]

#150

Mean pairwise ID: 39.80%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAG-G
                          * * *   *   ***** *   * **    * **   *    *   *  *

LYC.ES_K        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTA-GTTCTGGCCTGCCCTGTCCAAGCACA
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCG
                   *  *****   *   *  *** ** * * * **  **  ****   *        * 

LYC.ES_K        GAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGA
LEI.MAJ.        GTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCG----TTGAAGCGAGG-GAA
                * ** *  *  *      ** * *       ***      *     * ***** ** * *

LYC.ES_K        CCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATA
LEI.MAJ.        CCGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACG-TCCGCCGTTGCAGAATC
                ***  * **** **    ** ******   **  * * * *  *  ** ** * ** ** 

LYC.ES_K        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
LEI.MAJ.        ACACCGCGGAGCATGTCCGCACTTGA----GCCCCACGCTTCGTCGCGAAGCCTT-----
                *     *** *  *   *    *       ***  * *  * *   * *           

LYC.ES_K        CTTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#151

Mean pairwise ID: 39.80%


TRI.AE_B        NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGG--CATTGAGGCGGTGTGGATGC
YAR.LI_A        -----CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTTC
                       *** **     ** * *   *   ****     * *      * ****  * *

TRI.AE_B        TTGGTGCGGTTTGTTGGCCTGGGCTTGTGATGTAACCTTGCTGGCCTGCCCGTTCCAAGT
YAR.LI_A        GAGTCTTGGGCTCTGCACTTGGCCATTTGGT-TGTCCTTTCCGAATTCTGCGGTTGATGG
                  *    **  * *   * *** * * ** * *  **** * *   *   ** *  * * 

TRI.AE_B        TGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGCCTTAAGTGGCAGGC
YAR.LI_A        GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTC-CGTTCTAAGA--TTAACTGG--GAA
                  **   ** *** **    **     *   *** * **** **   **** ***  *  

TRI.AE_B        ACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCCGCTTCCAACGGTGGAAGGATA
YAR.LI_A        ACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGT----ATGGCGGTGGGATC
                **  *  * *     *    *****   *     * *  * *    * ** **  **** 

TRI.AE_B        ACAGGCCGCTGCAGCATGGGCCCGCTCTGGGCCTCCTACCCCGCCATAGCAGACCACCAT
YAR.LI_A        GCAACCAAGTGGTATATG------TTATGGAAGATATTTACGATCACGATT---------
                 **  *   **    ***       * ***      *   *   **              

TRI.AE_B        CTTT
YAR.LI_A        ----
                    

[Download ClustalW]

#152

Mean pairwise ID: 39.87%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
SCH.POM.        --------------------------------CGCTGTAATGGCT--TGGTCGAAGTGTT
                                                  **** * * **  * ** * *  *  

DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAGC
SCH.POM.        TAGTACTCCCAA-TAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCT
                *    **   *  ** *** *    *     ***  ***   *   **    *  *    

DRO.MEL.        TTGCCATCAATATGGGTGCCATGGAGGAGTC--CGTGGCATTCAGGTTGGCTAAGGAGGG
SCH.POM.        CGATCTGCCACGTCTGT-TCGAAGAGTAGTCTTCGTGGCAACTGG--CAGTTAAACCGTG
                    *  * *  *  **  *   *** ****  *******    *    * ***   * *

DRO.MEL.        ATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGGG
SCH.POM.        TAGTACCGA--TGGAGGTTGGAAACAATGCACATCACTACCGGGTCTTGG--GCAGTGCG
                  * ****     * ***   ** **     **  * * ** *   * **  * **** *

DRO.MEL.        ATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCACAATCTT
SCH.POM.        ATAGCG--ATGGGATTCACCTTCGCAGGATGTGCA-TGGAAGTATAAACACAACGGTCGT
                ******    **  *  **   **      *  **   **  *      ** **  ** *

DRO.MEL.        T
SCH.POM.        T
                *

[Download ClustalW]

#153

Mean pairwise ID: 39.87%


ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
TRI.AE_C        ------------------------------------------------------------
                                                                            

ZEA.MA_H        AATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAAGTTG
TRI.AE_C        -------------------------------------GGTGGTCTGCCCGTTCCAAGTTG
                                                      **** *  *** **********

ZEA.MA_H        CGTAGTGGGTTTCG-GATGCCTTGGCGAAAGCTTTGCATCCCAACAC-TAAAGTGGCGGA
TRI.AE_C        AGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGG
                 *******    *  *  ****  ******* *  ** ** *    * *** ***** * 

ZEA.MA_H        CATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGAAGGA
TRI.AE_C        CACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGA
                **  ***************** **********  ** ******  *** ***********

ZEA.MA_H        TAATGAGTCGCTATGCTATAGGCCCAAT--------------------------------
TRI.AE_C        TAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCACCAT
                *** * * ****   **    * **  *                                

ZEA.MA_H        -
TRI.AE_C        C
                 

[Download ClustalW]

#154

Mean pairwise ID: 39.87%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
SCH.POM.        ----------------------------------------CGCTGTAATGGCTTGGTCGA
                                                        ** *  *   *  ***  * 

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGA--CCGAGCGTCCGTGCCAA
SCH.POM.        AGTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGA
                ****    *      *    **   *  * *      ***    ****  **  *  * *

CAE.EL_C        GCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTG
SCH.POM.        TCCCTCGATCTGCC----ACGTCTGTTCGAAGAG---TAGTCTTCGTGGCAACTGGCA-G
                 * **   **  *     * * ****  *****     ****   *  ***   **   *

CAE.EL_C        GTGGATGGTTCAGGACCGA--AAGGTAGCAGACAAAAGCCACCGC-GCGGTGCAGTGGCC
SCH.POM.        TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCACTACCGGGTCTTGGGC
                 *  *  **  ** *****   **** * * ****    ** * *  * * *   *** *

CAE.EL_C        GGACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCA-ATACCTTCAGAC-CACTT
SCH.POM.        AG--TGCGATAGCGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACG
                 *   *** * * **   **  *   * * ***  *   **   *  *  * ** **   

CAE.EL_C        GTCACT
SCH.POM.        GTCGTT
                ***  *

[Download ClustalW]

#155

Mean pairwise ID: 39.94%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGGGCATTAAGGTGGTGTGGATGTT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAA----ATCGTCTTCTTGTTGTG
                      **  *  *  *  ** * *   *  ** **       *  **  * * * *** 

ZEA.MA_F        TCCTGACGGATTCTGGGC-CTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCCAAG
YAR.LI_A        CGTT--CGAGTCTTGGGCTCTGCACTTGGCCAT----TTGGTTGTCCTTTCCGAATTCTG
                   *  **  *  ***** ***  ****    *     ***  * ***  ***      *

ZEA.MA_F        TTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGACCTGAAGCGGCAG
YAR.LI_A        CGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACT
                  * *  ***  *    **   * *  *  * **  *    **  *  ** *        

ZEA.MA_F        GCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATC-ACTCGCC-CGCTTCCAACGGTGGG
YAR.LI_A        GGGAAACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGG
                *     * * **  ***    *   ***** **** * * ***  *  *    *******

ZEA.MA_F        AGGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGACCA
YAR.LI_A        ATCGCAACCAAGTGGTATATGTTATGG--AAGATATTTACGATCACGATT----------
                *    ***     * *  **   * *   **     *   ** *   ***          

ZEA.MA_F        CCATCTTT
YAR.LI_A        --------
                        

[Download ClustalW]

#156

Mean pairwise ID: 39.94%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGGATGCT
LYC.ES_D        ------------------------------------------------------------
                                                                            

ZEA.MA_C        TGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAGTT
LYC.ES_D        ----------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCA
                                                     *  **********  ******  

ZEA.MA_C        GGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTGGCAG
LYC.ES_D        CAGAGTAGGATCACGAGGCCCAAATG-AAAATATGGGCTTCTTGATTCCTAAAGCGGGGC
                   *** *      ** **      * *     ******** *    **** ** **   

ZEA.MA_C        GAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGGAAGG
LYC.ES_D        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGG
                * ** ** ******** ************* ** **   ** *** *   * ********

ZEA.MA_C        ATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAGACCA
LYC.ES_D        ATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCA
                ****  ** *  **    **    *    *** *****            **  * ****

ZEA.MA_C        CCATTTTT
LYC.ES_D        CCACTTTT
                *** ****

[Download ClustalW]

#157

Mean pairwise ID: 40.00%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
YAR.LI_A        -------------------CTTAGCTGTAATGGCATTTTGTCGGAG-TGGTAAATCGTCT
                                     ** *   * ***     *** ***  *** * ** *  *

HUM.LU_B        CAGCCCAGTG-GATCGGGTCCAGTGTT----AGCTGCTTACTGGTCTGCCCATTCCAAGC
YAR.LI_A        TCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAAT
                       *** * *** ***  * * *    *  **   * * *  ** ** **** *  

HUM.LU_B        ----CGGGAGTTGGGCTGAGTGACCTGGGCGAA-GGCCTGGGTTGCGCAGCTCCTAGAGT
YAR.LI_A        TCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                    ***  * *****     *  *** *  *  *** * *      * * **  *** *

HUM.LU_B        GGAGGGCAA--TGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAG
YAR.LI_A        AACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGT--GGGTATGGCGG
                    ** **  * *    *     *    *****   *   * **    *     *** *

HUM.LU_B        TGGAAGGATAACGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAAT
YAR.LI_A        TGGGATCGCAACCAAGTGGTA-TATGTTATGGAAGATATTTAC-GATCACGATT------
                *** *    ***     ***  **  *  *  *  ** ** ** * **  ** *      

HUM.LU_B        CGGACCATTTCCTTT
YAR.LI_A        ---------------
                               

[Download ClustalW]

#158

Mean pairwise ID: 40.00%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
SCH.POM.        ---------CGCTGTAATGGCTTG---GTCGAAGTGTTTAGTACTCCCAATAGTGCATGT
                         **  *     *****   ***    * ** *        **  *** *** 

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGA--GCGTCCGTGCCAA
SCH.POM.        TCGGTGGTCTCGGGTTC-GAGTCTCGCTTTCGATCCCTCGATCTGCCACGTCTGTTCGAA
                   * *     * ** * * ** *  * **   * * **** *     **** ** * **

CAE.EL_A        GCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGG-GTGCATAAGGAGT
SCH.POM.        GAGTAGTCTTCGTGGCAACTGGCAGTT--AAACCGTGTAGTACCGATGGAGGTTGGAAAC
                * *     *     *    *  * **   **  **  **** ***  *    *  * *  

CAE.EL_A        CGTGGATGGTTCAGGACCGAAAGGTAG-CAG-ACAAAAGCGACCGCGTGGTGCAGTGGCC
SCH.POM.        AATGCACA--TCACTACCGGGTCTTGGGCAGTGCGATAGCGATGGGATT-CACCTTCGCA
                  ** *    ***  ****     * * ***  * * *****  *  *    *  * ** 

CAE.EL_A        GGACCGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTAT
SCH.POM.        GGAT-GTGCATGGAAGTATAAACACAACGGTCGTT-------------------------
                ***  * ** **  ***  * *****   *  *                           

CAE.EL_A        CATTT
SCH.POM.        -----
                     

[Download ClustalW]

#159

Mean pairwise ID: 40.00%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
                 *** ** * ** *** **** ****  ** ***              **  **** *  

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
ZEA.MA_H        AATTGTGGTGCATGTGC-CTGGG-TCTAGTGCTACAAACTG-TGGACCACCCATTCCAAG
                   *   ** ** * *  ***** * ******   *  * * * *     **   * ***

HOM.SA_A        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
ZEA.MA_H        TTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACAC-TAAAGTGGCG
                **  * *      *   **   *  **     *     ** *      * *** * ** *

HOM.SA_A        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
ZEA.MA_H        GACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC-ACCAGCGGTGGAA
                   *  *    ***  **   *  **     * *    * *  **  * ***  **** *

HOM.SA_A        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTCTT
ZEA.MA_H        GGA------TAATGAGTCGCTATGCTATAGGCCCAAT-----------------------
                         * *  ** * **   **  ** *                            

[Download ClustalW]

#160

Mean pairwise ID: 40.00%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAA-TCGCCTTCT
                                     ***** *  **  *  ****   * * *   **     *

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_B        TG-TTGTGCGTTCGAGTTCTGGACTCT---GCACTGGGCTACTTTGTTGTCCTTTCCGAA
                 * *** *     ********* ** *   ** **  **   *  * *****   *  * 

ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **     * *  

ORI.CUN.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_B        T-AACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

ORI.CUN.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGTCTCC-
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTA---TGGAAGGTATT-TGCAATCACGACTCTC
                  * *   *  *  *     *  *    *   ***     **   *  * *  * ***  

[Download ClustalW]

#161

Mean pairwise ID: 40.00%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
LYC.ES_D        ------------------------------------------------------------
                                                                            

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
LYC.ES_D        ----------------------------------------TAGTTCTGGCCTGCCCTGTC
                                                        *  * ***** *****  **

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
LYC.ES_D        CAAGC-ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGG-----CTTCTTGATTCC
                ****   *  *** **     * ***      ***    *  *     *****     **

ORY.SA_A        TAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCA
LYC.ES_D        TAAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGT
                ***** **   * ** ** ********************** ** **   ******    

ORY.SA_A        TCGGTGGAAGGATAACAGGCTGCTGCACC-TTGGGCCCGCTTCTGGCCCA-GAGTCCCTC
LYC.ES_D        GCAGTGGAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTC
                 * ************  **  * **     *   *  *  *   * *  * * **  ***

ORY.SA_A        TACAACAGACCACCATCTTT
LYC.ES_D        CA-ACTAAACCACCACTTTT
                 * *  * *******  ***

[Download ClustalW]

#162

Mean pairwise ID: 40.07%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAA-ATCGTCTTCTTGTTGTGC--
                      ** **    *** ** * *   *   ****  * **     *  **     *  

ARA.TH_F        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
YAR.LI_A        GTTCGAGTCTTGGGCTCTGCACT----TGGCCATTTGGTTGTCCTTTCCGAATTCTGCGG
                *****  ** * ** ** *  **    *** *** *   **  **  **       ** *

ARA.TH_F        TGAGTAATTAGTGTTGAGTTGAGCGA--AGGCTTGGCTTGCAGGTTCTAGAGTCGGAGGG
YAR.LI_A        TTGATGGGC-GTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                *   *     ** * *   ****  *   *  ***   *    ******   *     **

ARA.TH_F        TAATGCGTGAGGCTGGCTTCACAGAGCAGCGA-CTACTTCCCGCTTACAGCAGTGGACGG
YAR.LI_A        GAA-ACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCGGTGGG
                 **  * * **  ***    *   ***** ** * * ** ***     *   * **  **

ARA.TH_F        ATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCA
YAR.LI_A        ATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT------------
                *** *     ** *         *           * *     ****             

ARA.TH_F        CCATTTT
YAR.LI_A        -------
                       

[Download ClustalW]

#163

Mean pairwise ID: 40.07%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  * * *    *  * *

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
TRY.BR_A        CGGGGACGTCTTGGACAAGCGGGGGTT-CTGT-TGCGTTGACTTGGTGTTC-TGCTTGGT
                 * *   *     * *  * *   **   *** * *** ***   * ** * ***   * 

CAE.EL_A        GCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
TRY.BR_A        TGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGC-GTTCTCGCGCCGTTAAAGTGGGG
                     ***      * * *  *    * *  * **    ** ** *    *** * *  *

CAE.EL_A        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGGAC
TRY.BR_A        GGAACGGGTCAGGCCGGTGACGGAGCAGCCCACCTTG--CGCACGTTCCCGTTCGAGAAG
                 * * ** ***** * *  * * ***** * *    *  ***  * * * **    * * 

CAE.EL_A        CGCGCTTGTGAGT-TGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTATCAT
TRY.BR_A        CACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG--------
                * * *    ***  *  **    *  **  **     *    *   ** *          

CAE.EL_A        TT
TRY.BR_A        --
                  

[Download ClustalW]

#164

Mean pairwise ID: 40.13%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGG-GGGCAACAATGTGGTGGAATGTT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTT
                      *** *       *** * *   * ******          * * ** *   ***

LYC.ES_F        GGGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAGCAC
YAR.LI_A        CGA---GTCTTGGGCTCTGCACTTG----GCCA----TTTGGT-TGTCCTTTCCGAATTC
                 *     *****     **  ****    ** *    * ***  ** *** *** *   *

LYC.ES_F        AGAGTTGGGTCAAGTGGTCTATACGAAAGTATAGCCACTTGGCCTTTAGAGTGGGATGGA
YAR.LI_A        TGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAA
                 * * * * *       **  *  **       **     *   *      *  ***  *

LYC.ES_F        CTGCGTGAGGCTGGTTTCACAG---AGCAACGA-CTAGTCCCCGCTCTGTGCAGTGGAAG
YAR.LI_A        CTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCG-TGGGTATGGCGGTGG
                *** *  *     **    **    ****  ** * ***  *** *  **   * **  *

LYC.ES_F        GATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACC
YAR.LI_A        GATCGCAACCAAGTGGTATAT--GTTATGGAAGATATTTACGATCACGATT---------
                **** *   * **** * * *  **  *   * * *  *   *    *  *         

LYC.ES_F        ATCACTTTT
YAR.LI_A        ---------
                         

[Download ClustalW]

#165

Mean pairwise ID: 40.13%


ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
LYC.ES_L        ---------------------------------------------------------GTT
                                                                         ** 

ZEA.MA_H        AATTGTGGTGCATGTGCCTGGGTCTAGT-GCTACAAACTGTGGACCACCCATTCCAAGTT
LYC.ES_L        GGGT-TGACCCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCCTGCCCTCTCCAAGC-
                   * **   **  **  *****   ** *    * * * *** *  ***  ******  

ZEA.MA_H        GCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCC---AACACTAAAGTGGCG
LYC.ES_L        ATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGGGG
                  * *** ** *   *  ** * * ******   **  *  *   *   ********* *

ZEA.MA_H        GACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGAAG
LYC.ES_L        TGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAG
                   * ************* **** ****** ***  * *  ****     ** *******

ZEA.MA_H        GATAATGAGTCGCTATGCTATAGGCCCAAT------------------------------
LYC.ES_L        GATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAAC
                ***** * ***  *   *     * *** *                              

ZEA.MA_H        ---------
LYC.ES_L        CACCACTTT
                         

[Download ClustalW]

#166

Mean pairwise ID: 40.13%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATC-CAGCTACTTGGAGGCTTGGGCTGTCGGATC
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTT
                                     *******  **  *  * ****   *     * *   * 

XEN.LAE.        GCTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGT
YAR.LI_B        G-TTGTGCGTTCGAGTTCTGGACT---CTGCACTGGGCTACTTTGTTGTCCTTTCCGAAT
                * *** *     ********* **   ***  **  *    *  * *****   *  * *

XEN.LAE.        TCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGG
YAR.LI_B        TCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGA--
                ** *         ** **  * *   ***     *      ** ** *  *    **   

XEN.LAE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGGA
YAR.LI_B        TTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *   ** **  *  *  *** ***  

XEN.LAE.        TCGCGCCTGTGAATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGTTCT-
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTA---TGGAAGGTATTTGCAATCACGACTCTC
                  * *   *  *  *   ***  *    *   ** *    *     *  ***   *** 

[Download ClustalW]

#167

Mean pairwise ID: 40.19%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGCT
LYC.ES_D        ------------------------------------------------------------
                                                                            

ZEA.MA_A        TTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCCAAG
LYC.ES_D        -----------------------------------TAGTT-CTGGCCTGCCCTGTCCAAG
                                                    * *  * *** *****   *****

ZEA.MA_A        TTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCGGC
LYC.ES_D        CACAGAGTAGGATCACGAGGCCCAAATGAAAA-TATGGGCTTCTTGATTCCTAAAGCGGG
                     ***        * *** * *  ****  * ****  ***  *  ***  ***** 

ZEA.MA_A        AGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGGTGGGA
LYC.ES_D        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAA
                  * *  ** * ******************** ** **   **  ***    * **** *

ZEA.MA_A        GGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCA--GAACCTCACTAAGCAAA
LYC.ES_D        GGATAATGG-GTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAA
                ****** *  * ** **   * * *   * * * * **  *  *     * * **  ***

ZEA.MA_A        CCACCATCTTT
LYC.ES_D        CCACCACTTTT
                ******  ***

[Download ClustalW]

#168

Mean pairwise ID: 40.20%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
SCH.POM.        ----------------------------------------CGCTGTAATGGCTTGGTCGA
                                                        ** *  *   *  ***  * 

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGA--CCGAGCGTCCGTGCCAA
SCH.POM.        AGTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGA
                ****    *      *    **   *  * *      ***    ****  **  *  * *

CAE.EL_B        GCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTG
SCH.POM.        TCCCTCGATCTGCC----ACGTCTGTTCGAAGAG---TAGTCTTCGTGGCAACTGGCA-G
                 * **   **  *     * * ****  *****     ****   *  ***   **   *

CAE.EL_B        GTGGATGGTTCAGGACCGA--AAGGTAGCAGACAAAAGCCACCGC-GCGGTGCAGTGGCC
SCH.POM.        TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCACTACCGGGTCTTGGGC
                 *  *  **  ** *****   **** * * ****    ** * *  * * *   *** *

CAE.EL_B        GGACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCA-ATACCTTCAGAC-CACTT
SCH.POM.        AG--TGCGATAGCGATGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACG
                 *  **** * * **   **  *   * * ***  *   **   *  *  * ** **   

CAE.EL_B        GTTTTT
SCH.POM.        GTCGTT
                **  **

[Download ClustalW]

#169

Mean pairwise ID: 40.20%


TRI.AE_B        NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGGCATTGAGGCGGTGTGGATGCTT
LYC.ES_D        ------------------------------------------------------------
                                                                            

TRI.AE_B        GGTGCGGTTTGTTGGCCTGGGCTTGTGATGTAACCTTGCTGGCCTGCCCGTTCCAAGTTG
LYC.ES_D        ---------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCAC
                                                    * ***********  ******   

TRI.AE_B        GTAGTGGGCTGG-GTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGCCTTAA-GTGGCAGGC
LYC.ES_D        AGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGG
                  *** ** *   * ***      ****   * * *****     * *** * **   * 

TRI.AE_B        ACCACGTTAGGCTGGTTTCACAGAGCAGCGA-CAACTGCCGCTTCCAACGGTGGAAGGAT
LYC.ES_D        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
                *** * * ******* ************ ** ** ** *****     * **********

TRI.AE_B        AACAGGCCGCTGCAGCATGGGCCCGCTCTGGGCCTCCTACCCCGCCATAGC-AGACCACC
LYC.ES_D        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCACC
                **  ** ** **    **             ****  *     **   * * * ******

TRI.AE_B        ATCTTT
LYC.ES_D        ACTTTT
                *  ***

[Download ClustalW]

#170

Mean pairwise ID: 40.20%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATC--GCCTTC
                                     ***** *  **  *  ****   * * *  *  *     

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_B        TTGTTGTGCGTTCGAGTTCTGGACT---CTGCACTGGGCTACTTTGTTGTCCTTTCCGAA
                   *** *     ********* **    *** **  **   *  * *****   *  * 

HOM.SA_A        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATT-TCCGTTCTAAGA
                *** **        ** * *       ***     * *    ** **  *        * 

HOM.SA_A        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_B        TTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

HOM.SA_A        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGC-GAGACCCCGTCTCT
YAR.LI_B        GTGGGATAGCAA-----CAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCT
                  * *   *  *     **  *   *  *   * ** **  **   *  * * ** ****

HOM.SA_A        T
YAR.LI_B        C
                 

[Download ClustalW]

#171

Mean pairwise ID: 40.26%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGT-------AAATCGTCTTCTTGTT
                      **  *  *  *  ** * *   * *** **        *  * **     *  *

ZEA.MA_G        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
YAR.LI_A        GTGCGTTCGAGTCTTGGGCTCTG---CACT-TGGCCATTTGGTTGTCCTTTCCGAATTCT
                 **** * *  *  ***** * *   * ** **  * *****  * ***  ***      

ZEA.MA_G        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
YAR.LI_A        GCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                *  * *  ***  * *   * **         ******   * ***   *    * *  *

ZEA.MA_G        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATC--ACTGCC-CGCTTCCAACGGTG
YAR.LI_A        TGGGA-AACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTG
                 ** *   * * **  ***    *   ***** ****    ****  *  *    *****

ZEA.MA_G        GGAGGATAACGGGCCGCTGCACTTCGAGCCCAAC--TCAGGCCCAGAGCCTCACTAAGCA
YAR.LI_A        GGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT----------
                ***    ***     * *  *  *   *    *   * * *  **               

ZEA.MA_G        GACCACCATCTTT
YAR.LI_A        -------------
                             

[Download ClustalW]

#172

Mean pairwise ID: 40.26%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGCT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGT-------AAATCGTCTTCTTGTT
                      **  *  *  *  ** * *   * *** **        *  * *      ** *

ZEA.MA_B        TTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCCCAAGTT
YAR.LI_A        GTGCGTTCGAGTCTTGGGCTCTGCACTTGGCCATT-TGGTTGTCCTTTCCGAATTCTGCG
                 **** * *  *** ** **  ** * * *  * * * *  * * *  **       *  

ZEA.MA_B        GGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGGCAGG
YAR.LI_A        GTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                * *  **   * *  **    **  *  *  ** *   * * *   *  * *    * **

ZEA.MA_B        AATGGCGTAAGGCTGGCTTCACAGAGCAGCGATC-ACTCGCC-CACTTCCAACGGTGGGA
YAR.LI_A        GA-AACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGA
                 *   * * **  ***    *   ***** **** * * ***     *    ********

ZEA.MA_B        GGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAAACCA
YAR.LI_A        TCGCAACCAAGTGGTATATGTTATGGAAGATATTTAC---GATCACGATT----------
                    *** *   * *  *  **  *    * *   **   ****     *          

ZEA.MA_B        CCATCTTT
YAR.LI_A        --------
                        

[Download ClustalW]

#173

Mean pairwise ID: 40.33%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATC-GTCTTCT
                                *    ***** *  **  *  ****   * * *  * * *   *

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
YAR.LI_A        TG-TTGTGCGTTCGAGTCTTGGGCTC---TGCACTTGGCCATTTGGTTGTCCTTTCCGAA
                 * *** **    ****  ******    *** **  ***    **  ****   *  * 

GAL.GAL.        GCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGGG
YAR.LI_A        TTCTGCGGTTG-ATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGA
                  * **      ****    * * *        *    *     * *  *        * 

GAL.GAL.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACGGGA
YAR.LI_A        TTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGG
                * *** **   *  ** *    * *      ** *  *** **  * **  ***  * * 

GAL.GAL.        TCGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGA-GACCCTGTCTCC
YAR.LI_A        TGGGATC-----GCAACCAA-GTGGTATATGTTATGGAAGATATTTACGATCACGATT--
                * *   *       * ***  *  *  **   *  * ** ***   * ** *  *  *  

[Download ClustalW]

#174

Mean pairwise ID: 40.33%


HUM.JA_A        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACTTTGGGTC
YAR.LI_B        ---------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTG
                                 ******    * *  *     **** * ** *   * * * * 

HUM.JA_A        AGCCCATTGGATC-GGGTCCAGTGTTAG-CTGCTT-GCTGGTCTGCCCATTCCAAGCCGA
YAR.LI_B        TGCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGC-GG
                 **      * ** **   * *   * * ** *** * **  **  **       ** * 

HUM.JA_A        GAGTTGGGCTGTGTGATCTGGGCGAA-GGCTGGGGTCGCACAGCTCCTAAAGAGGAGGGC
YAR.LI_B        TTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTC-TAAGATTAACTGG
                  * *****     * **** *  *  ****  *      * * ** ***     *  * 

HUM.JA_A        AATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGGAT
YAR.LI_B        GATACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGAT
                 ** * * **  ***    *   ***** ** *   *  *  *       * **  ****

HUM.JA_A        AACGGGTCGGTGCTACTTGGGCCACCATGGTCACTGCATGCACTCTTAATCAGACCATCT
YAR.LI_B        AGCAACAAAGTGGTATATG-----TTATGGAAGGTATTTGCAATCACGACTCTC------
                * *      *** **  **       ****    *   **** **   *           

HUM.JA_A        CTTTT
YAR.LI_B        -----
                     

[Download ClustalW]

#175

Mean pairwise ID: 40.37%


YAR.LI_B        AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTCGAGTTCTG
LYC.ES_L        -GTTGGGTTGAC-CCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCCTGCCCTCTCCA
                 * **   ** *      * *  * * *   * * *** * **   ** * *    **  

YAR.LI_B        GACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCGG
LYC.ES_L        AGCATGGAGTTGGATCAC---GTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAA
                  *   *   ***   **   ** *     **  **  *   ***** * *    **   

YAR.LI_B        TCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA
LYC.ES_L        GTGGGGTGGACTGCGT-GAGGCTGGT-TTCACAGAGCAACGAACAGCTTCCGCT----CT
                   * **   * ** * ***  *    ***  ***  ***    *   * *  *    * 

YAR.LI_B        ATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATAGCAACAAAGTGGTATATG
LYC.ES_L        GTGCAGTGGAAGGATAACGGGTCAGTGCTCAGCGA-GTCCAGTTAACGCCCTG--ATGGG
                 * ***  **     *   *    * *    ***  *       ***    **  **  *

YAR.LI_B        TTATGGAAGGTATTTGCAATCACGACTCTC
LYC.ES_L        CTGCTCCAACTA-----AACCACCACTTT-
                 *     *  **     ** *** *** * 

[Download ClustalW]

#176

Mean pairwise ID: 40.38%


HUM.LU_C        GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTGGGT
YAR.LI_B        ----------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTT
                                  ******    * *  *     **** **** *   * * * *

HUM.LU_C        CAAC-CCAGTGGTNCGGGNCCAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAAGC----
YAR.LI_B        GTGCGTTCGAGTTCTGGACTCTGCACTGGGC---TACTTTGTTGTCCTTTCCGAATTCTG
                   *    * * *  **   * *  ** *     ***   * ** ** **** *      

HUM.LU_C        CGGGAGGTGGGCTGAGGGACCTGGGCGAA-GGCTNNNGGNGCGCACTCCTAGACTGGAGG
YAR.LI_B        CGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACT
                ***  * *****     *  *** *  *  ****    *    *  * ***   *  *  

HUM.LU_C        GCAATGCGTGAGGCTGGCTTCACAGAGCAGCGA-CTACCTCCCGCT--CTCGGCAGTGGA
YAR.LI_B        GGGATACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGG
                *  ** * * **  ***    *   ***** ** * *  * ***       *** **** 

HUM.LU_C        AGGATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGG
YAR.LI_B        ATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCA---CGACTCTC------
                *    ***     ***     **  *  *    * * ***       ******       

HUM.LU_C        ACCATTTCTTTT
YAR.LI_B        ------------
                            

[Download ClustalW]

#177

Mean pairwise ID: 40.39%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAAC--CTAAGCGGGGGCATTAAGGTGGTGTGGATG
SCH.POM.        -------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAG-TACTCCCAATA
                                      *****   **  *  *  *  ** ** *  *    ** 

ZEA.MA_F        TTTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCCAA
SCH.POM.        GTGCATGTTCGGT---GGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCGATC-TGCCAC
                 * * **   * *   ** *  *** * *  * *  *  * *    *  *  * * *** 

ZEA.MA_F        GTTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGACCTGAAGCGGCA
SCH.POM.        GTCTGTT-CGAAGAGTAGTCTTCGTGGCAA---CTGG---CAGTTAAACC--GTGTAGTA
                **  ***  *    ** *   *** *  **   ****      *** ***    *  * *

ZEA.MA_F        GGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTGGGA
SCH.POM.        CCGATGG----AGGTTGGA--AACAATGCAC--ATCACTACCGGGTCTTGGGCAGTGCGA
                   ****    *** ***    ***  ***   ******  *  *  *    * *** **

ZEA.MA_F        GGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGACCAC
SCH.POM.        TAGCGATGGGATTCACCTTCGCAGGATGTGCATGG----AAGTATAAACACAACGGTCGT
                     *  **   *  * * *** *     *  **     **  * *  * *  *  *  

ZEA.MA_F        CATCTTT
SCH.POM.        T------
                       

[Download ClustalW]

#178

Mean pairwise ID: 40.40%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  * * *    *  * *

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
TRY.BR_B        CGGGGACGTCTTGGACAAGCGGGGGT--TCTGTTGCGTTGACTTGGTGTTC-TGCTTGGT
                 * *   *     * *  * *   **  **   * *** ***   * ** * ***   * 

CAE.EL_D        GCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
TRY.BR_B        TGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGC-GTTCTCGCGCCGTTAAAGTGGGG
                     ***      * * *  *    * *  * **    ** ** *    *** * *  *

CAE.EL_D        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGGAC
TRY.BR_B        GGAACGGGTCAGGCCGGTGACGGAGCAGCCCACCTTG--CGCACGTTCCCGTTGCAGAAG
                 * * ** ***** * *  * * ***** * *    *  ***  * * * ** ** * * 

CAE.EL_D        CGCGCTTGTAAGT-TGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTATCAT
TRY.BR_B        CACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT-----
                * * *     **  *  **    *   *  **     *    *   ** *   **     

CAE.EL_D        TT
TRY.BR_B        --
                  

[Download ClustalW]

#179

Mean pairwise ID: 40.45%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTAGTTC
YAR.LI_A        ----------CTTAG--CTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTG
                          * * *  ******    * *  *     **** **** *   * * *** 

HUM.JA_B        GGCCCATTGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCATTCCAAGCCGAG-A
YAR.LI_A        TGCGT-TCGAGTCTTGGGCTCTGC-ACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCG
                 **   * *  **     *  **  *  **     * ** ** ** **** *     *  

HUM.JA_B        GTTGAGCTGTGTGAGCCGGACGAAG-GTCTGGCTTGGTCAGCTCCTAAAGCGGAGGGCAA
YAR.LI_A        GTTGA--TGGGCGTCTCGGTCTGAGTAATCGGCTTTG--AGATTTCCGTTCTAAGATTAA
                *****  ** * *   *** *  **     ***** *  ** *       *  **   **

HUM.JA_B        -TGCGTGAGGCTGGTTTCACAGAGCAGC-GACAACCTCCCGCTCTCGGCA--GTGGAAGG
YAR.LI_A        CTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGG
                 ** *  *     **    **   **** ** * **    **  * ** *  * **  **

HUM.JA_B        ATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGGACC
YAR.LI_A        ATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT------------
                **  *   *  *** *   **            ** **      ** *            

HUM.JA_B        ATTTCTTTT
YAR.LI_A        ---------
                         

[Download ClustalW]

#180

Mean pairwise ID: 40.47%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAA-TCGTCTTCT
                                *    ***** *  **  *  ****   * * *   **     *

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_A        TG-TTGTGCGTTCGAGTCTTGGGCTCT---GCACTTGGCCATTTGGTTGTCCTTTCCGAA
                 * *** *     ****  ****** *   ** **  ***  * ** *****   *  * 

ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_A        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **     * *  

ORI.CUN.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_A        T-AACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

ORI.CUN.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGTCTCC
YAR.LI_A        GTGGGATCGCAACCAAGTGGTATATGTTA---TGGAAGATATT-TACGATCACGATT--
                  * *   *  *  *     *  *    *   ***   * **     ** *  *  *  

[Download ClustalW]

#181

Mean pairwise ID: 40.47%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGG-GCAATAAGGTAGTGTGGATGT
                 *** ** * ** *** **** ****  ** ***     *  *    *  *** *    *

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
ZEA.MA_H        CAATTGTGGT-GCATGTGCCTGGGTCTAGTGCTACAAACTG-TGGACCACCCATTCCAAG
                *  *** *       ** *  ** * ******   *  * * ***     **   * ***

HOM.SA_B        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
ZEA.MA_H        TTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACAC-TAAAGTGGCG
                **  * *      *   **   *  **     *     ** *      * *** * ** *

HOM.SA_B        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
ZEA.MA_H        GACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC-ACCAGCGGTGGAA
                   *  *    ***  **   *  **     * *    * *  **  * ***  **** *

HOM.SA_B        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGAGCAACATAGCGAGACCCCGTCTCT
ZEA.MA_H        GGA------TAATGAGTCGCTATGCTATAGGCCCAAT----------------------
                         * *  ** * **   **  ** *  *                        

[Download ClustalW]

#182

Mean pairwise ID: 40.51%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
LYC.ES_L        --------------------------------------------------------GTTG
                                                                        * * 

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGG-TGTCCGTACTAAG
LYC.ES_L        GGTTGACCCAGATGGTT---GGGTTCGGTAGGCT-TATAGTCTGGCCTGCCCTCTCCAAG
                * **** *      ***   ** *** *  * ** * * *   **  ** **   * ***

FUG.RUB.        TTCGGTATCGA--TATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGG
LYC.ES_L        CATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATT-CCTAAAGTGG
                   **  * *    * *  ***     *  ** ** ** *  *  * *  ***** * **

FUG.RUB.        GGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGT
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                ****  * *    ***  **    **  ****    * ***  ***  * *  **** * 

FUG.RUB.        GGGAT--CGCGCCCGTGAATAGACGCTGTAGTT--CAACCTGAGTAACA----CAGCGGG
LYC.ES_L        AGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAA
                 ****  ** * * ***   **    *  ****  *  *****    *     ** *   

FUG.RUB.        ACTCAGTCTTT
LYC.ES_L        ACCACCACTTT
                **     ****

[Download ClustalW]

#183

Mean pairwise ID: 40.52%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACGTTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTCTTGTTG
                         **       *** * *  **  *****      ***   *       ****

ARA.TH_C        GGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCCCGCCCATTCCAAGTT
YAR.LI_B        TG-CGTTCGAGTTCTG--GACTCTGCACTGGGCTACTTTGT----TGTCCTTTCCGAATT
                 * ** **   **  *  *  *  *   *******  ** *     * ** **** * **

ARA.TH_C        GGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGGGGA
YAR.LI_B        CTGCGGTT-GATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                  * * *  *    * *  ***  *  **     **  *   *  ***     *  *   

ARA.TH_C        GACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAAGGA
YAR.LI_B        AACTG-----GGATACTTCAGTGGAGCAA--TCCAGCAGA-GATCCAGTTGCCGTGGGTA
                 ** *     ** *  **     *****   **** *    * **  *  *  *   * *

ARA.TH_C        TTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTG-GACCAT
YAR.LI_B        TGGCGGTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCT
                *  ***     *  *  *  **     ****       * *    * * **   ***  *

ARA.TH_C        CACTTT
YAR.LI_B        C-----
                *     

[Download ClustalW]

#184

Mean pairwise ID: 40.58%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGCT
SCH.POM.        -------------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCC
                                           *   *  **     *  * ***    * *  * 

ZEA.MA_B        TTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCCCAAG-T
SCH.POM.        CAATAGTGCATGTTCGG--TGGTCTCG----GGTTCGAGTCTCGCTTTCGATCCCTCGAT
                      **  *  * **  *** ****    *  ** ** *    *  * *****  * *

ZEA.MA_B        TGGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCG-GCA
SCH.POM.        CTGCCACGTCTGTTCGA-----AGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTA
                  *    *****   *      ** * *  *** * * *       *  ** * ** * *

ZEA.MA_B        GGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGTGGGA
SCH.POM.        GTACCGATG-GAGGTTGGAA--ACAATGCA--CATCACTACCGGGTCTTGGGCAGTGCGA
                * *  *  *  *** ***    ***  ***   ******  *     *    * *** **

ZEA.MA_B        GGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAAACCA
SCH.POM.        ---TAGCGATGGGATTCACCTT---CGCAGGATGTGCATGGAAG---TATAAACA--CAA
                   ** * *   * * *** **   * **  *    *   **     * * * **  * *

ZEA.MA_B        CCATCTTT
SCH.POM.        CGGTCGTT
                *  ** **

[Download ClustalW]

#185

Mean pairwise ID: 40.59%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTCTTGTTG
                         **       *** * *  **  *****       ***  *  *   * ***

LYC.ES_A        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT-CTGGCCTGCCCTGTCCAAGCACA
YAR.LI_B        TGCGTTC---GAGTTCTGGACTC--TGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCT
                 ** **    **    *** **   **  **  * * **    ** *** *** *   * 

LYC.ES_A        GAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGA
YAR.LI_B        GCGGTTGATGG-GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAA
                * * * ***   * * * *      *   ** *****   **** *     *  *    *

LYC.ES_A        CCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCTGTGCAGTGGAAGGATAA
YAR.LI_B        CTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG----GGTATGGCGG
                * *    *     *     **   ***   *    *     * ***    ** * *    

LYC.ES_A        TGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACC
YAR.LI_B        TGGGATAGCA----ACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCA-CGACTCTC
                ****   *      *  ****    **     *    ***   * **** * * **   *

LYC.ES_A        TTT
YAR.LI_B        ---
                   

[Download ClustalW]

#186

Mean pairwise ID: 40.66%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAA-TGTGGTGGAATGTT
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAG--
                          * *     *   *******     ***   *  *    * * **   *  

LYC.ES_B        GGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTA
LEI.MAJ.        GACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTC
                *   ** *****   *   *  *** ** * * *  *    **   * *  *   *  * 

LYC.ES_B        GAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
LEI.MAJ.        GGTGTGGCT----TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAA
                *   *** *    ** ***  *  *     ***      *    ***  *   * * * *

LYC.ES_B        ATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTC-TAAGCGGTGGAAGGAT
LEI.MAJ.        CCGGGTCAGGCCGGAA--ACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCAGAAT
                  * ** **** **    ** ***** *    *     *** * *  ** ** * ** **

LYC.ES_B        AACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAACCACCA
LEI.MAJ.        CACACCGCGGAGCA---TGTCCGCACTTGAGCCCCACGCTTCG---TCGCGAAGCCTT--
                 **    *** *     **    ** *   ***  * *    *   *    ** **    

LYC.ES_B        CTTTT
LEI.MAJ.        -----
                     

[Download ClustalW]

#187

Mean pairwise ID: 40.67%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAA-TCGCCTTCT
                                     ***** *  **  *  ****   * * *  * *     *

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
YAR.LI_B        TG-TTGTGCGTTCGAGTTCTGGACTCT---GCACTGGGCTACTTTGTTGTCCTTTCCGAA
                 * *** **    ********* ** *   ** **  **   *  * *****   *  * 

HOM.SA_B        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **     * *  

HOM.SA_B        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_B        T-AACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

HOM.SA_B        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGAGCAACATAGCGAGACCCCGTCTCT-
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTA---TGGAAGGTATT-TGCAATCACGACTCTC
                  * *   *  *  *     *  *    *   **      **   *  * * ** **** 

[Download ClustalW]

#188

Mean pairwise ID: 40.71%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
LYC.ES_D        ------------------------------------------------------------
                                                                            

ZEA.MA_D        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
LYC.ES_D        -------------------------------------TAGTTCTGGCCTGCCCTGTCCAA
                                                     *    * *********   ****

ZEA.MA_D        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
LYC.ES_D        GCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGG
                *     *** *      *****   *  * **   * **  ***  *  *** *** ** 

ZEA.MA_D        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTGGG
LYC.ES_D        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCT-CCCGCTCTGTGCAGTGGA
                  * *  ** ********************** ** **    ******     * **** 

ZEA.MA_D        AGGATAACAGGCCGCTGCACT-TCGAGCCCAACTCAGGCCCA--GAGCCTCACTAAGCAG
LYC.ES_D        AGGATAATGGGTCGGTGTCTTATCAAGTTCAG-TAACGCCTAATGGGTTGCTCCAACTAA
                *******  ** ** **   * ** **  **  * * *** *  * *   * * **  * 

ZEA.MA_D        ACCACCATCTT-
LYC.ES_D        ACCACCACTTTT
                *******  ** 

[Download ClustalW]

#189

Mean pairwise ID: 40.71%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGCT
SCH.POM.        -------------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCC
                                           *   *  **     *  * *** *  * *  * 

ZEA.MA_A        TTGCGATGGCTTTCTGG--GCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCCA
SCH.POM.        CAATAGTGCATGTTCGGTGGTCTCGGGTTCGA---------GTCTCGCTTTCGATCCCTC
                      **  * *  **  * *  *** ***          * *  **** *    **  

ZEA.MA_A        AGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCG
SCH.POM.        GATCTGCCACGTCTGTTCGA------AGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCG
                  *  *    ***** * *       ** * *  *** * * *       *  *  * **

ZEA.MA_A        -GCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGGTG
SCH.POM.        TGTAGTACCGATG-GAGGTTGGAA--ACAATGCA--CATCACTACCGGGTCTTG--GGCA
                 * ** *  *  *  *** ***    ***  ***   ****** ***  **     **  

ZEA.MA_A        GGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGCAA
SCH.POM.        GTGCGATAGCGATGG-GATTCACCTT--------CGCAGGATGTGCATGGAAGTATAAAC
                *   **** *** *  * * *** **        * **** *  * *    * **   * 

ZEA.MA_A        ACCACCATCTTT
SCH.POM.        ACAACGGTCGTT
                ** **  ** **

[Download ClustalW]

#190

Mean pairwise ID: 40.71%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGT-------AAATCGTCTTCTTGTT
                      **  *  *  *  ** * *   * *** **        *  * **     *  *

ZEA.MA_D        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
YAR.LI_A        GTGCGTTCGAGTCTTGGGCTCTG---CACT-TGGCCATTTGGTTGTCCTTTCCGAATTCT
                 **** * *  *  ***** * *   * ** **  * *****  * ***  ***      

ZEA.MA_D        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
YAR.LI_A        GCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                *  * *  ***  * *   * **         ******   * ***   *    * *  *

ZEA.MA_D        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATC-ACTCGCC-CGCTTCCAACGGTG
YAR.LI_A        TGGGA-AACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTG
                 ** *   * * **  ***    *   ***** **** * * ***  *  *    *****

ZEA.MA_D        GGAGGATAACAGGCCGCTGCACTTCGAGCCCAAC--TCAGGCCCAGAGCCTCACTAAGCA
YAR.LI_A        GGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT----------
                ***    ***     * *  *  *   *    *   * * *  **               

ZEA.MA_D        GACCACCATCTT
YAR.LI_A        ------------
                            

[Download ClustalW]

#191

Mean pairwise ID: 40.73%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****   *   *** * *   *  * ***      ***   *      *****

LYC.ES_I        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
YAR.LI_A        ---TGCGTTCGAGTCTTGGGCTCTGCAC-TTGGCCATTTGGTTGTCCTTTCCGAATTCTG
                   **     **   *******  *     *      *   *** *** *** *  *  *

LYC.ES_I        AGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGAA
YAR.LI_A        CGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                 * * ***   * * * *  *   ** *** * **    ****       *  *    * 

LYC.ES_I        TGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGATAAC
YAR.LI_A        TGGGAAAC-----TTCAGTGGAGCAAT--CCAGCAGAGATCCAGTTGCCGTGGGTATGGC
                ** *  *      **     ******     **    * ** *   *  *   * **  *

LYC.ES_I        GAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCATTT
YAR.LI_A        -----GGTGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-
                     ****   **  *  * ***      ** *  *         *   * *** *** 

LYC.ES_I        TT
YAR.LI_A        --
                  

[Download ClustalW]

#192

Mean pairwise ID: 40.73%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****       *** * *   *  *****      ***   *      *****

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
YAR.LI_A        ---TGCGTTCGAGTCTTGGGCTCTGCAC-TTGGCCATTTGGTTGTCCTTTCCGAATTCTG
                   **     **   *******  *     *      *   *** *** *** *  *  *

LYC.ES_N        AGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGAA
YAR.LI_A        CGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                 * * ***   * * * *  *   ** *** * **    ****       *  *    * 

LYC.ES_N        TGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGATAAC
YAR.LI_A        TGGGAAAC-----TTCAGTGGAGCAAT--CCAGCAGAGATCCAGTTGCCGTGGGTATGGC
                ** *  *      **     ******     **    * ** *   *  *   * **  *

LYC.ES_N        GAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCATTT
YAR.LI_A        -----GGTGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-
                     ****   **  *  * ***      ** *  *         *   * *** *** 

LYC.ES_N        TT
YAR.LI_A        --
                  

[Download ClustalW]

#193

Mean pairwise ID: 40.79%


HUM.JA_A        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGG--CATGTGGGAGATGGGACTTTGGG
YAR.LI_A        --CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTTCGAG
                  * ****      *** * *   *  *****     * * *    * ** *  ** * *

HUM.JA_A        TCAGCCCATTGGATCGGGTCCAGTGTTAGCTGCTTGCTGGTCTGCCCATTCCAAGCCGAG
YAR.LI_A        TC------TTGGGCTCTGCACTTGGCCATTTGGTTGTCC-TTTCCGAATTCTG---CGGT
                **      ****     *  *   *  *  ** ***    * * *  ****     **  

HUM.JA_A        AGTTGGGCTGTGTGATCTGGGCGAA-GGCTGGGGTCGCACAGCTCCTAAAGAGGAGGGCA
YAR.LI_A        TGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTC-TAAGATTAACTGGG
                 * *****     * **** *  *  ****  *      * * ** ***     *  *  

HUM.JA_A        ATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGGATA
YAR.LI_A        AAACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATC
                *  * * **  ***    *   ***** ** *   *  *  *       * **  **** 

HUM.JA_A        ACGGGTCGGTGCTACTTGGGCCACCATGGTCACTGCATGCACTCTTAATCAGACCATCTC
YAR.LI_A        GCAACCAAGTGGTATATG-----TTATGGAAGATATTTACGATCACGATT----------
                 *      *** **  **       ****    *   * *  **   **           

HUM.JA_A        TTTT
YAR.LI_A        ----
                    

[Download ClustalW]

#194

Mean pairwise ID: 40.80%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
SCH.POM.        -------------------CGCTGTAATGGC--TTGGTCGAAGTGTTTAGTACTCCCAAT
                                     ***** *  *   *  ***    * * **        **

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
SCH.POM.        AGTGCATGTTCGGTGGTCTCGGGTTCGAGT-CTCGCTTTCGATCCCTCGATC-TGCCACG
                 *     *  * *  **   *** *  *** * *  *  ****     *  *   * * *

HOM.SA_B        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
SCH.POM.        TCTG---TTCGAAGAGTAGTCTTC--GTGGCAACTGGCAGTTAAACCGTGTA--------
                *  *   *    *  **   ** *  *  **    * *    *    *  **        

HOM.SA_B        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
SCH.POM.        -GTACCGATGGAGGTTGGAAACAATGCACATCA---CTACCGGGTCT-TGGGCAGTGCGA
                 * ****    **** ******   ***  ***   ** *** *    *  * **** **

HOM.SA_B        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGAGCAACATAGCGAGACCCCGTCTCT
SCH.POM.        TAGCGA-TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACG-GTCGTT
                * ***  ** ** *  **   ***       *   * *  ***   * * *  ***  *

[Download ClustalW]

#195

Mean pairwise ID: 40.84%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
SCH.POM.        -------------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCC
                                           *   *  **     *  * *** *  * * ** 

ZEA.MA_G        TTGCGATG---GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
SCH.POM.        CAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCTCGATCTG--C
                      **   * *   *** * **** ***      ** ** *  *   *   * *  *

ZEA.MA_G        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
SCH.POM.        CACGTCTGT----TCGAAGAGTAGTCTTCGTGGCAACT---GGCAGTTAAACCGTGTAGT
                ** **  **     *     *  *  ** * ** * **   * *  *  *  * ** ***

ZEA.MA_G        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCAACGGTG
SCH.POM.        ACCG---ATGG----AGGTTGGAA--ACAATGCA--CATCACTACCGGGTCTTG--GGCA
                  *    ****    *** ***    ***  ***   ****** ** * *      **  

ZEA.MA_G        GGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAGA
SCH.POM.        GTGCGATAGCGATGGGATTCACCTT---CGCAGGATGTGCATGGA-----AGTATAAACA
                *   **** **    * * *** *    * **      **   **     * **   * *

ZEA.MA_G        CCACCATCTTT
SCH.POM.        CAACGGTCGTT
                * **  ** **

[Download ClustalW]

#196

Mean pairwise ID: 40.85%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

ARA.TH_F        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
TRI.AE_C        -------------------------------------GGTGGTCTGCCCGTTCCAAGTTG
                                                       **  ******  ****** **

ARA.TH_F        TG-AGTAATTAGTGTTGAGTTGA-GCGAAGGCTTGGCTTGCAGGTTCTAGAGTCGGAGGG
TRI.AE_C        AGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGG
                 * ***     *  * * *   * ***** * * *** *   *** *   *   **  **

ARA.TH_F        TAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGA
TRI.AE_C        CACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGA
                 *  ***************************** *** ******* ** * ***** ***

ARA.TH_F        TCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCAC
TRI.AE_C        TAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCG---ACCAC
                * ****      *     *    ** **  *****  * * *   **        *****

ARA.TH_F        CATTTT
TRI.AE_C        CATC--
                ***   

[Download ClustalW]

#197

Mean pairwise ID: 40.89%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGT-------AAATCGTCTTCTTGTT
                      **  *  *  *  ** * *   * *** **        *  * **     *  *

ZEA.MA_E        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
YAR.LI_A        GTGCGTTCGAGTCTTGGGCTCTG---CACT-TGGCCATTTGGTTGTCCTTTCCGAATTCT
                 **** * *  *  ***** * *   * ** **  * *****  * ***  ***      

ZEA.MA_E        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
YAR.LI_A        GCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                *  * *  ***  * *   * **         ******   * ***   *    * *  *

ZEA.MA_E        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATC-ACTCGCCG-GCTTCCAACGGTG
YAR.LI_A        TGGGA-AACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTG
                 ** *   * * **  ***    *   ***** **** * * **** *  *    *****

ZEA.MA_E        GGAGGATAACGGGCCGCTGCACTTCGAGCCCAAC--TCAGGCCCAGAGCCTCACTAAGCA
YAR.LI_A        GGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT----------
                ***    ***     * *  *  *   *    *   * * *  **               

ZEA.MA_E        GACCACCATCTTT
YAR.LI_A        -------------
                             

[Download ClustalW]

#198

Mean pairwise ID: 40.91%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

ARA.TH_A        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
TRI.AE_C        -------------------------------------GGTGGTCTGCCCGTTCCAAGTTG
                                                       **  ******  ****** **

ARA.TH_A        TG-AGTAATTAGTGTTGAGTTGA-GCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGGAG
TRI.AE_C        AGTAGTGGACCGCTTGGGGCCTATGCGAAAG-TTGGGCCTCACGGTCCATAATGT-GGCA
                 * ***     *  * * *   * ***** * ****  *   * *    **  ** **  

ARA.TH_A        GGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACG
TRI.AE_C        GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
                ** *  ***************************** *** ******* ** * ***** *

ARA.TH_A        GATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACC
TRI.AE_C        GATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCG---ACC
                *** ****      *     *    ** **  *****  * * *   **        ***

ARA.TH_A        ACCATTTT
TRI.AE_C        ACCATC--
                *****   

[Download ClustalW]

#199

Mean pairwise ID: 40.93%


TRY.BR_B        AGCCGGAGCG-CATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTT
YAR.LI_B        AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCT-TCTTGTTGTGCGTTCGAGTTCT
                *** * *  * ****     * *    *     **   **  * *  ***     **  *

TRY.BR_B        GGAC---AAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCT-TGGTTGCGTGTCGGT
YAR.LI_B        GGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG
                ****      * *** * ** *   **    *  *  ******  * * ** * ***   

TRY.BR_B        GTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGGGTCAG
YAR.LI_B        GTCTGAGTAATCGGCTTTGAGA------TTTCCGTTCTAAGATTAACTGGGATACTTCAG
                **    **   *    * ****       *  **   * * * *    ** *    ****

TRY.BR_B        GCCGGTGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCACACCGAGGAGCA
YAR.LI_B        TGGAGCAATCCAGCAGAG-ATCCAGTTGCCGTGGGTATGGCGGTGGGATAGCAACAAAGT
                    *  *   *****   * *  *    ***     * ** *  * * * * *  *   

TRY.BR_B        TCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT
YAR.LI_B        GGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC---
                  *      * **      *  **   ** ***  *     

[Download ClustalW]

#200

Mean pairwise ID: 40.97%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
LYC.ES_L        -----------------------------------------------------GTTGGGT
                                                                     * ***  

DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAGC
LYC.ES_L        TGA--CCCAGATG-GTTGGGT--TCGGTAGGCTTATAGTC-TGGCCTGCCCTCTCCAAGC
                ***  *   ***    ** **    *    *** **  *   **   * ** * * ****

DRO.MEL.        TTGCCATCAATATGGGTGCCATGGA-GGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGA
LYC.ES_L        ATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGGGG
                 **   *        *** * * *  * *   * ***  * *  * *  **** * *** 

DRO.MEL.        TGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGG
LYC.ES_L        TGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAG
                ** ** * *  ***  ***   *   **** * ** ** * ***   *  ***** *  *

DRO.MEL.        GATAGCGTACCGGAGTG----GACTGCCGTTATCAGCCCAA----CCGATATGGTTGGAC
LYC.ES_L        GATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAAC
                **** **   * * *      ** * * **** *  **  *    * * *     *  **

DRO.MEL.        CACAATCTTT
LYC.ES_L        CACCACTTT-
                *** *  ** 

[Download ClustalW]

#201

Mean pairwise ID: 40.98%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACGTTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      ** **       *** * *  **  *****      ***   *       ****

ARA.TH_C        GGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCCCGCCCATTCCAAGTT
YAR.LI_A        TG-CGTTCGAGTCTTG--GGCTCTGCACTTGGCCAT---TTGGTTGTCCTTTCCGAATTC
                 * ** **   *   *  ** *  *   * *** **    ***    **  * * ** * 

ARA.TH_C        GGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGGGGA
YAR.LI_A        TGCGGTTGATG--GGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                 *  ***** *   * *  ***  *  **     **  *   *  ***     *  *   

ARA.TH_C        GACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAAGGA
YAR.LI_A        AACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATC-----CAGTTGCCGTGGGTATGG
                 ** * *  *     **    **   ****    * *     *  *** **  ** * * 

ARA.TH_C        TTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACCATC
YAR.LI_A        CGGTGGG--ATCGCAA-CCAAGTGGTATATGTTATGGAAGATATTTACGATC--ACGATT
                    ***  ** **   ** **     ****       *      * ****   ** ** 

ARA.TH_C        ACTTT
YAR.LI_A        -----
                     

[Download ClustalW]

#202

Mean pairwise ID: 40.98%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
TRY.BR_A        ---------------AGC--CGGAGCGCATTGCTCTGTAACCTTCGGGGGCTG-ATCCCG
                               ***  * *    **    ***** *  *  *   *  * **  * 

DRO.MEL.        TGAGGCTGGGATCTACTGCGTA---GCGGACCAGCTCATGTTGACGGAACGTCCGCACTA
TRY.BR_A        CTTAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTG
                    ** ****  *  **   *   * **      *   ******     ** *    * 

DRO.MEL.        A--GCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT-TGGCTAAGG
TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAG----AGGCGTTCTCGCGCCGTTAAAG
                   ** ** *     *  **  ****  *  ***     *** ***  *    * *** *

DRO.MEL.        AGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
TRY.BR_A        TGGGGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA----CCTTGCGCACGTTCCCGT
                 ***  **** *** ****   *  *   ******* *     *  * *   *       

DRO.MEL.        TGGGATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCACAA
TRY.BR_A        TCGAGAAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
                * *   ***  ****  * * *   * *   *  ** *  *   * * ** *     *  

DRO.MEL.        TCTTT
TRY.BR_A        -----
                     

[Download ClustalW]

#203

Mean pairwise ID: 40.98%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
SCH.POM.        ---------CGCTGTAATGGCTTG---GTCGAAGTGTTTAGTACTCCCAATAGTGCATGT
                         **  *     *****   ***    * ** *        **  *** *** 

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGA--GCGTCCGTGCCAA
SCH.POM.        TCGGTGGTCTCGGGTTC-GAGTCTCGCTTTCGATCCCTCGATCTGCCACGTCTGTTCGAA
                   * *     * ** * * ** *  * *    * * **** *     **** ** * **

CAE.EL_D        GCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGG-GTGCATAAGGAGT
SCH.POM.        GAGTAGTCTTCGTGGCAACTGGCAGTT--AAACCGTGTAGTACCGATGGAGGTTGGAAAC
                * *     *     *    *  * **   **  **  **** ***  *    *  * *  

CAE.EL_D        CGTGGATGGTTCAGGACCGAAAGGTAG-CAG-ACAAAAGCGACCGCGTGGTGCAGTGGCC
SCH.POM.        AATGCACA--TCACTACCGGGTCTTGGGCAGTGCGATAGCGATGGGATT-CACCTTCGCA
                  ** *    ***  ****     * * ***  * * *****  *  *    *  * ** 

CAE.EL_D        GGACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTAT
SCH.POM.        GGAT-GTGCATGGAAGTATAAACACA---ACGGTCGTT----------------------
                ***  * ** ** ****  * *****   ** * * *                       

CAE.EL_D        CATTT
SCH.POM.        -----
                     

[Download ClustalW]

#204

Mean pairwise ID: 40.98%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_H        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     **   *****  ****** * **

LYC.ES_H        AGTTGGATCATGTGGC-CCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCA
                   **** *   ***  ** **   * *  *** *  *  * * * *** ****   * *

LYC.ES_H        ATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                  ************ ************ **  *   ******     * ***********

LYC.ES_H        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
TRI.AE_C        ACGGGCCGCTGCACT-CCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCA-CCAT
                * *** ** **   *  * **  *  *   ****  * *  * *****   * ** *** 

LYC.ES_H        CTTTT
TRI.AE_C        C----
                *    

[Download ClustalW]

#205

Mean pairwise ID: 41.00%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  * * *    *  * *

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
TRY.BR_A        CGGGGACGTCTTGGACAAGCGGGGGTT-CTGTTG-CGTTGACTTGGTGTTC-TGCTTGGT
                 * *   *     * *  * *   **   ***   *** ***   * ** * ***   * 

CAE.EL_B        GCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
TRY.BR_A        TGCGTGTCGGTGTTGAGGTCGCCA-CTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG
                   * ***      * * *  *   * * ***  * *  ** ** *    *** * * **

CAE.EL_B        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGGAC
TRY.BR_A        GGAACGGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTCGAGAAG
                 * * ** ***** * *  * * ***** * *   *   *** ** * * **    * * 

CAE.EL_B        TGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTTTTT
TRY.BR_A        CACACCGAGGAGC--ATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG------
                  * *    ***   *       **   **   *  * *  * **      *        

[Download ClustalW]

#206

Mean pairwise ID: 41.03%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
LYC.ES_D        ------------------------------------------------------------
                                                                            

ZEA.MA_E        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
LYC.ES_D        -------------------------------------TAGTTCTGGCCTGCCCTGTCCAA
                                                     *    * *********   ****

ZEA.MA_E        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
LYC.ES_D        GCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGG
                *     *** *      *****   *  * **   * **  ***  *  *** *** ** 

ZEA.MA_E        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTTCCAACGGTGGG
LYC.ES_D        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCT-CCCGCTCTGTGCAGTGGA
                  * *  ** ********************** ** **    ** ***     * **** 

ZEA.MA_E        AGGATAACGGGCCGCTGCACT-TCGAGCCCAACTCAGGCCCA--GAGCCTCACTAAGCAG
LYC.ES_D        AGGATAATGGGTCGGTGTCTTATCAAGTTCAG-TAACGCCTAATGGGTTGCTCCAACTAA
                ******* *** ** **   * ** **  **  * * *** *  * *   * * **  * 

ZEA.MA_E        ACCACCATCTTT
LYC.ES_D        ACCACCACTTTT
                *******  ***

[Download ClustalW]

#207

Mean pairwise ID: 41.03%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTAGTTC
YAR.LI_B        ---------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTG
                                 ******    * *  *     **** **** *   * * *** 

HUM.JA_B        GGCCCATTGGATC-GGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCATTCCAAGCCGAG-
YAR.LI_B        TGCGTTCGAGTTCTGGACTCTGCACTGGGC---TACTTTGTTGTCCTTTCCGAATTCTGC
                 **      * ** ***  * *   * *     * **  * ** ** **** *     * 

HUM.JA_B        AGTTGAGCTGTGTGAGCCGGACGAAG-GTCTGGCTTGGTCAGCTCC----TAAAGCGGAG
YAR.LI_B        GGTTGA--TGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                 *****  ** * *   *** *  **     ***** *  *  ***    ***     * 

HUM.JA_B        GGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCA--GTGGA
YAR.LI_B        TGGGATACTTCAG--TGGAGCAATCCAGCAGAGAT--CCAGTTGCCGTGGGTATGGCGGT
                 *  ** * * **  ***    *   ***** **   **    **  * ** *  * ** 

HUM.JA_B        AGGATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGG
YAR.LI_B        GGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC------
                 ***** *      *** *   **            **  *      ******       

HUM.JA_B        ACCATTTCTTTT
YAR.LI_B        ------------
                            

[Download ClustalW]

#208

Mean pairwise ID: 41.04%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAA-TGTT
SCH.POM.        ----------------------------------CGCTGTAATGGCTTGGTCGAAGTGTT
                                                   *  * **     **** *** ****

LYC.ES_F        GGGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAGCAC
SCH.POM.        TAGTACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTTCGAGTCT-CGCTTTCGATCCCT
                  ** *  *     *     * * *  ** **   ****  * ** * ** ** *  *  

LYC.ES_F        AGAGTTGGGTCAAGTGGTCTATACGAAAGTATAGC--CACTTGGCCTTTAGAGTGGGATG
SCH.POM.        CGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAG
                 **  **   *   ** ** *   * *    * *   **  ****  *** *  * *  *

LYC.ES_F        GACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAAGGA
SCH.POM.        TACCGATGGAGGTTGGAAACAATGCACATC-ACTA--CCGGGTCTTGGGCAGTGCGATAG
                 ** *   **** ***   **  *  ** * ****  **  *   ** ******  *   

LYC.ES_F        TCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCAT
SCH.POM.        CGATGGG---ATTCACCTT----CGCAGGATGTGCATGGAAGTATA---AACACAACGGT
                  * ***    * * * **    *  *  *    * **  **  *    **   ***  *

LYC.ES_F        CACTTTT
SCH.POM.        CGTT---
                *  *   

[Download ClustalW]

#209

Mean pairwise ID: 41.06%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAG---GAG
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCG----GGGGCAATAAGGTAGTGTGGA
                 *** ** * ** ***   ** ****  ** ***     ***    * **  **   *  

RAT.NOR.        GATCGATTG-AGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCAC
ZEA.MA_H        TGTCAATTGTGGTGCATGTGC-CTGGGTC-TAGTGCTACAAACTG-TGGACCACCCATTC
                  ** ****  ** ** * *  *****   ******   *  * * * *     **   *

RAT.NOR.        TAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
ZEA.MA_H        CAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACAC-TAAAGT
                 *****  * *      *   **   *  **     *     ** *      * *** * 

RAT.NOR.        GGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
ZEA.MA_H        GGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC-ACCAGCGGT
                ** *   *  *    ***  **   *  **     * *    * *  **  * ***  **

RAT.NOR.        GGGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGTCT
ZEA.MA_H        GGAAGGA------TAATGAGTCGCTATGCTATAGGCCCAAT-------------------
                ** *         * *  ** * **   **  ** *                        

RAT.NOR.        CT
ZEA.MA_H        --
                  

[Download ClustalW]

#210

Mean pairwise ID: 41.08%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGGATGCT
YAR.LI_B        ------AGCTGTAATGGCATTTTGT---CGGAGTGGTAA-ATCGCCTTCTTGTTG-TGCG
                        *****  *  *  ****   * *** **    **     *  *** * *** 

ZEA.MA_C        TGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAGTT
YAR.LI_B        T----TCGAGTTCTGGACT--CTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCG
                *     ** **  * * **   * **  * *   ******** ***  ***      *  

ZEA.MA_C        GGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTGGCAG
YAR.LI_B        GTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCC-GTTCTAAGATTAACTG
                * *  *** ***      **  *   * ***  ** * ** *  *  *  * * *  * *

ZEA.MA_C        GAACGGC---GTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGGA
YAR.LI_B        GGATACTTCAGTGGAGCAATCCA-GCAGAGATCCAGTTGCCGTGGGT--ATGGCGGTGGG
                * *       ***  **  **    *****   *  *  * *  **    *  ****** 

ZEA.MA_C        AGGATAACAGGCCACTGCAG--CATGGGCT-CGCTTAAGGCCTAGACTTCATACTAAAGC
YAR.LI_B        ATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC---------
                *    ****      *  *    ****       **     *  ****            

ZEA.MA_C        AGACCACCATTTTT
YAR.LI_B        --------------
                              

[Download ClustalW]

#211

Mean pairwise ID: 41.14%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAA-TCGTCTTCT
                                * *  ***** *  **  *  ****   * * *  * *     *

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
YAR.LI_A        TG-TTGTGCGTTCGAGTCTTGGGCTCT---GCACTTGGCCATTTGGTTGTCCTTTCCGAA
                 * *** **    ****  ****** *   ** **  ***  * ** *****   *  * 

HOM.SA_B        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_A        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **     * *  

HOM.SA_B        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_A        T-AACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

HOM.SA_B        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGAGCAACATAGCGAGACCCCGTCTCT
YAR.LI_A        GTGGGATCGCAACCAAGTGGTATATGTTA---TGGAAGATATT-TACGATCACGATT--
                  * *   *  *  *     *  *    *   **    * **     ** * **  *  

[Download ClustalW]

#212

Mean pairwise ID: 41.16%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
LYC.ES_L        ---------------------------------------------------------GTT
                                                                         * *

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_L        GGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCC---TGCCCTCTCCAAG
                 * ****  *     ***  *  * ****     **  * *  *   ** ** * * ***

RAT.NOR.        TTCGGCATCA-ATATGGTGACCTC-CCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LYC.ES_L        CATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATT-CCTAAAGTGG
                   **  *   **   *** * *   **  **    **    *  * ** ***** * **

RAT.NOR.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                **** ** *    ***  **    ** *****    * * ** ***  ***  **** * 

RAT.NOR.        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCA-GCC----TGGGCAACATAGCGAGA
LYC.ES_L        AGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAA
                 ****  ** * * ***   *** * * ** *  * ***    *****  *        *

RAT.NOR.        CCCGTCTCT--
LYC.ES_L        ACCACCACTTT
                 **  * **  

[Download ClustalW]

#213

Mean pairwise ID: 41.16%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
LYC.ES_M        -------------------------------------CAAGTGGGGATGTTAAGGTGGTG
                                                       **    ***  *  * ***  

DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGC-GGACCAGCT---CATGTTGACGGAACGTCCGCACT
LYC.ES_M        GAATATTGGGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTGTCC
                  *   **** * * *    * ** ** *  * *   *   **   **   * **   * 

DRO.MEL.        AAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAG
LYC.ES_M        AAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTG
                ****      *        * * *    * **     ***  ***  * *  **** * *

DRO.MEL.        GGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
LYC.ES_M        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
                **  * ****    ***  **    *   *****  ** ** *****   *  ***** *

DRO.MEL.        TGGGATAGCGTACCGGAGTGGACTGCCGTT--ATCAGCCCAACCGATATGGT----TGGA
LYC.ES_M        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
                  *****  *   *** **    *   ***   * *  ** *  *   ** *    *  *

DRO.MEL.        CCACAATCTTT
LYC.ES_M        CAACCACCTTT
                * ** * ****

[Download ClustalW]

#214

Mean pairwise ID: 41.18%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

CIN.HYB.        AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCGA
LYC.ES_D        --------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACA
                                                     ***** *****  ******   *

CIN.HYB.        GAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGGGGGGC
LYC.ES_D        GAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTA-AAGCGGGGCGG
                **** ** *** *   **  *  ***     ***     ***    ** ** ***** * 

CIN.HYB.        AATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGAAGGAT
LYC.ES_D        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
                *  ** * ******* ********** * *** * ***   ****   * **********

CIN.HYB.        TACAAGCCGGAGTGTC-TTAGGCTCA-TATAACCAGCCTGGCTAGCCCAACAGGACACCC
LYC.ES_D        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCACC
                 *   * *** ** *  * * * *** **   **     ** *   *****   **  **

CIN.HYB.        ATTT--
LYC.ES_D        ACTTTT
                * **  

[Download ClustalW]

#215

Mean pairwise ID: 41.20%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATC--GCCTTC
                                     ***** *  **  *  ****   * * *  *  *     

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_B        TTGTTGTGCGTTCGAGTTCTGGACTC---TGCACTGGGCTACTTTGTTGTCCTTTCCGAA
                   *** **    ********* **    *** **  **   *  * *****   *  * 

CAN.SPE.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
YAR.LI_B        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **     * *  

CAN.SPE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
YAR.LI_B        T-AACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCG
                * *** **   *  ** *    * *      ** *  *** **     *  *** ***  

CAN.SPE.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGC-GAGACCCCGTCTCT
YAR.LI_B        GTGGGATAGCAA-----CAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCT
                  * *   *  *     **  *   *  *   * ** **  **   *  * * ** ****

CAN.SPE.        -
YAR.LI_B        C
                 

[Download ClustalW]

#216

Mean pairwise ID: 41.23%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAGTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

ARA.TH_D        GTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAGCTG
TRI.AE_C        -------------------------------------GGTGGTCTGCCCGTTCCAAGTTG
                                                       **  ******  ****** **

ARA.TH_D        TG-AGTAATCTGTGTGGGTC--AGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGAG
TRI.AE_C        AGTAGTGGACCGCTTGGGGCCTATGCGAAAG-TTGGGCCTCACGGTCCATAATGT-GGCA
                 * ***   * *  **** *  * ***** * ***   *   ***    *** ** **  

ARA.TH_D        GGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGATG
TRI.AE_C        GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
                ** *  ************ **************** *** *** *** ** * ***** *

ARA.TH_D        GATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACC
TRI.AE_C        GATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGC---GACC
                *** *  *  **  *     *    ** **  ****   * *     **   *   ****

ARA.TH_D        ACCACTTT
TRI.AE_C        ACCATC--
                ****    

[Download ClustalW]

#217

Mean pairwise ID: 41.25%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****       *** * *  **  *****       ***  *  *   * ***

LYC.ES_A        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT-CTGGCCTGCCCTGTCCAAGCACA
YAR.LI_A        TGCGTTC---GAGTCTTGGGCTC--TGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCT
                 ** **    **   *******   **  *** *    * *  ** *** *** *   * 

LYC.ES_A        GAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGA
YAR.LI_A        GCGGTTGATGG-GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAA
                * * * ***   * * * *      *   ** *****   **** *     *  *    *

LYC.ES_A        CCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCTGTGCAGTGGAAGGATAA
YAR.LI_A        CTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG----GGTATGGCGG
                * *    *     *     **   ***   *    *     * ***    ** * *    

LYC.ES_A        TGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACC
YAR.LI_A        TGGGATCGCA----ACCAAGTGGTATATGTTATGGAAGATATTTACGATCA-CGATT---
                ****   *      * *****    **     *    * *   * * ** * * *     

LYC.ES_A        TTT
YAR.LI_A        ---
                   

[Download ClustalW]

#218

Mean pairwise ID: 41.26%


LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
ZEA.MA_H        ------NCCGAGCTCTGTAGC----GAGTGCTTGT-AACCCGAGCGGGGGCAATAAGG--
                       *   ******** *    * * ***    *  *  *******   *   **  

LEI.MAJ.        CAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGTGTGGCT
ZEA.MA_H        TAGTGTGGATG-TCAATTGTGGTG-CATG-TGCCTGGGTCTAGTGCTACAAACTGTGGAC
                 ** * ** ** *    ** * ** * ** ***   * *    **        *****  

LEI.MAJ.        TGCCCCCCTGCAGAGG-GTGGCGCGGGTCCGCCGTTGAAGCGAGGGAACCGGGTCAGGCC
ZEA.MA_H        CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATC---CC
                  ***      **  * ** * * *  ** *  *     ****  *    *  **   **

LEI.MAJ.        GGAAACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCAGAATCACACCGCGGAGCATG
ZEA.MA_H        AACACTAAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGA-GTACCGCCCG
                   *    **  **  **    **   * * * * *   ***    *   *    **  *

LEI.MAJ.        TCCGCACTTG-AGCCCCACGCTTCGTCGCGAAGCCTT---------
ZEA.MA_H        CCACCAGCGGTGGAAGGATAATGAGTCGCTATGCTATAGGCCCAAT
                 *  **   *  *    *   *  ***** * **  *         

[Download ClustalW]

#219

Mean pairwise ID: 41.30%


TRY.BR_A        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGG--CTGATCCCGCTTAGCGGGGACGTCT
SCH.POM.        CGCTGTAATGGCTTGGTC-GAAGTGTTTAGTACTCCCAATAGTGCAT-GTTCGGTGGTCT
                 ** * *  *  *** ** * *   **  *     *  **   ** * *   **  ****

TRY.BR_A        TGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGTGTT
SCH.POM.        CGGGT---TCGAGTCTCGCTTTCGATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTC
                 **       * *  **  ** ** *  ** * * * *  * *   * **    *  ** 

TRY.BR_A        GAGGTCGCCACTG-TAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGGGTCAGGC
SCH.POM.        TTCGTGGCAACTGGCAGTTAAACCGTGTAGTACCGATGGAG-GTTGGAAACAATGCACAT
                   ** ** ****  **  *  *  * * *  *** *  ** *  ** ***    **   

TRY.BR_A        CGGTGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCGAGAAGCACACCGAGGAGCATC
SCH.POM.        CACTACCGGG-----TCTTGGGCAGTGCGATAGCGATGGGATTCACCTTCGCAGGATGTG
                *  *  ***       *       *  ** *  ** * *       *  **  *    * 

TRY.BR_A        TCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
SCH.POM.        CATGGAAGTATAAACACAACGGTCGTT---------
                   ***  *     * ***  *****          

[Download ClustalW]

#220

Mean pairwise ID: 41.31%


LYC.ES_E        GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGGGGAGG
                          * * *   *   *******   * **** *    ***    *       *

LYC.ES_E        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGTACAG
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCG
                   **  ****   *   *  *** ** * * *  *   **    * *  *   **   *

LYC.ES_E        AGTTGGATCATGTGGTCCAATTGAAAGAATGG-GCTACTAGATTCCTAAAGTGGGGTGGA
LEI.MAJ.        GTGTGGCT----TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAAC
                   *** *    **  **  *  * **  *** **   *       * *** * **    

LYC.ES_E        CCCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATAA
LEI.MAJ.        CGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAGAATCA
                *  ** **** **    ** ***** *  *   *   * * *   ** ** * ** ** *

LYC.ES_E        CGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGTTCTAGTTAAACTACCAC
LEI.MAJ.        CACCGCGGAGCATGTCCG----CACTTGAGCCCCACGCTTCGTC---GCGAAGCCTT---
                *    *** ** *  *      ** *   ***  * *    **    *  ** *      

LYC.ES_E        ATTTT
LEI.MAJ.        -----
                     

[Download ClustalW]

#221

Mean pairwise ID: 41.31%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATC--GTCTTC
                                * *  ***** *  **  *  ****   * * *  *  *     

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_A        TTGTTGTGCGTTCGAGTCTTGGGCT---CTGCACTTGGCCATTTGGTTGTCCTTTCCGAA
                   *** *     ****  ******    *** **  ***  * ** *****   *  * 

HOM.SA_A        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCC----TAAGGA
YAR.LI_A        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **    ****  

HOM.SA_A        GGGGTGAACCGGCCCAGGTCGGAAACGGAGCAG-GTCAAAACTCCCGTGCTGATCAGTAG
YAR.LI_A        TAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTAT-GGCGG
                    **        ***    * **   ***** *    *  * *****   **  *  *

HOM.SA_A        TGGGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGT
YAR.LI_A        TGGGATCGCAACCA--AGTGGTATATGTTATGGAAGATATTTACGATCACGATT------
                *********  *    * * *    **   *  *   * *  *  **  ***        

HOM.SA_A        CTCTT
YAR.LI_A        -----
                     

[Download ClustalW]

#222

Mean pairwise ID: 41.33%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  * ***    *  * *

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
TRY.BR_A        CGGGGACGTCTTGGACAAGCGGGGGTT-CTGTTG-CGTTGACTTGGTGTTC-TGCTTGGT
                 * *   *     * *  * *   **   ***   *** ***   * ** * ***   * 

CAE.EL_C        GCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
TRY.BR_A        TGCGTGTCGGTGTTGAGGTCGCCA-CTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG
                   * ***      * * *  *   * * ***  * *  ** ** *    *** * * **

CAE.EL_C        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGGAC
TRY.BR_A        GGAACGGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGT--TCGAGA
                 * * ** ***** * *  * * ***** * *   *   *** ** * * **   **   

CAE.EL_C        AGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTCACT
TRY.BR_A        AGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG------
                *** *      *   *       **   **   *  * *  * **      *        

[Download ClustalW]

#223

Mean pairwise ID: 41.35%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGA-GACAATAAGGGGATGGGACGTT
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTG--GAT
                  *** *   **  ** * ********  **  *    ***  **      ** *  * *

ARA.TH_C        GGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCC---CGCCCATTCCA
CAE.EL_A        GGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCA
                **   **    *  * * *  **    ** *   * **    * **   ** ** * ***

ARA.TH_C        AGTTGGGAGTTG---AGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAG
CAE.EL_A        AGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTT--AGTCCCGGGTGCA-TAAGG
                **      **      ** **     ***   *  ** *   *** *  **    **  *

ARA.TH_C        TGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGT
CAE.EL_A        AGTCGTGGATGGTTCAGGACCGA---AAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
                 *  *  **  *     * * *     *   *****     * *  ****      * **

ARA.TH_C        GGAAGGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTG
CAE.EL_A        GGCCGGACCGCGC-TTGTGAGTTGACACACATAC-GCAGCCTTCTCGATACCTTCAGACC
                **  ***   **     *    *  *   *  **     **   *      ** *     

ARA.TH_C        GACCATCACTTT
CAE.EL_A        ACTTATCATTT-
                    **** ** 

[Download ClustalW]

#224

Mean pairwise ID: 41.37%


HUM.JA_A        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACTTTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                     ** * *   ** * ** *** *  **  *    *   ** *   *  *    * *

HUM.JA_A        GGTCAGCCCATTGGATCGG-GTCCAGTGTTAGCTGC-TTGCTGGTCTGCCCATTCCAAGC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 ** **   *   *  * * **     **   ** * * *   *   * ** * ******

HUM.JA_A        CGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCCTAAAGAGGAGG
CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
                     **      * *  * ***   ****** *      *   *  * *** ***  * 

HUM.JA_A        GCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGG
CAE.EL_D        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGG
                * *  *     * * *     *   *****  *  * *  ****     *******  **

HUM.JA_A        ATAACGGGTCGGTGCTACTTGGGCCACCATGGTCACTGCATGCACTCTTAATCAGACCAT
CAE.EL_D        ACCGCGCTTGTAAGTTGAC-ACACATACACAGCCTTCTCG-ATACCTTCAGACCACTTAT
                *   **  *    * *       *   **  * *    *    **  * *  *     **

HUM.JA_A        CTCTTTT
CAE.EL_D        CATTT--
                *  **  

[Download ClustalW]

#225

Mean pairwise ID: 41.39%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  * * *    *  * *

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
TRY.BR_B        CGGGGACGTCTTGGACAAGCGGGGGTT-CTGT-TGCGTTGACTTGGTGTTC-TGCTTGGT
                 * *   *     * *  * *   **   *** * *** ***   * ** * ***   * 

CAE.EL_A        GCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
TRY.BR_B        TGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGC-GTTCTCGCGCCGTTAAAGTGGGG
                     ***      * * *  *    * *  * **    ** ** *    *** * *  *

CAE.EL_A        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGGAC
TRY.BR_B        GGAACGGGTCAGGCCGGTGACGGAGCAGCCCACCTTG--CGCACGTTCCCGTTGCAGAAG
                 * * ** ***** * *  * * ***** * *    *  ***  * * * ** ** * * 

CAE.EL_A        CGCGCTTGTGAGT-TGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTATCAT
TRY.BR_B        CACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT-----
                * * *    ***  *  **    *  **  **     *    *   ** *   **     

CAE.EL_A        TT
TRY.BR_B        --
                  

[Download ClustalW]

#226

Mean pairwise ID: 41.40%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
YAR.LI_B        ------AGCTGTAATGGCATTTTGT---CGGAGTGGT-------AAATCGCCTTCTTGTT
                        *****  *  *  ****   * *** **        *  * *      *  *

ZEA.MA_G        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
YAR.LI_B        GTGCGTTCGAGTTCTGGACTCTG---CACTGGGCTACTTTG-TTGTCCTTTCCGAATTCT
                 **** * *  ****** * * *   * **  *   *****   * ***  ***      

ZEA.MA_G        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
YAR.LI_B        GCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                *  * *  ***  * *   * **         ******   * ***   *    * *  *

ZEA.MA_G        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATC--ACTGCC-CGCTTCCAACGGTG
YAR.LI_B        TGGGATA-CTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTG
                 ** **  * * **  ***    *   ***** ****    ****  *  *    *****

ZEA.MA_G        GGAGGATAACGGGCCGCTGCACTTC---GAGCCCAACTCAGGCCCAGAGCCTCACTAAGC
YAR.LI_B        GGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC-------
                ***    ***     * *  *  *    **    *  *     *  **  ***       

ZEA.MA_G        AGACCACCATCTTT
YAR.LI_B        --------------
                              

[Download ClustalW]

#227

Mean pairwise ID: 41.42%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
LYC.ES_L        --------------------------------------------GTTGGGTTGACCCAGA
                                                            * ** *    **    

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
LYC.ES_L        TGGTTGGGTTCGGTAG-----GCTTATAGTCTGGCCTGCCC------TCTCCAAGCATGG
                 * *** *  * * **     *  *  ***  *   ****         ***  **   *

GAL.GAL.        GCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGGG
LYC.ES_L        AGTTGGATCACGTGGCTTAGTC---GAAAGACCTGGGTTGCTTGATT-CCTAAAGTGGGG
                    * ****    * * ** *   *  ** *  **    *  * ** ***** * ****

GAL.GAL.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACGG
LYC.ES_L        TGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAG
                ** ** *    ***  **    ** *****    * * ** ***  * *  ****    *

GAL.GAL.        GAT--CGCGCCTGTGAATAGCCACTGCAGCGTA-GCC----TGGGCAACAT-AGCGAGAC
LYC.ES_L        GATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAAC
                ***  ** * * ***   *** * * ***   * ***    *****  *   * * * **

GAL.GAL.        CCTGTCTCC
LYC.ES_L        CACCACTTT
                *    **  

[Download ClustalW]

#228

Mean pairwise ID: 41.45%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATC--GTCTTC
                                *    ***** *  **  *  ****   * * *  *  *     

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
YAR.LI_A        TTGTTGTGCGTTCGAGTCTTGGGCTC---TGCACTTGGCCATTTGGTTGTCCTTTCCGAA
                   *** **    ****  ******    *** **  ***  * ** *****   *  * 

CAN.SPE.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCC----TAAGGA
YAR.LI_A        TTCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                *** **        ** * *       ***     * *    ** ** **    ****  

CAN.SPE.        GGGGTGAACCGGCCCAGGTCGGAAACGGAGCAG-GTCAAAACTCCCGTGCTGATCAGTAG
YAR.LI_A        TAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTAT-GGCGG
                    **        ***    * **   ***** *    *  * *****   **  *  *

CAN.SPE.        TGGGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGT
YAR.LI_A        TGGGATCGCAACCA--AGTGGTATATGTTATGGAAGATATTTACGATCACGATT------
                *********  *    * * *    **   *  *   * *  *  **  ***        

CAN.SPE.        CTCT
YAR.LI_A        ----
                    

[Download ClustalW]

#229

Mean pairwise ID: 41.46%


TRY.BR_B        ---AGCCGGAGCG-CATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
YAR.LI_A        CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCG-TCTTCTTGTTGTGCGTTCGAGT
                   *** * *  * ****     * *    *     * *  **  * *  ***     **

TRY.BR_B        CTTGGAC-----AAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTG-CGTG
YAR.LI_A        CTTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTC
                ***** *     *   **   **  ****   *  *    *  *  * *** * * *** 

TRY.BR_B        TCGGTGTTGA-GGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACG
YAR.LI_A        TCGGTCTGAGTAATCGGCTTTG-AGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTG
                ***** *      *** *  ** ***    ******            *       *  *

TRY.BR_B        GGTCAGGCCGGTGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCACACCGA
YAR.LI_A        GAGCAATCCAGCAGAGATCCAGTT-GCCGTGGGTATGG---CGGTGGGATCGCA-ACCAA
                *  **  ** *    *   ***    ** ** * * *    ** **     *** *** *

TRY.BR_B        GGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT
YAR.LI_A        GTGGTATAT----GTTATGGAAGATATTTACGATCACGATT------
                *  * ** *      * **      *  *    ** ***        

[Download ClustalW]

#230

Mean pairwise ID: 41.46%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGCT
YAR.LI_B        ------AGCTGTAATGGCATTTTGT---CGGAGTGGT-------AAATCGCCTTCTTGTT
                        *****  *  *  ****   * *** **        *  * *  *   ** *

ZEA.MA_A        TTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCCAAG
YAR.LI_B        GTGCGTTCGAGTTCTGGACTCTGCACTGG--GCTACTTTG------TTGTCCTTTCCGAA
                 **** * *  ****** * ***  ** *  *  **  **      *** ** * ** * 

ZEA.MA_A        TTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCGGC
YAR.LI_B        TT--CTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAG
                **    * *  ** **** *     *    **   * **  *    *   * *       

ZEA.MA_A        AGGAA-TGGCGTAAGGC--TGGCTTCACAGAGCAGCGATC--ACTGCCG-ACTCCCAACG
YAR.LI_B        ATTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCG
                *  ** ***  **   *  ***    *   ***** ****    *****         **

ZEA.MA_A        GTGGGAGGATAACGAAGCCGC-TGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAA
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC----
                ******    *** ***  *  *    * **      * *     ***  **        

ZEA.MA_A        GCAAACCACCATCTTT
YAR.LI_B        ----------------
                                

[Download ClustalW]

#231

Mean pairwise ID: 41.46%


PER.AME.        GATCCGTAACGCGAGCTTATAACTCGAGCGGGGGCTATAAAGGTGGTGTGGAACGAGCTG
MUS.MU_A        -GCCTGTAGTTCCAGCT----ACTCG---GGAGGCTGAGACAGGAGGATCGCTTGAGTCC
                   * ***   * ****    *****   ** ****   *  *  *  * *   ***   

PER.AME.        ACTCGACCTGCCGGGTTGGGCCAGGGACTGCGGTGCTGGCTCGCCCGTTCCAAGTCGGGT
MUS.MU_A        AAGAGTTCTGGGCTGTAGTGC-----GCTATGCCGATCGGGTGTCCGCACTAAGTTCGGC
                *   *  ***    ** * **      **  *  * * *   * ***  * ****  ** 

PER.AME.        AGTGGGCCATGTGGCTTGGGCGAAGGCCTGGGTTTCTTGGCC--
MUS.MU_A        AACAATATG-GTGACCTCCCGGGAGCGGGGGACCACCAAGTTGC
                *         *** * *    * **    **    *   *    

[Download ClustalW]

#232

Mean pairwise ID: 41.48%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAA-ATCGTCTTCTTGTTGTGC--
                      ** **    *   ** * *   *   ****  * **     *  **     *  

ARA.TH_E        GTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGTCCAAGCTG
YAR.LI_A        GTTCGAGTCT-----TGGGCTCTGCACTTGGC-CATTT---GGTTGTCCTTTCCGAATTC
                ***** ***        ** ****   *****   ***   ** ** **  *** *  * 

ARA.TH_E        TGAGTAAGACGTGTGTGTCAAGCGAAG-GCTTGGCTCAAACGGCT----TCTAAAGTTGG
YAR.LI_A        TGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAA
                ** *   ** * * ** **   *  **   * ****   *    *    *****  **  

ARA.TH_E        AGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGA-CTACTTCCCGCTTACAGCAGTGG
YAR.LI_A        CTGGGAA-ACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTA-TGGCGG
                  ** **  * * **  ***    *   ***** ** * * ** ***     *   * **

ARA.TH_E        ACGGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGA
YAR.LI_A        TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT--------
                  ***** **    ** *         *           * *     ****         

ARA.TH_E        ACCACCATTTT
YAR.LI_A        -----------
                           

[Download ClustalW]

#233

Mean pairwise ID: 41.48%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
LYC.ES_L        ---------------------------------------------------------GTT
                                                                         * *

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_L        GGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCC---TGCCCTCTCCAAG
                 * ****  *     ***  *  * ** *     **  * *  *   ** ** * * ***

ORI.CUN.        TTCGGCATCA-ATATGGTGACCTC-CCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LYC.ES_L        CATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATT-CCTAAAGTGG
                   **  *   **   *** * *   **  **    **    *  * ** ***** * **

ORI.CUN.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                **** ** *    ***  **    ** *****    * * ** ***  ***  **** * 

ORI.CUN.        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCA-GCC----TGGGCAACAT-AGCGAG
LYC.ES_L        AGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAA
                 ****  ** * * ***   *** * * ** *  * ***    *****  *   * * * 

ORI.CUN.        ACCCTGTCTCC
LYC.ES_L        ACCACCACTTT
                ***    **  

[Download ClustalW]

#234

Mean pairwise ID: 41.48%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
LYC.ES_D        ------------------------------------------------------------
                                                                            

ZEA.MA_G        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
LYC.ES_D        -------------------------------------TAGTTCTGGCCTGCCCTGTCCAA
                                                     *    * *********   ****

ZEA.MA_G        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
LYC.ES_D        GCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGG
                *     *** *      *****   *  * **   * **  ***  *  *** *** ** 

ZEA.MA_G        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCAACGGTGGGA
LYC.ES_D        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAA
                  * *  ** ********************** ** **   ******     * **** *

ZEA.MA_G        GGATAACGGGCCGCTGCACT-TCGAGCCCAACTCAGGCCCA--GAGCCTCACTAAGCAGA
LYC.ES_D        GGATAATGGGTCGGTGTCTTATCAAGTTCAG-TAACGCCTAATGGGTTGCTCCAACTAAA
                ****** *** ** **   * ** **  **  * * *** *  * *   * * **  * *

ZEA.MA_G        CCACCATCTTT
LYC.ES_D        CCACCACTTTT
                ******  ***

[Download ClustalW]

#235

Mean pairwise ID: 41.58%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGGGGAGG
                          * * *   *   *******   * **** *    * *    *    *  *

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCG
                   ** *****   *   *  *** ** * * *  *    **   * *  *   *  * *

LYC.ES_N        AGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGAA
LEI.MAJ.        GTGTGGCT----TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAAC
                   *** *    ** ***  *  *     ***      *    ***  *   * * * * 

LYC.ES_N        TGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTC-TAAGCGGTGGAAGGATAA
LEI.MAJ.        CGGGTCAGGCCGGAA--ACGGAGCAGCC-CACCCCACGCACGTCCGCCGTTGCAGAATCA
                 * ** **** **    ** ***** *   *     *** * *  ** ** * ** ** *

LYC.ES_N        CGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCATT
LEI.MAJ.        CACCGCGGAGCA---TGTCCGCACTTGAGCCCCACGCTTCGTCGCGA---AGCCTT----
                *    *** *     **    ** *   ***  * *  * *   * *   * **      

LYC.ES_N        TTT
LEI.MAJ.        ---
                   

[Download ClustalW]

#236

Mean pairwise ID: 41.61%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACA-ATAAGGTGGTGGAACAGT
LEP.COL.        -----GCCGG--AGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                     **     * *       *** ***   * ***     *  ** **       ** 

ARA.TH_D        GGTTCAATTC--CTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAG
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGG---TGCTCTGCTTGGCTGTGT
                 **      *  *   **  *     *  * **** *     **  ****   *      

ARA.TH_D        CTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGAG
LEP.COL.        GTCGGAGGCCTCCGGGTGC-CCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG
                 *  ***   ** * ***   *    * **    * * *   *      * **    ***

ARA.TH_D        GGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA-CAGCAGTGGAT
LEP.COL.        GA-ACTGGGTCAGGCCGGCA--ACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCA
                *  * ** ** **** **    ** *******  * ** ** * *    * ** ** *  

ARA.TH_D        GGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCC-GCTGGTTCGATCTCTCCTGGA
LEP.COL.        GAACCACACCGCGGAGCCTGTCA--TCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT--
                * * ** *   ** ** ** ***  **  **  * *** *  * * *  *    * *   

ARA.TH_D        CCACCACTTT
LEP.COL.        ----------
                          

[Download ClustalW]

#237

Mean pairwise ID: 41.64%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
YAR.LI_B        -------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTT
                                     *******   *  *  * ****    *    * *   * 

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
YAR.LI_B        G-TTGTGCGTTCGAGTTCTGGACTCT---GCACTGGGCTACTTTGTTGTCCTTTCCGAAT
                * *** **    ********* **     * ***  *    *  * ***** * *  * *

FUG.RUB.        TCGGTA-TCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCC----TAAGGA
YAR.LI_B        TCTGCGGTTGATG-GGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                ** *   * ***  ** *   * *   ***     *      ** *  **    ****  

FUG.RUB.        GGGGTGCCCCGGCCCAGGTCGGAAACGAAGCAG-GTCAAAGCCCCCGTGCCGCTCAGTAG
YAR.LI_B        TAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGG-GTATGGCGG
                    **        ***    * **   ***** *    **   *****  *    *  *

FUG.RUB.        TGGGATCGCGCCCGTG-AATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAG
YAR.LI_B        TGGGATAGCAACAAAGTGGTATATGTTATGG---AAGGTATTTGCAATCACGACTCTC--
                ****** **  *   *   ** * * * * *   **  *   *   *   **   ***  

FUG.RUB.        TCTTT
YAR.LI_B        -----
                     

[Download ClustalW]

#238

Mean pairwise ID: 41.64%


TRY.BR_B        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGG-GCTGATCCCGCTTAGCGGGGACGTCTT
SCH.POM.        ----------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAATAGTG-CATGTT
                          *  **   **      ***  * * * *   * *  *   * * * * **

TRY.BR_B        GGACAAGCGGGGGTTCT-GTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGTGTT
SCH.POM.        CGGTGGTCTCGGGTTCGAGTCTCGCT--TTCGATCCCTCGATCTGCCACGT-CTGTTCGA
                 *     *  ******  **  ** *   * * *     * *  *   ***   * *   

TRY.BR_B        GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGGGTC-AGGC
SCH.POM.        AGAGTAGTCTTCGTGGCAA--------CTGGCAGTTAAACCGTGTAGTACCGATGGAGGT
                   ** * *   ** *  *        *  ** ******  * *  * ** * *  *** 

TRY.BR_B        CGGTGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCACACCGAGGAGCATC
SCH.POM.        TGGAAACAATGCACATCACTACCGGGTCTTGGGCAGTGCGATAGCGA--TGGGATTCACC
                 **  **   ***   ***     *  * *   *  ***   ***     * *   ** *

TRY.BR_B        TCAGGACTTTGCGCCCC-AAGTGTCGTCGCGA-GGCGGTTT
SCH.POM.        TTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT-
                *  * *   ** **    **** *   * * * **  *** 

[Download ClustalW]

#239

Mean pairwise ID: 41.67%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGA-GACAATAAGGGGATGGGACGTT
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTG--GAT
                  *** *   **  ** * ********  **  *    ***  **      ** *  * *

ARA.TH_C        GGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCC---CGCCCATTCCA
CAE.EL_D        GGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCA
                **   **    *  * * *  **    ** *   * **    * **   ** ** * ***

ARA.TH_C        AGTTGGGAGTTG---AGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAG
CAE.EL_D        AGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTT--AGTCCCGGGTGCA-TAAGG
                **      **      ** **     ***   *  ** *   *** *  **    **  *

ARA.TH_C        TGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGT
CAE.EL_D        AGTCGTGGATGGTTCAGGACCGA---AAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
                 *  *  **  *     * * *     *   *****     * *  ****      * **

ARA.TH_C        GGAAGGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTG
CAE.EL_D        GGCCGGACCGCGC-TTGTAAGTTGACACACATAC-ACAGCCTTCTCGATACCTTCAGACC
                **  ***   **     *    *  *   *  ** *   **   *      ** *     

ARA.TH_C        GACCATCACTTT
CAE.EL_D        ACTTATCATTT-
                    **** ** 

[Download ClustalW]

#240

Mean pairwise ID: 41.67%


FUG.RUB.        GCCGGGTACGGTGGCGCGTG-CCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGAT
LEP.COL.        GCCGGA-GCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGG--AGCTGTC
                *****   *  **    **  ***            **  *  *     **   ** *  

FUG.RUB.        CGCTTGAGCTCAGGAGTTCTG-GGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAA
LEP.COL.        TGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGAG
                 *    ***  ***     ** *** *   **   *     * * ** ***  **   * 

FUG.RUB.        GTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGG
LEP.COL.        GCC-----TCCGGGTGCC-CCCTTGCAGAAG---GGGCGCGCCCCCTCCGTTAAAGTAGA
                *       **    **   * * **  * **   ***  * **   **   *** *  * 

FUG.RUB.        GTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGG
LEP.COL.        G-GAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTTGCAGA
                * *  * **  **** *** **** *****  **   * * *  * *   * ** *  * 

FUG.RUB.        ATCGCGCCCGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAGTCTTT
LEP.COL.        ACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT------
                * * * **   **        *    * *  **   *  *  * * *   **        

[Download ClustalW]

#241

Mean pairwise ID: 41.67%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
SCH.POM.        -------------------CGCTGTAATGGC--TTGGTCGAAGTGTTTAGTACTCCCAAT
                                     ***** *  *   *  ***    * * **        **

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
SCH.POM.        AGTGCATGTTCGGTGGTCTCGGGTTCGAGT-CTCGCTTTCGATCCCTCGATC-TGCCACG
                 *     ** * *  **   *** *  *** * *  *  *****    *  *   * * *

HOM.SA_A        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
SCH.POM.        TCTG---TTCGAAGAGTAGTCTTC--GTGGCAACTGGCAGTTAAACCGTGTA--------
                *  *   *    *  **   ** *  *  **    * *    *    *  **        

HOM.SA_A        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
SCH.POM.        -GTACCGATGGAGGTTGGAAACAATGCACATC---ACTACCG-GGTCTTGGGCAGTGCGA
                 * ****    **** ******   ***  **   *** *** * *  *  * **** **

HOM.SA_A        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTCTT
SCH.POM.        TAGCGA-TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATA--AACACAACGGTCGTT
                * ***  ** ** *  **   ***       *   * *  ***   * **  **    **

[Download ClustalW]

#242

Mean pairwise ID: 41.78%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC--
                    ***       * * *   ***** *   * **    ***    *    *   *   

LYC.ES_K        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRY.BR_B        GTCTTGGACAAGCGG--GGGTTCTGTTGCGTTGACTTGG---TGTTCTGCTTGGTTGCGT
                * ***   **   **  *** *  ** *  **   *  *   **  ***        *  

LYC.ES_K        AGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGAC
TRY.BR_B        GTCGGTGTTGAG-GTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGAA
                    *  *   * * * * * ** * * * * * *          ***** **** *** 

LYC.ES_K        CGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGC-TCTGTGCAGTGGAAGGATA
TRY.BR_B        CGGGTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCACA
                **  * **** **  * ** ******   **    * * * *    *  *  **** * *

LYC.ES_K        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
TRY.BR_B        CCGAGG-AGCATCTCAGGACTTT-----GCGCCCCAAGTGTCGTCGCGA--GGCGGTTT-
                  * *   *  *** *  *  **      ****  * * ** *   * *    *      

LYC.ES_K        CTTT
TRY.BR_B        ----
                    

[Download ClustalW]

#243

Mean pairwise ID: 41.78%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****       *** * *  **  *****       ***  *  *   * ***

LYC.ES_H        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
YAR.LI_A        ---TGCGTTCGAGTCTTGGGCTCTGCAC-TTGGCCATTTGGTTGTCCTTTCCGAATTCTG
                   **     **   *******  *     *      *   *** *** *** *  *  *

LYC.ES_H        AGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGAA
YAR.LI_A        CGGTTGATGG-GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                 * * ***   * * * *  *   ** *** * **    ****       *  *    * 

LYC.ES_H        TGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAA
YAR.LI_A        TGGGAAACTTCAGTGGAGCAATCCAGCAG--AGATCCAGTT----GCCGTGG--GTATGG
                ** *  *     **    **   ***     ** *** * *    ** ****  * **  

LYC.ES_H        TGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACC
YAR.LI_A        CGG-TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCA-CGATT---
                 ** * **      * *****    **     *    * *   * * ** * * *     

LYC.ES_H        TTTT
YAR.LI_A        ----
                    

[Download ClustalW]

#244

Mean pairwise ID: 41.80%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGGATGCT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAA----ATCGTCTTCTTGTTGTG
                      **  *  *  *  ** * *   * *** **       *  **  * * * **  

ZEA.MA_C        TGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAGTT
YAR.LI_A        CGTT--CGAGTCTTGGGCTCTGCACTTGGCC--ATTTGGTTGTCCTTTCCGAATTCTGCG
                 * *  ** ***** * **  *  * ***      ** **** ***  ***      *  

ZEA.MA_C        GGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTGGCAG
YAR.LI_A        GTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCC-GTTCTAAGATTAACTG
                * *  *** ***      **  *   * ***  ** * ** *  *  *  * * *  * *

ZEA.MA_C        GAACGGC---GTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGGA
YAR.LI_A        GGAAACTTCAGTGGAGCAATCCA-GCAGAGATCCAGTTGCCGTGGGT-----ATGGCGGT
                * *       ***  **  **    *****   *  *  * *  **      * ** ** 

ZEA.MA_C        AGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAGA
YAR.LI_A        GGGATCGCAACCAAGTGGTATATG-------TTATGGAAGATATTTACGATCACGATT--
                 ****  **  * * **    ***       *** **   * * **   *  *       

ZEA.MA_C        CCACCATTTTT
YAR.LI_A        -----------
                           

[Download ClustalW]

#245

Mean pairwise ID: 41.81%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
SCH.POM.        ------------------CGC-TGTAATGGC--TTGGTCGAAGTGTTTAGTACTCCCAAT
                                  *** **** *  *   *  ***    * * **        **

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
SCH.POM.        AGTGCATGTTCGGTGGTCTCGGGTTCGAGT-CTCGCTTTCGATCCCTCGATC-TGCCACG
                 *     *  * *  **   *** *  *** * *  *  *****    *  *   * * *

CAN.SPE.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
SCH.POM.        TCTG---TTCGAAGAGTAGTCTTC--GTGGCAACTGGCAGTTAAACCGTGTA--------
                *  *   *    *  **   ** *  *  **    * *    *    *  **        

CAN.SPE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
SCH.POM.        -GTACCGATGGAGGTTGGAAACAATGCACATCA---CTACCGGGTCT-TGGGCAGTGCGA
                 * ****    **** ******   ***  ***   ** *** *    *  * **** **

CAN.SPE.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTCT
SCH.POM.        TAGCGA-TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACG-GTCGTT
                * ***  ** ** *  **   ***       *   * *  ***   * * *  ***  *

[Download ClustalW]

#246

Mean pairwise ID: 41.83%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                       ** *  **      *****  *   *         *      * **** *   

RAT.RAT.        CGCTTGAGTCCA-----GGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCA
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTG--
                 *  **   *       ** * *   ***  *   * * *   * * * ** ***  *  

RAT.RAT.        CTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LEP.COL.        ------TCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGT
                      ****   *     **** ** *  *     ****  *  **     *   *** 

RAT.RAT.        AGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
LEP.COL.        AGAGG--AACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCC-GTTG
                ** **  *** **  **** *** **********  **   * * *  *     * ** *

RAT.RAT.        TGGGATCGCGCCTGTGAATA-GCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCG
LEP.COL.        CAGAACCACACCGCGGAGCCTGTCATCAC-CTGCGCCCCAGGCGATCCTGTGAAGCTTT-
                  * * * * **   **    * **   * ** *  **  *** *    * **  *    

RAT.RAT.        TCTCTT
LEP.COL.        ------
                      

[Download ClustalW]

#247

Mean pairwise ID: 41.83%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGAT-GGTGGGACACT
LEI.MAJ.        -----GCCGG--AGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGA
                     **     * *  *    *******   * ***   *  * * *  * ***     

ARA.TH_F        GGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCT
LEI.MAJ.        CGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCT---CTGCTTGGCTGTGTGT
                 **       *  ** *   **     ** * * ** * **   ****   *       *

ARA.TH_F        GTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCAGGTTCTAGAGTCGGAGGGT
LEI.MAJ.        CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT--CCGCCGTTGAAGC--GAGGGA
                  * **   * *             *  ***  ** *  * *    *  **   ***** 

ARA.TH_F        AATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-CAGCAGTGGACGGA
LEI.MAJ.        ACCGGGTCAGGCCGGAA--ACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCAGAA
                *  * ** **** **    ** *******  * **  * ***    * ** ** *  * *

ARA.TH_F        TCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCAC
LEI.MAJ.        TCACACCGCGGAGCATGTCCG---CACTTGAGCCCCACGCTTCG---TCGCG-AAGCCTT
                ****      * *    ** *   ****   ***    * * **   **     * **  

ARA.TH_F        CATTTT
LEI.MAJ.        ------
                      

[Download ClustalW]

#248

Mean pairwise ID: 41.88%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

ARA.TH_A        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
LYC.ES_D        ---------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCAC
                                                 *  *****  ****** ********  

ARA.TH_A        TGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGGAGGG
LYC.ES_D        AGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAG-CGGGGCG
                 *****         *     *  ***    ***          * *** ** *** * *

ARA.TH_A        TAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGA
LYC.ES_D        GACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA
                 *  ** ********************** **  *  *******    ******** ***

ARA.TH_A        TCACGGTTTAGCGTCGC-TCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCA
LYC.ES_D        TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAAC-TAAACCA
                * * ** *  * ***   ***    ** **  ****  ***   * **  *  * *****

ARA.TH_A        CCATTTT-
LYC.ES_D        CCACTTTT
                *** *** 

[Download ClustalW]

#249

Mean pairwise ID: 41.90%


TRY.BR_A        ---AGCCGGAGCG-CATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
YAR.LI_A        CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCG-TCTTCTTGTTGTGCGTTCGAGT
                   *** * *  * ****     * *    *     * *  **  * *  ***     **

TRY.BR_A        CTTGGAC-----AAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTG-CGTG
YAR.LI_A        CTTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTC
                ***** *     *   **   **  ****   *  *    *  *  * *** * * *** 

TRY.BR_A        TCGGTGTTGA-GGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACG
YAR.LI_A        TCGGTCTGAGTAATCGGCTTTG-AGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTG
                ***** *      *** *  ** ***    ******            *       *  *

TRY.BR_A        GGTCAGGCCGGTGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCGAGAAGCACACCGA
YAR.LI_A        GAGCAATCCAGCAGAGATCCAGTT-GCCGTGGGTATGG---CGGTGGGATCGCA-ACCAA
                *  **  ** *    *   ***    ** ** * * *    ** * *    *** *** *

TRY.BR_A        GGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
YAR.LI_A        GTGGTATAT----GTTATGGAAGATATTTACGATCACGATT---
                *  * ** *      * **      *  *    ** ***     

[Download ClustalW]

#250

Mean pairwise ID: 41.91%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATC-CAGCTACTTGGAGGCTTGGGCTGTCGGATC
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                                  *  *******  **  *  * ****   *     ***   * 

XEN.LAE.        GCTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGT
YAR.LI_A        G-TTGTGCGTTCGAGTCTTGGGCT---CTGCACTTGGCCATTTGGTTGTCCTTTCCGAAT
                * *** *     ****  ******   ***  **  * *  * ** *****   *  * *

XEN.LAE.        TCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTT---GCTCTAAGGAG
YAR.LI_A        TCTGCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                ** *         ** **  * *   ***     *      ** **   * ******   

XEN.LAE.        GGGTGAACCGGCCCAGGTCGGAAACGGAGCAG-GTCAAAACCCCCGTGCCGATCAGTAGT
YAR.LI_A        AACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTAT-GGCGGT
                   **        ***    * **   ***** *    *    *****   **  *  **

XEN.LAE.        GGGATCGCGCCTGTG-AATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGT
YAR.LI_A        GGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT---------
                ********  *   *   **   * *   *** *   * *  * ***             

XEN.LAE.        TCT
YAR.LI_A        ---
                   

[Download ClustalW]

#251

Mean pairwise ID: 41.97%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

CIN.HYB.        AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCGA
TRI.AE_C        ------------------------------------GGTGGTCTGCCCGTTCCAAGTTGA
                                                      ***  ************** **

CIN.HYB.        G-AGTGGGTT-CATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGGGGG
TRI.AE_C        GTAGTGGACCGCTTGGGGCCTATGCGAAAG-TTGGGCCTCACGGTCCATAATGT-GGCAG
                * *****    * **   ***  ***** * * ***      *  *  **   * **  *

CIN.HYB.        GCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGAAGG
TRI.AE_C        GCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGG
                ***  **** ******* ********** **** ***  *   **  * ** ********

CIN.HYB.        ATTACAAGCCGGAGTG-TCTTAGGCTCATATAACCAGCCTGGCTAGCCCAACAGGACACC
TRI.AE_C        ATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGC--GACCAC
                ** **  ****  *   ** *****   *    **     * ***  *** *  ***  *

CIN.HYB.        CATTT
TRI.AE_C        CATC-
                ***  

[Download ClustalW]

#252

Mean pairwise ID: 41.97%


HUM.LU_C        GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTGGGT
SCH.POM.        -------------------------CGCTGTAATGGCTTGGTCGAAGTG-----TTTAGT
                                         *   **   *** **   *** **     **  **

HUM.LU_C        CAACCCAGTGGTNCGGGNCCAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAAGCCGGGA
SCH.POM.        ACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTT--CGAGTCTCGCTTTCGATCCCTCGA
                   **** * ** *  *  * *** *  * * **  *  *   * * *** *  **  **

HUM.LU_C        GGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGC--ACTCCTAGACTGGAGGGCAA
SCH.POM.        TCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTAC
                  **    *   *  *   * * ** **    *    *   *   ** ** *    * * 

HUM.LU_C        TGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGATAA
SCH.POM.        CGATGGAGGTTGGAA--ACAATGCA--CATCACTACCGGGTCTTGG--GCAGTGCGATAG
                 *   **** ***    ***  ***   *  **  ** * *** **  *  *   **** 

HUM.LU_C        CGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGACCATTT
SCH.POM.        CGATGGGATTCACCTT---CGCAGGATGTGCA--TGGA---AGTATAAACACAACGGTCG
                **    * * * ****   *  *   *** **  ***    * * * ** *  **  *  

HUM.LU_C        CTTTT
SCH.POM.        TT---
                 *   

[Download ClustalW]

#253

Mean pairwise ID: 41.98%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAAT-------CGTCTT
                      ** **  *  *  ** * *   *  ** **      ****        **  * 

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
YAR.LI_A        CTTGTTGTGCGTTCGAGTCTTGGGCTCTGCACT-TGGCCATTT-----GGTTGTCCTTTC
                 *** ****  ***   ** ***** *     * * *  ** *     * *** ** ***

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
YAR.LI_A        CGAATTCTGCGGTTGAT--GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTC
                * * **  *  ** *    * * * **  * *  **   *  ******    * * *  *

ORY.SA_A        TAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATC--ACTGCC-CGCTT
YAR.LI_A        TAAGATTAACTGGGAAACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGT
                ***  *     *   * * * **  ***    *   ***** ****    ****  *  *

ORY.SA_A        CCATCGGTGGAAGGATAACAGGCTGCTGCACCTT---GGGCCCGCTTCTGGCCCAGAGTC
YAR.LI_A        ATGGCGGTGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-
                    ****** *    ***    ** *  *  **   *       **  *  *  ** * 

ORY.SA_A        CCTCTACAACAGACCACCATCTTT
YAR.LI_A        ------------------------
                                        

[Download ClustalW]

#254

Mean pairwise ID: 41.99%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
LYC.ES_L        ---------------------------------------------------------GTT
                                                                         * *

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_L        GGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCC---TGCCCTCTCCAAG
                 * ****  *     ***  *  * ****     **  * *  *   ** ** * * ***

HOM.SA_A        TTCGGCATCA-ATATGGTGACCTC-CCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LYC.ES_L        CATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATT-CCTAAAGTGG
                   **  *   **   *** * *   **  **    **    *  * ** ***** * **

HOM.SA_A        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                **** ** *    ***  **    ** *****    * * ** ***  ***  **** * 

HOM.SA_A        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCA-GCC----TGTGCAACAT-AGCGAG
LYC.ES_L        AGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAA
                 ****  ** * * ***   *** * * ** *  * ***    ** **  *   * * * 

HOM.SA_A        ACCCCGTCTCTT
LYC.ES_L        ACCACCACTTT-
                *** *  ** * 

[Download ClustalW]

#255

Mean pairwise ID: 42.02%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGG-GGGCAACAATGTGGTGGAATGTT
YAR.LI_B        ----AGC--TGTAATG---GCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTT
                    ***  ***** *   ** * *   * ******       *  * * ** *   ***

LYC.ES_F        GGGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAGCAC
YAR.LI_B        CGA---GTTCTGGACTCTGCACT----GGGCTACTTTGTTGTCCTTTCCGAATTCTGCG-
                 *     *  **     **  **    ****** * *  ** ***  **       **  

LYC.ES_F        AGAGTTGGGTCAAGTGGTCTATACGAA-AGTATAGCCACTTGGCCTTTAGAGTGGGATGG
YAR.LI_B        GTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGG
                   * ****      *****     *   *  * *  * **    * **   *    ***

LYC.ES_F        ACTGCGTGAGGCTGGTTTCACAGAGCAACGA-CTAGTCCCCGCTCTGTGCAGTGGAAGGA
YAR.LI_B        GATACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCG-TGGGTATGGCGGTGGGA
                  * * * **  ***    *   ****  ** * ***  *** *  **   * **  ***

LYC.ES_F        TCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCAT
YAR.LI_B        TAGCAACAAAGTGGTATAT--GTTATGGAAGGTATTTGCAATCACGACTCTC--------
                *  *     **** * * *  **  *   *   *  **  *    * **           

LYC.ES_F        CACTTTT
YAR.LI_B        -------
                       

[Download ClustalW]

#256

Mean pairwise ID: 42.04%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
YAR.LI_B        ------AGCTGTAATGGCATTTTGT---CGGAGTGGT-------AAATCGCCTTCTTGTT
                        *****  *  *  ****   * *** **        *  * *      *  *

ZEA.MA_E        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
YAR.LI_B        GTGCGTTCGAGTTCTGGACTCTG---CACTGGGCTACTTTG-TTGTCCTTTCCGAATTCT
                 **** * *  ****** * * *   * **  *   *****   * ***  ***      

ZEA.MA_E        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
YAR.LI_B        GCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                *  * *  ***  * *   * **         ******   * ***   *    * *  *

ZEA.MA_E        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATC-ACTCGCCG-GCTTCCAACGGTG
YAR.LI_B        TGGGATA-CTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTG
                 ** **  * * **  ***    *   ***** **** * * **** *  *    *****

ZEA.MA_E        GGAGGATAACGGGCCGCTGCACTTC---GAGCCCAACTCAGGCCCAGAGCCTCACTAAGC
YAR.LI_B        GGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC-------
                ***    ***     * *  *  *    **    *  *     *  **  ***       

ZEA.MA_E        AGACCACCATCTTT
YAR.LI_B        --------------
                              

[Download ClustalW]

#257

Mean pairwise ID: 42.07%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
LYC.ES_M        ---------------------------------CAAGTGGGGATGTTAAGGTGGTGGAAT
                                                 * * * **** * * **   *  * **

GAL.GAL.        CGCTTGA-GCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAA
LYC.ES_M        ATTGGGCTGTCCCAGATGGCTGGGCT-TGGTGGGCTAATTTCTG-GCCTGCCCTGTCCAA
                     *  * **  **   *******   *** ****      * *   * **   * **

GAL.GAL.        GGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGG
LYC.ES_M        GCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGG
                *  * *  *           ****    **    * *  *  *  * * ***** * ***

GAL.GAL.        GTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACG
LYC.ES_M        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAA
                * * ****    ***  **    ** ******   * * ******  * *  ****    

GAL.GAL.        GGAT--CGCGCCTGTGAATAGCCAC-TGCAGCGTAGCCTGG-GCAACATAGCGAGACCCT
LYC.ES_M        GGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACA
                ****   * * * ***  *   **  * ***    ****   *        * * *  * 

GAL.GAL.        GTCTCC---
LYC.ES_M        ACCACCTTT
                  * **   

[Download ClustalW]

#258

Mean pairwise ID: 42.07%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGT-GGATG
LYC.ES_M        ------------------------CAAGTGGGGATGTTAA-GGTGGTGGAATATTGGGCT
                                          ***  *  * ** * *** *   * * * **   

CAE.EL_D        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAG
LYC.ES_M        GTCCCAGATGGCTGGGCTTG-GTGGGCTAATTTCTGGCCTGCCC---TGTCCAAGCACAG
                *    *** *    * * ** **  *      ***     * **    ****  **  **

CAE.EL_D        CGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
LYC.ES_M        AGTTGGATCACGAGGCCCAAAT-----GAAAATATGGGCTTCTTGATTCCTAAAGTGGGG
                 * *   **** ***    **      ***         * *  * * * *** * *  *

CAE.EL_D        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCG
LYC.ES_M        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 ***  *     * * *     *   *****  ** ***  ****   *********  *

CAE.EL_D        GAC--CGCGCTTGTAAGTTGACACACATA-CACAGCCTTCTCGATACCTTCAG--ACCAC
LYC.ES_M        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAA
                **    * *   **   **  **     *  *  ****  * * *  ** **   * ** 

CAE.EL_D        TTATCATTT
LYC.ES_M        CCACCTTT-
                  * * ** 

[Download ClustalW]

#259

Mean pairwise ID: 42.11%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
SCH.POM.        -------------------------CGCTGTAATGGCTTGGTCGAAGTG-----TTTAGT
                                         *   **   *** **   *** **     **  **

HUM.LU_B        CAGCCCAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCGGGA
SCH.POM.        ACTCCCAATAGTGCATGTTCGGTGGTCTCGGGTT-CGAGTCT-CGCTTTCGATCCCTCGA
                   **** * *  *  ** * *** *  * * ** *  **** * * *** *  **  **

HUM.LU_B        GTTGGGCTGAGTGACCTGGGCGAAGGCCTGG-GTTGCGCAGCTCCTAGAGTGGAGGGCAA
SCH.POM.        TCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTAC
                  **    *  **  *   * * ** * * * *       **   ** *  *    * * 

HUM.LU_B        TGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAGGATAA
SCH.POM.        CGATGGAGGTTGGA--AACAATGCAC--ATCACTACCGGGTCTTGG--GCAGTGCGATAG
                 *   **** ***    ***  ***   *  **  ** * **  **  *  *   **** 

HUM.LU_B        CGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACCATTTC
SCH.POM.        CGATGGGATTCACCTTCG--CAGGATGTGCATGGAAGTATAAACACAAC--GGTCGTT--
                **    * * *  *** *  **  **** **  *      *  *  **   *  * **  

HUM.LU_B        CTTT
SCH.POM.        ----
                    

[Download ClustalW]

#260

Mean pairwise ID: 42.12%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
LYC.ES_L        ---------------------------------------------------------GTT
                                                                         * *

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_L        GGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCC---TGCCCTCTCCAAG
                 * **** **     ***  *  * * **     **  * *  *   ** ** * * ***

CAN.SPE.        TTCGGCATCA-ATATGGTGACCTC-CCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LYC.ES_L        CATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATT-CCTAAAGTGG
                   **  *   **   *** * *   **  **    **    *  * ** ***** * **

CAN.SPE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                **** ** *    ***  **    ** *****    * * ** ***  ***  **** * 

CAN.SPE.        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCA-GCC----TGTGCAACAT-AGCGAG
LYC.ES_L        AGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAA
                 ****  ** * * ***   *** * * ** *  * ***    ** **  *   * * * 

CAN.SPE.        ACCCCGTCTCT
LYC.ES_L        ACCACCACTTT
                *** *  ** *

[Download ClustalW]

#261

Mean pairwise ID: 42.14%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
SCH.POM.        ------------------CGC-TGTAATGGC--TTGGTCGAAGTGTTTAGTACTCCCAAT
                                  *** **** *  *   *  ***    * * **  *     **

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
SCH.POM.        AGTGCATGTTCGGTGGTCTCGGGTTCGAGT-CTCGCTTTCGATCCCTCGATC-TGCCACG
                 *     ** * *  **   *** *   ** * *  *  *****    *  *   * * *

ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
SCH.POM.        TCTG---TTCGAAGAGTAGTCTTC--GTGGCAACTGGCAGTTAAACCGTGTA--------
                *  *   *    *  **   ** *  *  **    * *    *    *  **        

ORI.CUN.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
SCH.POM.        -GTACCGATGGAGGTTGGAAACAATGCACATCA---CTACCGGGTCT-TGGGCAGTGCGA
                 * ****    **** ******   ***  ***   ** *** *    *  * **** **

ORI.CUN.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGTCTCC
SCH.POM.        TAGCGA-TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACG-GTCGTT
                * ***  ** ** *  **   ***       *  ** *  ***   * * *  ***   

[Download ClustalW]

#262

Mean pairwise ID: 42.16%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTCTTGTTG
                         **       *** * *  **  *****       ***  *  *   * ***

LYC.ES_K        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT-CTGGCCTGCCCTGTCCAAGCACA
YAR.LI_B        TGCGTTC---GAGTTCTGGACTC--TGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCT
                 ** **    **    *** **   **  **  * * **    ** *** *** *   * 

LYC.ES_K        GAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGA
YAR.LI_B        GCGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAA
                * *   ***   * * * *      *   ** *****   **** *        *    *

LYC.ES_K        CCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGT-GCAGTGGA-AGGA
YAR.LI_B        CTG-----GGATACTTCAGTGGAGCAATC--CAGCAGAGATCCAGTTGCCGTGGGTATGG
                * *     ** *   *     ***** *   ****       * ** ** ****  * * 

LYC.ES_K        TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACC
YAR.LI_B        CGGTGGGATAGCA----ACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCA-CGACT
                   ****   *      *  ****    **     *    ***   * **** * * ** 

LYC.ES_K        ACCTTT
YAR.LI_B        CTC---
                  *   

[Download ClustalW]

#263

Mean pairwise ID: 42.16%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCAGTGTGGTGGAATGTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_C        AACATGCCCAGAAGGTAGGGCTTGTGTGACAATTCTCTGGCCTGCCCTGTCCAAGCAAAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     *** ******  ******   **

LYC.ES_C        AGTTGGGTC--TTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCCTAAAGTGGGGTGG
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAG-TTGGGCCTCACGGTCCATAATGTGGCAGGC
                   ***  *  *** ** * * ***** * ******  *  **  * *** ****   * 

LYC.ES_C        ACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGTGCAGTGGAAGGAT
TRI.AE_C        ACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGAT
                ** ************ *********** ***  *   ******     * **********

LYC.ES_C        AACGAGCCAGTGTCATATAAGTTCAACGAATGTCTGATGGGCTGTTCTAGTTAAACTACC
TRI.AE_C        AACGGGCCGCTGCACTCCTAGGCCG-CTTGGGCCTCGTAGCCTACTCCAGC--GACCACC
                **** ***  **   *   **  *  *    * **  * * **  ** **    ** ***

LYC.ES_C        ACATTT
TRI.AE_C        ATC---
                *     

[Download ClustalW]

#264

Mean pairwise ID: 42.16%


HUM.LU_C        GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTGGGT
LYC.ES_D        ------------------------------------------------------------
                                                                            

HUM.LU_C        CAACCCAGTGGTNCGGGNCCAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAAGCCGGGA
LYC.ES_D        -----------------------------TAGTT-CTGGCCTGCCCTGTCCAAGCACAGA
                                             *  ** *  * ******  *******   **

HUM.LU_C        GGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGC-ACTCCTAGACTGGAGGGCAAT
LYC.ES_D        GTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGACC
                *  **     * * **     ***       *   *   * ***** *  ** * * *  

HUM.LU_C        GCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGATAAC
LYC.ES_D        GCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAAT
                ** ********************** **  * **********  *************** 

HUM.LU_C        GGGCCGGTGCGCCTTGAG--CCAACACTGTTCAACTGGGCTGACTCTTAATAGGACCATT
LYC.ES_D        GGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAA-TGGGTTG--CTCCAACTAAACCACC
                *** *****     * *    **  *  *   ** **** **      **    ****  

HUM.LU_C        TCTTTT
LYC.ES_D        ACTTTT
                 *****

[Download ClustalW]

#265

Mean pairwise ID: 42.16%


TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTC----TT
                         ** **  *  ** * *   * ******      ****  *   *      *

TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGTTGC
YAR.LI_B        GTTGT-GCGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCT
                ***** *** *   *  **** **  *       ** **     * ** **** * **  

TRI.AE_A        GTAGTGGAC---CGCCTGGGGCTTATGCGAAAGCT--GGGTCTCACGGTCCATAATGTGG
YAR.LI_B        GCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT-TAA
                *  ** **    ** ** ** ** *       ***  * *  *  ** ** *  ** *  

TRI.AE_A        CAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCC-CGCTTCCAACGGTGG
YAR.LI_B        CTGGGATA-CTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGG
                * ** * * * * **    **    ***   **   **  ****  *  *    ******

TRI.AE_A        AAGGATAATGGGCCGCTGCACTCCTAGGCCA--ATTGGGCCTCGCAGCCTACTCCAGCAG
YAR.LI_B        GATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC--------
                 *    **      * *  *      **     *** *   ** *  *   *        

TRI.AE_A        ACCACC
YAR.LI_B        ------
                      

[Download ClustalW]

#266

Mean pairwise ID: 42.16%


TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTC----TT
                      ** ** **  *  ** * *   * ******      ****  *   *      *

TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGTTGC
YAR.LI_A        GTTGT-GCGTTCGAGTCTTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCT
                ***** *** *   * * *** **  *       *   * *   * ** **** * **  

TRI.AE_A        GTAGTGGAC---CGCCTGGGGCTTATGCGAAAGCT--GGGTCTCACGGTCCATAATGTGG
YAR.LI_A        GCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT-TAA
                *  ** **    ** ** ** ** *       ***  * *  *  ** ** *  ** *  

TRI.AE_A        CAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCC-CGCTTCCAACGGTGG
YAR.LI_A        CTGGGA-AACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGG
                * ** * * * * **    **    ***   **   **  ****  *  *    ******

TRI.AE_A        AAGGATAATGGGCCGCTGCAC-TCCTAGGCCA-ATTGGGCCTCGCAGCCTACTCCAGCAG
YAR.LI_A        GATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-----------
                 *    **      * *  *  *  * *   * ***     ** *               

TRI.AE_A        ACCACC
YAR.LI_A        ------
                      

[Download ClustalW]

#267

Mean pairwise ID: 42.16%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATGTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_F        GGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAGCACA
TRI.AE_C        ------------------------------------GGTGGTCTGCCCGTTCCAAGTTGA
                                                      *** ******  ******   *

LYC.ES_F        GAGTTGGGTCAAGTGG--TCTATACGAAAGTATAGCCACTTGGCCTTTAGAGTGGGATGG
TRI.AE_C        GTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGC
                *   ***  *   ***   **** *******   *** *  ** *  **  **** * * 

LYC.ES_F        ACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAAGGAT
TRI.AE_C        ACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGAT
                ** ************ *********** **** * * ******     * **********

LYC.ES_F        CACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCATC
TRI.AE_C        AACGGGCCGCTGCACTCCTAGGCC--GCTTGGGCCTCGTAGCCTACTCCAGCGA-CCACC
                 ******   *** **   ** **   *     ***  ***  * *   *   * *** *

LYC.ES_F        ACTTTT
TRI.AE_C        ATC---
                *     

[Download ClustalW]

#268

Mean pairwise ID: 42.17%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
YAR.LI_B        ------AGCTGTAATGGCATTTTGT---CGGAGTGGT-------AAATCGCCTTCTTGTT
                        *****  *  *  ****   * *** **        *  * *      *  *

ZEA.MA_D        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
YAR.LI_B        GTGCGTTCGAGTTCTGGACTCTG---CACTGGGCTACTTTG-TTGTCCTTTCCGAATTCT
                 **** * *  ****** * * *   * **  *   *****   * ***  ***      

ZEA.MA_D        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
YAR.LI_B        GCGGTTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                *  * *  ***  * *   * **         ******   * ***   *    * *  *

ZEA.MA_D        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATC-ACTCGCC-CGCTTCCAACGGTG
YAR.LI_B        TGGGATA-CTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTG
                 ** **  * * **  ***    *   ***** **** * * ***  *  *    *****

ZEA.MA_D        GGAGGATAACAGGCCGCTGCACTTC---GAGCCCAACTCAGGCCCAGAGCCTCACTAAGC
YAR.LI_B        GGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC-------
                ***    ****    * *  *  *    **    *  *     *  **  ***       

ZEA.MA_D        AGACCACCATCTT
YAR.LI_B        -------------
                             

[Download ClustalW]

#269

Mean pairwise ID: 42.18%


SCH.POM.        CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCG
LYC.ES_L        -----------------------GTTGGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTA
                                       ***  **   ****   *     ******* * **  

SCH.POM.        GGTTCGAGTCT-CGCTTTCGATCCCTCGATCTG--CCACGTCTGTTCGAAGAGTAGTCTT
LYC.ES_L        TAGTCTGGCCTGCCCTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTG
                   **  * ** * ** ** *  * * **  **   *****   ** *  **     ** 

SCH.POM.        CGTGGCAACTGGCAGTTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATC--
LYC.ES_L        GGTTGC--TTGATTCCTAAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGA
                 ** **   **     ****  * *  * ** *   **** ***   **  *  ** *  

SCH.POM.        ACTACCGG-GTCTTGGGCAGTGCGATAGCGATGGGATTCACCTTCGCAGG--------AT
LYC.ES_L        ACAGCTTCCGCTCTGTGCAGTGGAAGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAAC
                **  *    *   ** ******  *     * ***      **  **  *        * 

SCH.POM.        GTGC--ATGGAA-GTATAAACACAACGGTCGTT--
LYC.ES_L        GCCCTGATGGGCTGCTCCAACTAAACCACCACTTT
                *  *  ****   *    ***  ***   *  *  

[Download ClustalW]

#270

Mean pairwise ID: 42.19%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
                 *** *  * ** *** **** ***** ** ***    *  *    *  *   *    **

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
ZEA.MA_H        AATTGTGGT-GCATGTGCCTGGGTCTAGTGCTACAAACTG-TGGACCACCCATTCCAAGT
                  *** * *     ** *  ** *  ** *    *    * * *     ** * * ****

FUG.RUB.        TCGGTATCGATAT---GGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGG
ZEA.MA_H        TGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACA----CTAAAGTGG
                *  ***  *   *   * ***    * *  ***   * *** * *      **** * **

FUG.RUB.        GGTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGG
ZEA.MA_H        CGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCAC-CAGCGGTGG
                 *  *   *    ***  **   *  **     * *   ** *  *** * ***  ****

FUG.RUB.        GATCGCGCCCGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAGTCTT
ZEA.MA_H        AAGGA------TAATGAGTCGCTATGCTATAGGCCCAAT---------------------
                 *         * *  ** **** *  *  *  *  * *                     

FUG.RUB.        T
ZEA.MA_H        -
                 

[Download ClustalW]

#271

Mean pairwise ID: 42.19%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  * * *    *  * *

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
TRY.BR_B        CGGGGACGTCTTGGACAAGCGGGGGTT-CTGTTG-CGTTGACTTGGTGTTC-TGCTTGGT
                 * *   *     * *  * *   **   ***   *** ***   * ** * ***   * 

CAE.EL_B        GCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
TRY.BR_B        TGCGTGTCGGTGTTGAGGTCGCCA-CTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG
                   * ***      * * *  *   * * ***  * *  ** ** *    *** * * **

CAE.EL_B        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGGAC
TRY.BR_B        GGAACGGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGAAG
                 * * ** ***** * *  * * ***** * *   *   *** ** * * ** ** * * 

CAE.EL_B        TGCGCTTGTGAGT-TGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTTTT
TRY.BR_B        CACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT-----
                  * *    ***  *  ** *  *   *  **          *   ** *   **     

CAE.EL_B        T
TRY.BR_B        -
                 

[Download ClustalW]

#272

Mean pairwise ID: 42.21%


LYC.ES_E        GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCTTTCACCAGCTGAACAGGG
                          * * * * *   *******    * ***   **      *  *** *  *

LYC.ES_E        GGCTGTCCCAGATGGCT----GGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGT
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 ******       **     * *****  * * * *  *   **    * *  *   **

LYC.ES_E        ACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGT
LEP.COL.        GTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAGG
                   *        *  ***  **  *  * *    * **  *        ****** * * 

LYC.ES_E        GGACCCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGA
LEP.COL.        AACTGGGTCAGGCCGGCA--ACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTTGCAGAA
                      ** **** **    ** ***** *  *   *   * * *  *** ** * ** *

LYC.ES_E        TAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGTTCTAGTTAAACTAC
LEP.COL.        CCACACCGCGGAGCCTGTCA----TCACCTGCGCCC--CAGGCGATCCT-GTGAAGCTTT
                  **    *** ****  **     **     ***     ***  * ** ** ** **  

LYC.ES_E        CACATTTT
LEP.COL.        --------
                        

[Download ClustalW]

#273

Mean pairwise ID: 42.21%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTG-TGGCATAAACAATGTAGTTAGAATAGTCAG
SCH.POM.        ----------------------CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAA
                                      *   **  **** *   * * **  **** *    ** 

TET.ROS.        AGTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGAGTTGC
SCH.POM.        TA-GTGCATGTTCGGTGGTCTCGGGTTCGAGTCTCGCTTTCGATCCCT-CGATCTGCCAC
                    **   *** * **     *  * * *     *    ** ***   *  *  *   *

TET.ROS.        -TATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAGGAACCGCCT
SCH.POM.        GTCTGTTCGAAGAGTAGTCTTCGTG--GCAACTGGCAGTTAAACCG-TGTAGTACCGATG
                 * ** * ***   ****  * *     ** * **   *****  * **  * ****   

TET.ROS.        CAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATAACATACTC
SCH.POM.        GAGGTTGGAAACAATGCACATCA---CTACCGGGTCTTG-GGCAGTGCGATAGCGATGGG
                 *** *** ****   **    *    * ***  * *** **  *   **** *      

TET.ROS.        ATTAACTGTCAAGCTAATCGGTTCTGCTATTCTGATCA-GACACT----
SCH.POM.        ATTCACCTTC--GCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT
                *** **  **  **     *    **  * * * * **  **  *    

[Download ClustalW]

#274

Mean pairwise ID: 42.21%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

ARA.TH_E        GTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGTCCAAGCTG
TRI.AE_C        -------------------------------------GGTGGTCTGCCCGTTCCAAGTTG
                                                       *** ******  ****** **

ARA.TH_E        TG-AGTAAGACGTGTGTGTC--AAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAG
TRI.AE_C        AGTAGTGGACCGCTTGGGGCCTATGCGAAAG-TTGGGCCTCACGGTCCATAATGT-GGCA
                 * ***    **  ** * *  * ***** * ****  *  ****    *** ** **  

ARA.TH_E        GGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACG
TRI.AE_C        GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
                ** *  ************ **************** *** ******* ** * ***** *

ARA.TH_E        GATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACC
TRI.AE_C        GATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCG---ACC
                *** ** *      *     *    ** **  *****  * * *   **        ***

ARA.TH_E        ACCATTTT
TRI.AE_C        ACCATC--
                *****   

[Download ClustalW]

#275

Mean pairwise ID: 42.24%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC--
                    ***       * * *   ***** *   * **    ***    *    *   *   

LYC.ES_K        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRY.BR_A        GTCTTGGACAAGCGG--GGGTTCTGTTGCGTTGACTTGG---TGTTCTGCTTGGTTGCGT
                * ***   **   **  *** *  ** *  **   *  *   **  ***        *  

LYC.ES_K        AGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGAC
TRY.BR_A        GTCGGTGTTGAG-GTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGAA
                    *  *   * * * * * ** * * * * * *          ***** **** *** 

LYC.ES_K        CGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAA
TRY.BR_A        CGGGTCAGGCCGG--TGACGGAGCAGCC--CACCTTGCGCACGTTCCCGTTCGAGAAGCA
                **  * **** **  * ** ******    ** **  *** *  * * **   ** *  *

LYC.ES_K        TGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACC
TRY.BR_A        CACCGAGGAG-CATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG-------
                      ** * * * *** *     *  ****  * * ** *   * *            

LYC.ES_K        TTT
TRY.BR_A        ---
                   

[Download ClustalW]

#276

Mean pairwise ID: 42.30%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
YAR.LI_B        -------------AGCTGTAATGGCATTTT--GTCGGAGTGGTAAATCGCCTTCTTGTTG
                             *  **   * * *      ** **  ** ***   *      *****

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTGG---TGGGCTAATTTCTGACTTGCCCTATCCAAGCT
YAR.LI_B        TGC-GTTCGAGTT--CTGGACTCTGCACTGGGCTACTTTGT----TGTCCTTTCCGAATT
                 ** ** * ** *   *** **  *   ******* *** *    ** *** *** *  *

LYC.ES_N        TAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCG
YAR.LI_B        CTGCGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                  * * * ***   * * * *  *   ** *** * **    ****       *  *   

LYC.ES_N        GAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGAT
YAR.LI_B        AACTG-----GGATACTTCAGTGGAGCAAT--CCAGCAGAGATCCAGTTGCCGTGGGTAT
                 * **     ** *  **     ******     **    * ** *   *  *   * **

LYC.ES_N        AACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCA
YAR.LI_B        GGCGGTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC
                  **    * *     *  ***    **     **   ***   * **** *   * *  

LYC.ES_N        TTTTT
YAR.LI_B        -----
                     

[Download ClustalW]

#277

Mean pairwise ID: 42.30%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
YAR.LI_A        ----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTT
                                * *  *******   *  *  * ****    *    * *   * 

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
YAR.LI_A        G-TTGTGCGTTCGAGTCTTGGGCTCT---GCACTTGGCCATTTGGTTGTCCTTTCCGAAT
                * *** **    ****  ******     * ***  * *  * ** ***** * *  * *

FUG.RUB.        TCGGTA-TCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGG
YAR.LI_A        TCTGCGGTTGATG-GGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGAT
                ** *   * ***  ** *   * *   ***     *      ** *  **     * *  

FUG.RUB.        TGCCCCGG----CCCAGGTCGGAAACGAAGCAG-GTCAAAGCCCCCGTGCCGCTCAGTAG
YAR.LI_A        TAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGG-GTATGGCGG
                *  *  **      ***    * **   ***** *    **   *****  *    *  *

FUG.RUB.        TGGGATCGCGCCCGTG-AATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAG
YAR.LI_A        TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT--------
                *********  **  *   ** * * * * *   *   * *  * ***            

FUG.RUB.        TCTTT
YAR.LI_A        -----
                     

[Download ClustalW]

#278

Mean pairwise ID: 42.31%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
LYC.ES_L        ---------------------------------------------------------GTT
                                                                         * *

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
LYC.ES_L        GGGTTGACCCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCC---TGCCCTCTCCAAG
                 * ****  *     ***  *  * ****     **  * *  *   ** ** * * ***

RAT.RAT.        TTCGGCATCA-ATATGGTGACCTC-CCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LYC.ES_L        CATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATT-CCTAAAGTGG
                   **  *   **   *** * *   **  **    **    *  * ** ***** * **

RAT.RAT.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                **** ** *    ***  **    ** *****    * * ** ***  ***  **** * 

RAT.RAT.        GGGAT--CGCGCCTGTGAATAGCCACTGCACTCCA-GCC----TGGGCAACAT-AGCGAG
LYC.ES_L        AGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAA
                 ****  ** * * ***   *** * * ** *  * ***    *****  *   * * * 

RAT.RAT.        ACCCCGTCTCTT
LYC.ES_L        ACCACCACTTT-
                *** *  ** * 

[Download ClustalW]

#279

Mean pairwise ID: 42.33%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  *   *    *  * *

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
TRY.BR_A        CGGGGACGTCTTGGACAAGCGGGGGTTCT--GTTGCGTTGACTTGGTGTTC-TGCTTGGT
                 * * * *     * *  * *** *** *  *   **  ***   * ** * ***   * 

CAE.BRI.        GCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTGGT
TRY.BR_A        TGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGG
                   * ****     *   **    * * **   **** ** ** **   *** * * ** 

CAE.BRI.        GCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCCGGATA
TRY.BR_A        GAACGGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTCGAGAAGC
                * **** ***** * *  * * ***** * *   *   *** ** * * **    * *  

CAE.BRI.        GCGCTTGTGAGT-TGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTTGTCATT
TRY.BR_A        ACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG---------
                 * *    ***  * **         *  **    **    *   ** *           

[Download ClustalW]

#280

Mean pairwise ID: 42.35%


HUM.JA_A        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACTTTG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                     ** * *   ** * ** *** *  **  *    *   ** *  **  *    * *

HUM.JA_A        GGTCAGCCCATTGGATCGG-GTCCAGTGTTAGCTGC-TTGCTGGTCTGCCCATTCCAAGC
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
                 ** **   *   *  * * **     ***  *  * * *   *   * ** * ******

HUM.JA_A        CGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCCTAAAGAGGAGG
CAE.EL_C        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGGT
                   * **      * *    ***   ****   *      *   *  * *** ***  * 

HUM.JA_A        GCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGG
CAE.EL_C        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGG
                * *  *     * * *     *   *****  *  * *  **** *   *******  **

HUM.JA_A        ATAACGGGTCGGTGCTACTTGGGCCACCATGGTCACTGCATGCACTCTTAATCAGACCAT
CAE.EL_C        ACAGCGCTTGTGAGTTGACACGTATAC-ACAGCCTTCTCA-ATACCTTCAGACCACTTGT
                * * **  *  * * *     *   ** *  * *    **   **  * *  *      *

HUM.JA_A        CTCTTTT
CAE.EL_C        CACT---
                * **   

[Download ClustalW]

#281

Mean pairwise ID: 42.39%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGCT
LYC.ES_D        ------------------------------------------------------------
                                                                            

ZEA.MA_B        TTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCCCAAGTT
LYC.ES_D        ------------------------------TAGTTCT----GGCCTGCCCTGTCCAAGCA
                                              *   ***    *** *****   *****  

ZEA.MA_B        GGTAGT-GTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGGCAG
LYC.ES_D        CAGAGTAGGATCACGAGGCCCAAATGAAAA-TATGGGCTTCTTGATTCCTAAAGCGGGGC
                   *** *  * *** *** * *  ****  * ****  ***  *  **** *****   

ZEA.MA_B        GAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGTGGGAG
LYC.ES_D        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAG-CTCCCGCTCTGTGCAGTGGAAG
                * *  ** * ******************** ** **  * *** **     * **** **

ZEA.MA_B        GATAACAAGCCGCTGCACT-TTGAGCCCAACACAGACCCA-GATCCTCTCTTAGCAAACC
LYC.ES_D        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC
                *****   * ** **   * *  **  **  *  * *  * *     ***  *  *****

ZEA.MA_B        ACCATCTTT
LYC.ES_D        ACCACTTTT
                ****  ***

[Download ClustalW]

#282

Mean pairwise ID: 42.39%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGGGCATTAAGGTGGTGTGGATGTT
LYC.ES_D        ------------------------------------------------------------
                                                                            

ZEA.MA_F        TCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCCAAGT
LYC.ES_D        ----------------------------------TAGTT-CTGGCCTGCCCTGTCCAAGC
                                                   * *  * *********  ****** 

ZEA.MA_F        TGGTTGT-GGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGACCTGAAGCGGCAG
LYC.ES_D        ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGC
                     ** ** *   * *** *    ***    ***** **** *  *** ******   

ZEA.MA_F        GCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTGGGAG
LYC.ES_D        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCT-CCCGCTCTGTGCAGTGGAAG
                * *  ** ********************** ** **    ******     * **** **

ZEA.MA_F        GATAACAGGCCGCTGCATTG-CAAGCCCAACTCGGTCCA--GAGCCTCATTAAACAGACC
LYC.ES_D        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACC
                *****  ** ** **  **  ****  **     * * *  * *   *   **  * ***

ZEA.MA_F        ACCATCTTT
LYC.ES_D        ACCACTTTT
                ****  ***

[Download ClustalW]

#283

Mean pairwise ID: 42.43%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
LEP.COL.        -GCCGGAGCCTTG-----CTCTGTAACC----TTCGGGGGCTTTCACCAGCTGAACAGGG
                  * ***   ***      ******* *    *** * *   *      *  * *  *  

DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAGC
LEP.COL.        AGCTGTCTGGACCA---GCATAGGGTGCTTGCG-GCGTTGACGTGGTGCTC-TGCTTGGC
                 *  *   *** *    ** *** *  *  **    *******    *  *   **  **

DRO.MEL.        TTGCCATCAA-----TATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGA
LEP.COL.        TGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGG-GGCGCGCCCCCTCCGTTAAAG
                *     **       *  *******     * **   * ***   *    *   * *   

DRO.MEL.        GGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGT
LEP.COL.        TAGAGGAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACG-TCTGCCGTTGC
                  ** **** *** ****   * **   ******* *     * *  * *  ** ** * 

DRO.MEL.        GGGATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCACAAT
LEP.COL.        AGAACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT---
                 * *   *    *****        *     *  ****  ****   **    *      

DRO.MEL.        CTTT
LEP.COL.        ----
                    

[Download ClustalW]

#284

Mean pairwise ID: 42.43%


LYC.ES_O        GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGGGGAGG
                          * * *   *   *******   * **** *    ***    *       *

LYC.ES_O        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACAG
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCG
                   **  ****   *   *  *** ** * * *  *   **    * *  *   *    *

LYC.ES_O        AGTTGGATCATGTGGTCCAATTGAAAGAATGG-GCTACTAGATTCCTAAAGTGGGGTGGA
LEI.MAJ.        GTGTGGCT----TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGG-GAA
                   *** *    **  **  *  * **  *** **   *       * *** * ** * *

LYC.ES_O        CCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
LEI.MAJ.        CCGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAGAATC
                *** ** **** **    ** ***** *  *   *   * * *   ** ** * ** ** 

LYC.ES_O        ACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCA
LEI.MAJ.        ACACCGCGGAGCATGTC----CGCACTTGAGCCCCACGCTTCGTCGCGA---AGCCTT--
                **    *** ** *  *      ** *   ***  * *    *   * *   * **    

LYC.ES_O        CTTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#285

Mean pairwise ID: 42.43%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****       *** * *  **  *****       ***  *  *   * ***

LYC.ES_K        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT-CTGGCCTGCCCTGTCCAAGCACA
YAR.LI_A        TGCGTTC---GAGTCTTGGGCTC--TGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCT
                 ** **    **   *******   **  *** *    * *  ** *** *** *   * 

LYC.ES_K        GAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGA
YAR.LI_A        GCGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAA
                * *   ***   * * * *      *   ** *****   **** *        *    *

LYC.ES_K        CCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATA
YAR.LI_A        CTGGGAAACTTCAGTGGAGCAATCCAGCAGAGA--TCCAGTT----GCCGTGG--GTATG
                * *    *     *     **   ***   * *  *** * *    ** ****  * ** 

LYC.ES_K        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
YAR.LI_A        GCGG-TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCA-CGATT--
                  ** * **      * *****    **     *    * *   * * ** * * *    

LYC.ES_K        CTTT
YAR.LI_A        ----
                    

[Download ClustalW]

#286

Mean pairwise ID: 42.44%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
LYC.ES_L        -------------------------------------------------------GTTGG
                                                                       * * *

XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGG-TGTCCGCACTAAGT
LYC.ES_L        GTTGA-CCCAGATGGT-TGGGTT-CGGTAGGCT-TATAGTCTGGCCTGCCCTCTCCAAGC
                 ****  ****  * * **** * *  *  *** * * *   **  ** ** * * *** 

XEN.LAE.        TCGGTATCAA--TATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGG
LYC.ES_L        ATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATT--CCTAAAGTGG
                  **  *      * *  * *     *  ** *  ** *  *  * **   **** * **

XEN.LAE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGT
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                **** ** *    ***  **    ** *****    * * *  ***  * *  **** * 

XEN.LAE.        GGGAT--CGCGCCTGTGAATAGCCGGTGCAG--AACAGCCTGAACAACA----CAGCGAG
LYC.ES_L        AGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAA
                 ****  ** * * ***   ***  ** ***  ***  *****    *     ** * * 

XEN.LAE.        AC-ACAGTTCT
LYC.ES_L        ACCACCACTTT
                ** **   * *

[Download ClustalW]

#287

Mean pairwise ID: 42.47%


LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCAC-CAGCTGAACAGGGAGCTGTCTG
LYC.ES_M        --------------------CAAGTGGGGATGTTAAGGTGGTGGAATATTGGGCTGTC--
                                    *    ****   ** *    *  *** *  * ******  

LEP.COL.        GACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGAGGC
LYC.ES_M        --CCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTGTCCAAGCACAGAGTTG
                  ****      * *****  * * * *  *   **    * ** *   *    *     

LEP.COL.        CTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG-GAACTGGGT
LYC.ES_M        GATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGACCGCAT
                   *  * * ***     * **   * **  *        ****** * * * ** *  *

LEP.COL.        CAGGCCGGCA--ACGGAGCAGCCCAC--CTCGCGCACGTCTGCCGTTGCAGAACCACACC
LYC.ES_M        GAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTC-TGTGCAGTGGAAGGATAATGGG
                 **** ***   ** ******   **  *** *** * * *** ** * ** *  *    

LEP.COL.        GCGGAGCCT-GTCA---TCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT---------
LYC.ES_M        TCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCTTT
                 *** * **  ***   ***    ****  * * * * **   *               

[Download ClustalW]

#288

Mean pairwise ID: 42.47%


TRY.BR_B        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
LYC.ES_M        --------CAAGTGGGGATGTTAAGGTGGTGGAATATT--GGGCTGTCCCAGATGGCTGG
                        *   * *   *** *   * * **  *  *   *  *  *   ** * ** *

TRY.BR_B        GACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGTGTTGA
LYC.ES_M        GCTTGGTGGGCTAATTTCTGGCCTGCCCTGTCCAAGCACAGAGTTG------GATCACGA
                *    * ***     *  **   ** * **        *   ****      * *   **

TRY.BR_B        GGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGAACGGGTCAGGCCG
LYC.ES_M        GGCC-CAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGACCGCATGAGGCTG
                ** * * * ** * * * * * *          ********** *** **  * **** *

TRY.BR_B        G--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCACACCGAGG-AGCAT
LYC.ES_M        GCTTCACAGAGCAGTGAACAGCTCCCGC-TCTGTGCAGTGGAAGGATAATGGGTCGGTGT
                *  * ** ******   **    * * * *    *  *  **** * *  * *   *  *

TRY.BR_B        CTCAGGACTTT-----GCGCCCCAAGTGTCGTCGCGA--GGCGGTTT-----
LYC.ES_M        CTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCTTT
                ** *  *  **      ****  * * ** *   * *    *          

[Download ClustalW]

#289

Mean pairwise ID: 42.52%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  * ***    *  * *

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
TRY.BR_B        CGGGGACGTCTTGGACAAGCGGGGGTT-CTGTTG-CGTTGACTTGGTGTTC-TGCTTGGT
                 * *   *     * *  * *   **   ***   *** ***   * ** * ***   * 

CAE.EL_C        GCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
TRY.BR_B        TGCGTGTCGGTGTTGAGGTCGCCA-CTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG
                   * ***      * * *  *   * * ***  * *  ** ** *    *** * * **

CAE.EL_C        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGGAC
TRY.BR_B        GGAACGGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGAAG
                 * * ** ***** * *  * * ***** * *   *   *** ** * * ** ** * * 

CAE.EL_C        AGCGCTTGTGAGT-TGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTCAC
TRY.BR_B        CACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT-----
                  * *    ***  *  ** *  *   *  **          *   ** *   **     

CAE.EL_C        T
TRY.BR_B        -
                 

[Download ClustalW]

#290

Mean pairwise ID: 42.55%


LYC.ES_M        CAAGTGGGGATGTTAAGGTGGTGGAATATTGGGCTGTCCCAGATGGCTGGGCTTGGTGGG
SCH.POM.        --CGCTGTAATGGCTTGGT--CGAAGTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGT
                   *  *  ***    ***   * * * **  *   *****   *     * * ***** 

LYC.ES_M        CTAATTTCTGGCCTGCCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATA
SCH.POM.        CTCGGGTTCGAGTCTCGCTTTCGATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCT
                **    *  *     * ** ** *  *   **  **   *    *  * **  * *    

LYC.ES_M        TGG-GCTTCTTGATTCCTAAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTG
SCH.POM.        TCGTGGCAACTGGCAGTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACAT
                * * *     **     ****  * *  * ****   **** ***    ***  ***   

LYC.ES_M        AACAGCTCCCGCTCTGTGCAGTGGAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAA
SCH.POM.        CACTAC-CGGGTCTTGGGCAGTGCGATAGCGATGGG----------ATTCACCTTCGCAG
                 **  * *  *   ** ******  *     *****          **  *  *  * * 

LYC.ES_M        CGCCTAATGGGTTGCTCCAATAAACAACCACCTTT
SCH.POM.        GATGTGCATGGAAGTATAAAC--ACAACGGTCGTT
                    *    **  *    **   *****   * **

[Download ClustalW]

#291

Mean pairwise ID: 42.58%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCTTTCACCAGCTGAACAGGG
                          * * *  *  *** ****     *  ***  *   *   * *****   *

CIN.HYB.        AGCT--------TGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGT--
                ****          ** ***   * * *    ** ***   *  *   ***** * **  

CIN.HYB.        CAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAAT
LEP.COL.        -GTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCT--CCGTTAAAGT
                   ****   *        **   ***    *****  ** *     *   * *** * *

CIN.HYB.        CGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGT
LEP.COL.        AGAGGAAC--TGGGTCAGGCCGGCA--ACGGAGCAGCCCAC-CTCGCGCACGTCTGCCGT
                 * **  *  ** ** **** **    ** **** **  *  *     *   **  * **

CIN.HYB.        GGAAGGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGCCCAACAGG
LEP.COL.        TGCAGAACCACACCGCGGAGCCTGTCA---TCACCTG--CGCCCCAGGCGATCCTGTGAA
                 * ** *  ***   *****  * * *   ***  *   *  **  *     **      

CIN.HYB.        ACACCCATTT
LEP.COL.        GCTTT-----
                 *        

[Download ClustalW]

#292

Mean pairwise ID: 42.62%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAGTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***       *       *** ***   * ****   **   *    *       *

ARA.TH_D        GTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAGCTG
TRY.BR_A        TCTTGGACAAGCGGG--GGTTCTGTTGC-GTTGACTTGGTGTTCTGCTTGGTTGCG--TG
                  *        ****  **  *** *** *     *   **  ****   **      **

ARA.TH_D        TGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGAGGGT
TRY.BR_A        TCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG---TTAAAGT--GGGGGG
                *  **  *  *   *   * *  **  *     ***  ** *    ******  * *** 

ARA.TH_D        AATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGATGGAT
TRY.BR_A        AACGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAAG
                ** * ** **** ***   ** *******  * ** *  * *      * **    * * 

ARA.TH_D        CATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACCACC
TRY.BR_A        CACACCGAGGAGCATCTCAGG---ACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG-----
                ** *    * **  ******    *** **  ** *  **    ** *     *      

ARA.TH_D        ACTTT
TRY.BR_A        -----
                     

[Download ClustalW]

#293

Mean pairwise ID: 42.62%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTCTTGTTG
                         **   *   *** * *   *  * ***      ***   *      *****

LYC.ES_I        GGCTGTACCAGATGGTTGGGCTTGG---TGGGCTAATTTCTGACTTGCCCTATCCAAGCT
YAR.LI_B        TGC-GTTCGAGTT--CTGGACTCTGCACTGGGCTACTTTGT----TGTCCTTTCCGAATT
                 ** ** * ** *   *** **  *   ******* *** *    ** *** *** *  *

LYC.ES_I        TAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCG
YAR.LI_B        CTGCGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                  * * * ***   * * * *  *   ** *** * **    ****       *  *   

LYC.ES_I        GAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGAT
YAR.LI_B        AACTG-----GGATACTTCAGTGGAGCAAT--CCAGCAGAGATCCAGTTGCCGTGGGTAT
                 * **     ** *  **     ******     **    * ** *   *  *   * **

LYC.ES_I        AACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCA
YAR.LI_B        GGCGGTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC
                  **    * *     *  ***    **     **   ***   * **** *   * *  

LYC.ES_I        TTTTT
YAR.LI_B        -----
                     

[Download ClustalW]

#294

Mean pairwise ID: 42.63%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGGATGC
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     ********* 

ZEA.MA_C        TTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCC---TGCCCGTTCCA
CAE.EL_D        --AGTGAGAGGAGGAGTCCTGTGTATGTCGT-CGTCTACGTCGACCGAGCGTCCGTGCCA
                   **     *      **** **   * **  * **  ** * **    * **** ***

ZEA.MA_C        AGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTG
CAE.EL_D        AGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAG-TCCCGGGTGCATAAGGAG
                **      **  **   ***    **   * ****  *  * * **  *  * **  * *

ZEA.MA_C        GCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGG
CAE.EL_D        TCGTGGATGGTTCAGGAC------CGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAG
                 *  * * **     * *      *  *  * ***   **    ** *        *  *

ZEA.MA_C        AAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAG
CAE.EL_D        TGGCCGGACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCA
                  *    ** *  *     **      * *    *  ****   *   *   * *  *  

ZEA.MA_C        ACCACCATTTTT
CAE.EL_D        CTTATCATTT--
                   * *****  

[Download ClustalW]

#295

Mean pairwise ID: 42.67%


LYC.ES_O        GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCTTTCACCAGCTGAACAGGG
                          * * * * *   *******    * ***   **      *  *** *  *

LYC.ES_O        GGCTGTCCCAGATGGCT----GGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 ******       **     * *****  * * * *  *   **    * *  *   * 

LYC.ES_O        ACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGT
LEP.COL.        GTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG-
                   *        *  ***  **  *  * *    * **  *        ****** * * 

LYC.ES_O        GGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGG
LEP.COL.        GAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTTGCAGA
                * ** * ** **** **    ** ***** *  *   *   * * *  *** ** * ** 

LYC.ES_O        ATAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCA
LEP.COL.        ACCACACCGCGGAGCCTGTCA----TCACCTGCGCCCCA---GGCGATCCTGTGAAGCTT
                *  **    *** ****  **     **     ***  *   *  * ***  * ** *  

LYC.ES_O        CCACTTT
LEP.COL.        T------
                       

[Download ClustalW]

#296

Mean pairwise ID: 42.67%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

ARA.TH_F        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
LYC.ES_D        ---------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCAC
                                                 *  *****  ****** ********  

ARA.TH_F        TGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGG-CTTGCAGGTTCTAGAGTCGGAGGGT
LYC.ES_D        AGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGG
                 *****         *     *  ***    *** ***   * ***   *  *** * * 

ARA.TH_F        AATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGAT
LYC.ES_D        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
                *  ** ********************** **  *  *******    ******** ****

ARA.TH_F        CACGGTTTAGCGTCGC-TCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCAC
LYC.ES_D        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAAC-TAAACCAC
                 * ** *  * ***   ***    ** **  ****  ***   * **  *  * ******

ARA.TH_F        CATTTT-
LYC.ES_D        CACTTTT
                ** *** 

[Download ClustalW]

#297

Mean pairwise ID: 42.67%


TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
LYC.ES_D        ------------------------------------------------------------
                                                                            

TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGTTGC
LYC.ES_D        --------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACA
                                                ** * ****** ****  ******    

TRI.AE_A        GTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCACGGTCCATAATGTGGCAGG
LYC.ES_D        GAGTAGGATCAC--GAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCG
                *    *** * *  * ***  *   ****   ****  **  * * * *** * **   *

TRI.AE_A        CACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGA
LYC.ES_D        GACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA
                 ** ** ********************** **  *   ******     * *********

TRI.AE_A        TAATGGGCCGCTGCACTCCTAGGC-CAATTGGGCCTCGCAGCCTACTCCAGC-AGACCAC
LYC.ES_D        TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCAC
                ******* ** **   *   * *  ** *   ****    *  * ***** * * *****

TRI.AE_A        C------
LYC.ES_D        CACTTTT
                *      

[Download ClustalW]

#298

Mean pairwise ID: 42.67%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATGTTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTT--CGGGGGC--TGATCCCGCTTAGCG--G
                    ***       * * *   *******     ******    **   *   *  *  *

LYC.ES_F        GGTCCATCTTGATGGATGGG---CTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAGC
TRY.BR_A        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                ** *    * **     ***     **  * * * *  *  **  ****   **      

LYC.ES_F        ACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAGCCACTTGGCCTTTAGAGTGGGATG
TRY.BR_A        TCGGTGTTGAGGTCGCCA--CTGTAGAGAGGCGTTCTCGC---GCCGTTAAAGTGGGGGG
                 * * **** *         ** **   * *  *   * *   *** *** ******  *

LYC.ES_F        GACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAAGGA
TRY.BR_A        AACGG-GTCAGGCCGGT--GACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAA
                 ** * ** **** ***   ** ***** *  * *     *** *  * * **   ** *

LYC.ES_F        TCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCAT
TRY.BR_A        GCACACCGAGGAGCATCTCAGGACTTTGC----GCCCCAAGTGTCGTC--GCGAGGCGG-
                 ***      * **   *   * * *  *     **  *   ** * *     *  *   

LYC.ES_F        CACTTTT
TRY.BR_A        -------
                       

[Download ClustalW]

#299

Mean pairwise ID: 42.67%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGC
                             **    **   * *  *      **  ** ****** *****     

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
TRY.BR_A        GGGGACGTCTTGGACAAGCGGGGGTTC----TGTTGCGTTGACTTGGTGTTC-TGCTTGG
                 *      *   *     * *** * *     * *  *  **   ** ** *  ***  *

GAL.GAL.        GCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGGG
TRY.BR_A        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG
                    *  **  * * * *  * **   *    *****   *  *      *** * ****

GAL.GAL.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACGGGA
TRY.BR_A        GGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTCGAGAA
                 **** **  **** ***  *********  **   **  **  *    * **    * *

GAL.GAL.        TCGCGCCTGTGAATAGC-CACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCTGTCTCC
TRY.BR_A        GCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG-------
                 * * **   **  * * **   *   *   **   *   * * ***** *         

[Download ClustalW]

#300

Mean pairwise ID: 42.72%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGT-GGATG
LYC.ES_M        ------------------------CAAGTGGGGATGTTAA-GGTGGTGGAATATTGGGCT
                                          ***  *  * ** * *** *   * * * **   

CAE.EL_A        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAG
LYC.ES_M        GTCCCAGATGGCTGGGCTTG-GTGGGCTAATTTCTGGCCTGCCC---TGTCCAAGCACAG
                *    *** *    * * ** **  *    * ***     * **    ****  **  **

CAE.EL_A        CGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
LYC.ES_M        AGTTGGATCACGAGGCCCAAAT-----GAAAATATGGGCTTCTTGATTCCTAAAGTGGGG
                 * *   **** ***    **      ***         * *  * * * *** * *  *

CAE.EL_A        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCG
LYC.ES_M        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 ***  *     * * *     *   *****  ** ***  ****   *********  *

CAE.EL_A        GAC--CGCGCTTGTGAGTTGACACACATACGCA-GCCTTCTCGATACCTTCAG--ACCAC
LYC.ES_M        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAA
                **    * *   ***  **  **     *   * ****  * * *  ** **   * ** 

CAE.EL_A        TTATCATTT
LYC.ES_M        CCACCTTT-
                  * * ** 

[Download ClustalW]

#301

Mean pairwise ID: 42.72%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
TRY.BR_B        ------------AGCCGGAGCGCATTGCT----CTGTAACCTTCGGGGGCTGATCCCGCT
                            ***  ****   *  *     * *   * **  ** * **      **

ZEA.MA_E        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
TRY.BR_B        TAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTT--G
                * ***  * * *  *** *  * *   * * ***  * *** *  *     * *      

ZEA.MA_E        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGG
                ****   ** * **  *  * *   *  * *       **     *     * ****** 

ZEA.MA_E        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTTCCAACGGTGGG
TRY.BR_B        GGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGA
                 **** ** ** **** **  * ** *******   *  *   *   ****    *  * 

ZEA.MA_E        AGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAGACC
TRY.BR_B        AGCACACCGAGGAGC---ATCTCAGG---ACTTTGCGCCCCAAGTGTCGTCGCG-AGGCG
                ** * * ** *  **   *  **  *   *  *   ****  **  **     * ** * 

ZEA.MA_E        ACCATCTTT
TRY.BR_B        GTTT-----
                         

[Download ClustalW]

#302

Mean pairwise ID: 42.76%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_I        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     **   *****  ****** * **

LYC.ES_I        AGTTGGATCATGTGGC-CCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCA
                   **** *   ***  ** **   * *  *** *  *  * * * *** ****   * *

LYC.ES_I        ATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGT-TTCGCTCTAAGCGGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                  ************ *********** *** ** *   ****   * *************

LYC.ES_I        ACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCAT
TRI.AE_C        ACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGC--GACCACCAT
                *** * ** **  ***  ** **  *   ****  * *  * *****     ********

LYC.ES_I        TTTT
TRI.AE_C        C---
                    

[Download ClustalW]

#303

Mean pairwise ID: 42.76%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC--
                    ***       * * *   ***** *   * **    ***    *    *   *   

LYC.ES_J        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRY.BR_B        GTCTTGGACAAGCGG--GGGTTCTGTTGCGTTGACTTGG---TGTTCTGCTTGGTTGC-G
                * ***   **   **  *** *  ** *  **   *  *   **  ***        * *

LYC.ES_J        AGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGAC
TRY.BR_B        TGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGAA
                 ** **       * * * * ** * * * * * *          ********** *** 

LYC.ES_J        CGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGC-TCTGTGCAGTGGAAGGATA
TRY.BR_B        CGGGTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCACA
                **  * **** **  * ** ******   **    * * * *    *  *  **** * *

LYC.ES_J        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
TRY.BR_B        CCGAGG-AGCATCTCAGGACTTT-----GCGCCCCAAGTGTCGTCGCGA--GGCGGTTT-
                  * *   *  *** *  *  **      ****  * * ** *   * *    *      

LYC.ES_J        CTTT
TRY.BR_B        ----
                    

[Download ClustalW]

#304

Mean pairwise ID: 42.76%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_B        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     **   *****  ****** * **

LYC.ES_B        AGTTGGATCATGTGGC-CCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCA
                   **** *   ***  ** **   * *  *** *  *  * * * *** ****   * *

LYC.ES_B        ATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                  ************ *********** *** ** *  *****   * *************

LYC.ES_B        ACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAACCACCAC
TRI.AE_C        ACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGC--GACCACCAT
                *** * ** **  ***  ** **  *   ****  * * ** *** *     ******* 

LYC.ES_B        TTTT
TRI.AE_C        C---
                    

[Download ClustalW]

#305

Mean pairwise ID: 42.76%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     **   *****  ****** * **

LYC.ES_N        AGTTGGATCATGTGGC-CCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCA
                   **** *   ***  ** **   * *  *** *  *  * * * *** ****   * *

LYC.ES_N        ATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGT-TTCGCTCTAAGCGGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                  ************ *********** *** ** *   ****   * *************

LYC.ES_N        ACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCAT
TRI.AE_C        ACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGC--GACCACCAT
                *** * ** **  ***  ** **  *   ****  * *  * *****     ********

LYC.ES_N        TTTT
TRI.AE_C        C---
                    

[Download ClustalW]

#306

Mean pairwise ID: 42.77%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
LYC.ES_M        ---------------------------------CAAGTGGGGATGTTAAGGTGGTGGAAT
                                                 * * ****    * * * *** ***  

FUG.RUB.        GCTTGA--GCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAA
LYC.ES_M        ATTGGGCTGTCCCAGATGGCTGGGCTT-GGTGGGCTA-ATTTCTGGCCTGCCCTGTCCAA
                  * *   *  *  **   ********  * ** ***  *   * *  ** **   * **

FUG.RUB.        GTTCGGTATCGA--TATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAG
LYC.ES_M        GCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT--CCTAAAGTG
                *  * *  * *    * *  ** *    *  *    *** *       *  ***** * *

FUG.RUB.        GGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAG
LYC.ES_M        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
                *** *  ***    ***  **    **  *****   * *** ****  * *  **** *

FUG.RUB.        TGGGAT--CGCGCCCGTG----AATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGA
LYC.ES_M        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
                  ****   * * * ***    *  *    * ***   *    ** **  * *      *

FUG.RUB.        CT-CAGTCTTT
LYC.ES_M        CAACCACCTTT
                *  *   ****

[Download ClustalW]

#307

Mean pairwise ID: 42.81%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAGTG
LEI.MAJ.        -----GCCGG--AGCTCTGCTCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGGGGAGG
                     **     * *       *** ***   * ****  **  ***    *       *

ARA.TH_D        GTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAGCTG
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGG-TGCTCTGCTTGGCTGTGTGTC
                        *  ** *   **  ** ***    *  *   **  ****   *       * 

ARA.TH_D        TGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGAGGGT
LEI.MAJ.        GGTGTGGCTTGCCC---CCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGC--GAGGGA
                 * **    **       *  **  *** * *     * * *    * ***   ***** 

ARA.TH_D        AATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA-CAGCAGTGGATGGA
LEI.MAJ.        ACCGGGTCAGGCCGGAA--ACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCAGAA
                *  * ** **** **    ** *******  * **  * * *    * ** ** *  * *

ARA.TH_D        TCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACCAC
LEI.MAJ.        TCACACCGCGGAGCATGTCCG---CACTTGAGCCCCACGCTTCG-----TCGCGAAGCCT
                *** *   ** **  * ** *   ****   ****   * ****     **  * * *  

ARA.TH_D        CACTTT
LEI.MAJ.        T-----
                      

[Download ClustalW]

#308

Mean pairwise ID: 42.81%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTCTTGTTG
                         **       *** * *  **  *****       ***  *  *   * ***

LYC.ES_J        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT-CTGGCCTGCCCTGTCCAAGCACA
YAR.LI_B        TGCGTTC---GAGTTCTGGACTC--TGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCT
                 ** **    **    *** **   **  **  * * **    ** *** *** *   * 

LYC.ES_J        GAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGA
YAR.LI_B        GCGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAA
                * * * ***   * * * *      *   ** *****   **** *     *  *    *

LYC.ES_J        CCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGT-GCAGTGGA-AGGA
YAR.LI_B        CTG-----GGATACTTCAGTGGAGCAATC--CAGCAGAGATCCAGTTGCCGTGGGTATGG
                * *     ** *   *     ***** *   ****       * ** ** ****  * * 

LYC.ES_J        TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACC
YAR.LI_B        CGGTGGGATAGCA----ACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCA-CGACT
                   ****   *      *  ****    **     *    ***   * **** * * ** 

LYC.ES_J        ACCTTT
YAR.LI_B        CTC---
                  *   

[Download ClustalW]

#309

Mean pairwise ID: 42.86%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGG-GGACTATAAGATGGTGGAACACT
YAR.LI_A        -CTTAGC--TGTAATGGCATTTTGT---CGGAGTGGTAAATCGTCTTCTTGTTGTGCGTT
                    ***  ***** *  *  ****   *  *****   *   *    * ** *  *  *

ARA.TH_G        GGATCGGCCCACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAGCTG
YAR.LI_A        CGA--GTCTTGGGCTCTGCACTTG-----GCCATTTGGTTGTCCTTTCCGAATTCTGCGG
                 **  * *    *    * * ***     * ***  *  **  **  ** *     ** *

ARA.TH_G        TGAGTGAACCGTATGAACCAAGCGA--AGGTTTGATCCGTACGGTTGCTAAAGGTTGAGG
YAR.LI_A        TTGATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTT---CTAAGATTAACT
                *   **  *     *  *  **  *   * *****    * ** *     *** ** *  

ARA.TH_G        GTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACGG
YAR.LI_A        GGGAAACTTCAG--TGGAGCAATCCAGCAGAGA-----TCCAGTT----GCCGTGGGT--
                *     * * **  ***    *   ***** **     *** * *    ** ****    

ARA.TH_G        ACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAACC
YAR.LI_A        ATGGCGGTGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-
                *   ****  **   **  *** *    **** *  *   * *  * **   *  **   

ARA.TH_G        ACCATTTT
YAR.LI_A        --------
                        

[Download ClustalW]

#310

Mean pairwise ID: 42.90%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
LYC.ES_M        --------------------------------CAAGTGGGGATGTTAAGGTGGTGGAATA
                                                * * * **    **  * **  ***   

XEN.LAE.        CTTGA--GTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAG
LYC.ES_M        TTGGGCTGTCCCAGATGGCTGGGCT-TGGTGGGCTA-ATTTCTGGCCTGCCCTGTCCAAG
                 * *   ****  **   *******    ** ****  *   * *  ** **   * ***

XEN.LAE.        TTCGGTATCA-ATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGG
LYC.ES_M        CACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT--CCTAAAGTGG
                  * *  *   **   * *  **    * *     **    *  * **   **** * **

XEN.LAE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGT
LYC.ES_M        GGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGA
                ** * ****    ***  **    ** ******   * * * ****  * *  **** * 

XEN.LAE.        GGGAT--CGCGCCTGTGAATAGCCG-GTGCAGAACAGCCTGAACAAC-ACAGCGAGACAC
LYC.ES_M        AGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAAC
                 ****   * * * ***  *   *  ** *** *  **** *       *  * * * **

XEN.LAE.        AGTTCT----
LYC.ES_M        AACCACCTTT
                *         

[Download ClustalW]

#311

Mean pairwise ID: 42.90%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGG-ATC
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
                 *** ** **** *** **** ***** **        * *     *   *** *   **

XEN.LAE.        GCTTG-AGTCCAGGAGTTCTGGGCT-GCACTGAGCTATGTCGATCGGGTGTCCGCACTAA
ZEA.MA_H        AATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACC----ACCCATTCCAA
                  ***  ** ** * *    ** ** *  **      *** ** *      **   * **

XEN.LAE.        GTTCGGTATCAATAT---GGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGG
ZEA.MA_H        GTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAA-----CACTAAAG
                ***  ***      *   * **     * *  *** * * *** * *     * **** *

XEN.LAE.        AGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAG
ZEA.MA_H        TGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC-ACCAGCGG
                 ** *   *  *    ***  **   *  **     * *   ** *  *** * ***  *

XEN.LAE.        TGGGATCGCGCCTGTGAATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGT
ZEA.MA_H        TGGAAGGA------TAATGAGTCGCTATGCTATAGGCCCAAT------------------
                *** *         * *  ** ** *     * ** *  **                   

XEN.LAE.        TCT
ZEA.MA_H        ---
                   

[Download ClustalW]

#312

Mean pairwise ID: 42.90%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTT--CGGGGGCT----GATCCCGCTTAGCGG
                    ***       *       *******     **** **    ***   *     * *

ARA.TH_G        GATCGGCCC--ACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAGCT
TRY.BR_B        GGACGTCTTGGACAAGCGGGGGTT-CTGTTG-CGTTGACTTGG--TGTTCTGCTTG-GTT
                *  ** *    **  *  **  **  ***** * * *   ***  **  *       * *

ARA.TH_G        GTGAGTGAACCGTATGAAC-CAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAGG
TRY.BR_B        GCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAG--TGGGG
                * * **      *  *  * * *  * **    *     *   *  * *****  ** **

ARA.TH_G        GTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACGG
TRY.BR_B        GGAACGGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGA
                * *  * ** **** **  * ** *******  * ****  *** *    * ** *  * 

ARA.TH_G        ACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGC--TCGTAACCCGCTTGAA
TRY.BR_B        AGCACACCGAGGAGCATCTCAGGACT-TTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT--
                *  **     *  **  * **   *   *  *  **    *   ***  *  ** **   

ARA.TH_G        CCACCATTTT
TRY.BR_B        ----------
                          

[Download ClustalW]

#313

Mean pairwise ID: 42.91%


TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
YAR.LI_A        -----------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGT
                             ** ****      ** * *    *    *  *   * *  * * *  

TET.THE.        G-ATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATG-AGTT
YAR.LI_A        GCGTTCGAGTCTTGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTT
                *  *  ***  ** *      ** ** ** *   *  ** **  *** **   **  ***

TET.THE.        GCTATG-GTGGTAACCT-AGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAG-GAAAC
YAR.LI_A        GATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAA
                * *  * **      ** ****** **  *  *      * **  *    ***  *  * 

TET.THE.        GCCTCAGGCTGGCAACAGAACAGGGAAA-ACTTGCCGCTTGTTGTGGTGGAAGGATAACA
YAR.LI_A        ACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCG-TGGGTATGGCGGTGGGATCGCA
                 * ****    ****   * *** **   * ****** * * * *** **  ****  **

TET.THE.        TACTCATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT
YAR.LI_A        ACCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-------
                  *   *    * *   *   *     * *** ****            

[Download ClustalW]

#314

Mean pairwise ID: 42.95%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_K        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     *** ******  ******   **

LYC.ES_K        AGTAGGATCAC--GAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGG
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCACGGTCCATAATGTGGCAGGC
                    *** * *  * **** *   **** * ***** **  * * * *** * **   * 

LYC.ES_K        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
TRI.AE_C        ACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGAT
                ***** ********************** **  *   ******     * **********

LYC.ES_K        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCA
TRI.AE_C        AACGGGCCGCTGCACT-CCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCA-CCA
                ** *** ** **   *  * **  *  *   ****  * *  * *****   * ** ***

LYC.ES_K        CCTTT
TRI.AE_C        TC---
                 *   

[Download ClustalW]

#315

Mean pairwise ID: 42.95%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
SCH.POM.        ------------------CGC-TGTAATGGC--TTGGTCGAAGTGTTTAGTACTCCCAAT
                                  *** **** *  *   *  ***    * * **        **

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
SCH.POM.        AGTGCATGTTCGGTGGTCTCGGGTTCGAGT-CTCGCTTTCGATCCCTCGATC-TGCCACG
                 *     ** * *  **   *** *  *** * *  *  *****    *  *   * * *

RAT.NOR.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
SCH.POM.        TCTG---TTCGAAGAGTAGTCTTC--GTGGCAACTGGCAGTTAAACCGTGTA--------
                *  *   *    *  **   ** *  *  **    * *    *    *  **        

RAT.NOR.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
SCH.POM.        -GTACCGATGGAGGTTGGAAACAATGCACATCA---CTACCG-GGTCTTGGGCAGTGCGA
                 * ****    **** ******   ***  ***   ** *** * *  *  * **** **

RAT.NOR.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGTCTCT
SCH.POM.        TAGCGA-TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACGGTCGTT
                * ***  ** ** *  **   ***       *  ** *  ***   * * * ***  *

[Download ClustalW]

#316

Mean pairwise ID: 42.95%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
TRY.BR_B        ---------------AGC--CGGAGCGCATTGCTCTGTAACCTTCGGGGGCTG-ATCCCG
                               ***  * *    **    ***** *  *  *   *  * **  * 

DRO.MEL.        TGAGGCTGGGATCTACTGCGTA---GCGGACCAGCTCATGTTGACGGAACGTCCGCACTA
TRY.BR_B        CTTAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTG
                    ** ****  *  **   *   * **      *   ******     ** *    * 

DRO.MEL.        A--GCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT-TGGCTAAGG
TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAG----AGGCGTTCTCGCGCCGTTAAAG
                   ** ** *     *  **  ****  *  ***     *** ***  *    * *** *

DRO.MEL.        AGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
TRY.BR_B        TGGGGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCACCTTGCGCACGTTC--CCGTTG
                 ***  **** *** ****   *  *   ******* *   * * *  * *   * ** *

DRO.MEL.        TGGGATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCACAA
TRY.BR_B        CAGAA--GCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
                  * *  **  ****  * * *   * *   *  ** *  *   * * ** *     *  

DRO.MEL.        TCTTT
TRY.BR_B        TTT--
                * *  

[Download ClustalW]

#317

Mean pairwise ID: 42.95%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAGTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***       *       *** ***   * ****   **   *    *       *

ARA.TH_D        GTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAGCTG
TRY.BR_B        TCTTGGACAAGCGGG--GGTTCTGTTGC-GTTGACTTGGTGTTCTGCTTGGTTGCG--TG
                  *        ****  **  *** *** *     *   **  ****   **      **

ARA.TH_D        TGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGAGGGT
TRY.BR_B        TCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG---TTAAAGT--GGGGGG
                *  **  *  *   *   * *  **  *     ***  ** *    ******  * *** 

ARA.TH_D        AATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGATGGAT
TRY.BR_B        AACGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGAAG
                ** * ** **** ***   ** *******  * ** *  * *      * ** *  * * 

ARA.TH_D        CATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACCACC
TRY.BR_B        CACACCGAGGAGCATCTCAGG---ACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT--
                ** *    * **  ******    *** **  ** *  **    ** *     *      

ARA.TH_D        ACTTT
TRY.BR_B        -----
                     

[Download ClustalW]

#318

Mean pairwise ID: 42.95%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCC-CAGCTACTCGGGAGGCTGAGGCAGGAGGA
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                       ** *  **      *****  *  * *   **             ****  * 

CAN.SPE.        TCGCTTGA---GCCCAGGAGTTCTG-GGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCA
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTG--
                *  ** **   **  ***     ** ***      * * *   * * * ** ***  *  

CAN.SPE.        CTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LEP.COL.        ------TCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGT
                      ****   *     **** ** *  *     ****  *  **     *   *** 

CAN.SPE.        AGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
LEP.COL.        AGAG--GAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCC-GTTG
                ** *  **** **  **** *** **********  **   * * *  *     * ** *

CAN.SPE.        TGGGATCGCGCCTGTGAATA-GCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCG
LEP.COL.        CAGAACCACACCGCGGAGCCTGTCATCAC-CTGCGCCCCAGGCGATCCTGTGAAGCTTT-
                  * * * * **   **    * **   * ** *  **   ** *    * **  *    

CAN.SPE.        TCTCT
LEP.COL.        -----
                     

[Download ClustalW]

#319

Mean pairwise ID: 42.96%


LYC.ES_M        --------CAAGTGGGGATGTTAAGGTGGTGGAATATTG--GGCTGTCCCAGATGGCTGG
TRY.BR_A        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
                        *   * *   *** *   * * **  *  *   *  *  *   ** * ** *

LYC.ES_M        GCTTGGTGGGCTAATTTCTGGCCTGCCCTGTCCAAGCACAGAGTTG------GATCACGA
TRY.BR_A        GACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGTGTTGA
                *    * ***     *  **   ** * **        *   ****      * *   **

LYC.ES_M        GGCC-CAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGACCGCATGAGGCTG
TRY.BR_A        GGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGAACGGGTCAGGCCG
                ** * * * ** * * * * * *          ********** *** **  * **** *

LYC.ES_M        GCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATGGGTCGGTGTC
TRY.BR_A        G--TGACGGAGCAGCC--CACCTTGCGCACGTTCCCGTTCGAGAAGCACACCGAGGAG-C
                *  * ** ******    ** **  *** *  * * **   ** *  *      ** * *

LYC.ES_M        TTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCTTT
TRY.BR_A        ATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG----------
                 * *** *     *  ****  * * ** *   * *               

[Download ClustalW]

#320

Mean pairwise ID: 43.00%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCT--TCGGGGGC--TGATCCCGCTTAGCG--G
                    ***         * *   *******     ******  * **   *   *  *  *

LYC.ES_B        GGCTGTACCAGATGGTTGGG---CTTGGTGGGCTAATTTC-TGACTTGCCCTATCCAAGC
TRY.BR_A        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                **  **    **     ***     ** ** * * * **  **   ***    *      

LYC.ES_B        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
TRY.BR_A        TCGGTGTTGAG----GTCGCC--ACTGTAGAGA-GGCGTTCTCGCGCCGTTAAAGTGGGG
                *  * ****      ** ***  * ** *** * **  * ** *   *** **   *** 

LYC.ES_B        GGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTGGAAGG
TRY.BR_A        GGAACGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGA
                **** * ** **** ***   ** ***** *    *  ** *** *    * **   ** 

LYC.ES_B        ATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAACCAC
TRY.BR_A        AGCACACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG----
                *  **     ** *        * *   *   ***  * * *  *     *         

LYC.ES_B        CACTTTT
TRY.BR_A        -------
                       

[Download ClustalW]

#321

Mean pairwise ID: 43.00%


CAE.EL_C        ------ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACG-GTAGATGAGTG
YAR.LI_B        AGCTGTAATG-GCATTTTGTCGGA--GTGGTAAATCGCCTTCTTGTTGTGCGTTCGAGTT
                      *  * ** *  ** ***    * ** * **  *******  * *     **** 

CAE.EL_C        TGGATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGT
YAR.LI_B        C---TGGACTCTGCACTGGGCTACTTTGT-TGTCCTTTCCGAATTCTGCGG-------TT
                    **** *  *    **  * ** *** **** **  * *  **  * *        *

CAE.EL_C        GCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG
YAR.LI_B        GATGGGCGTCTCGGTCTGAGTAATCGGCTTT---GAGATTTCCGTTCTAAGATTAACTGG
                *    ***   **     **     * ** *    ****   *  **   * *  *   *

CAE.EL_C        GAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAA-AGCCACCGCGCGGTGCAGTG
YAR.LI_B        GA--------TACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTG-GGTATGGCG
                **        *  *****    * **   ****** *   **   *** * ***   * *

CAE.EL_C        GCCGGACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACT
YAR.LI_B        GTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC----
                *  *** ***      * * *      ***  *  *  **  ****  *  *   *    

CAE.EL_C        TGTCACT
YAR.LI_B        -------
                       

[Download ClustalW]

#322

Mean pairwise ID: 43.01%


TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGA--TAGAT
LEP.COL.        GCCGGAGCCTTGCT--CTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCT
                *** * *      *  ****  *  *  * *** *  ** *  *     * **  *   *

TET.THE.        AGGATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGAGTT
LEP.COL.        GGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGAGG
                 *   *  * **  ** *      ***  *   * *     *    *        *    

TET.THE.        GCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAGGAAACGCC
LEP.COL.        CCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAA-AGTAGAGGAACTGGG
                 **  **  *   *** * *  ***    * **    *  * ** **   *****  *  

TET.THE.        TCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGT-TGTGGTGGAAGGATAACATAC
LEP.COL.        TCAGGCCGGCAACGGAGCAGCCC--ACCTCGCGCACGTCTGCCGTTGCAGAACCACAC-C
                ****** ****** ** ***     ** *  ***  ** **  ** * ** *  ***  *

TET.THE.        TCATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT
LEP.COL.        GCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT
                 *     ******       **   *          *  *  * **

[Download ClustalW]

#323

Mean pairwise ID: 43.04%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                  ** *    **  ** * ** *** *  **  *          ***     *   *  *

ARA.TH_G        GATCGGCCCACGGGTCGGATT--TGTTGTTGGCATAGGTC-TGGACTGCCCAATCCAAGC
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
                  *      * * ***   *   ****** ****  **     **  * **   ******

ARA.TH_G        TGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAGG
CAE.BRI.        GCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTGGT
                  ** **   * *      **   ** * *  **       ***  **  ****    * 

ARA.TH_G        GTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACGG
CAE.BRI.        GCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCCGG
                * *  **    *** *     *   *****  *  * *  **** *   ******* ***

ARA.TH_G        ACAACGGTTCGACGCCA-CACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAAC
CAE.BRI.        ATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTTG--T
                * * ** **    *    * *    ****       *     *    *  ** ****   

ARA.TH_G        CACCATTTT
CAE.BRI.        CATT-----
                **       

[Download ClustalW]

#324

Mean pairwise ID: 43.05%


HUM.JA_A        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACTTTGGGTC
LYC.ES_D        ------------------------------------------------------------
                                                                            

HUM.JA_A        AGCCCATTGGATCGGGTCCAGTGTTAGCTGCTTGCTGGTCTGCCCATTCCAAGCCGAGAG
LYC.ES_D        ----------------------------TAGTT-CTGGCCTGCCCTGTCCAAGCACAGAG
                                            *  ** **** ******  *******  ****

HUM.JA_A        TTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCCTAAAGAGGAGGGCAATG
LYC.ES_D        TAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGACCG
                * **     * *  *     ***     ***   *     ******** ** * * *  *

HUM.JA_A        CGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGGATAACG
LYC.ES_D        CATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATG
                * ********* ************ ** ** **********  *************** *

HUM.JA_A        GGTCGGTGCTACTTGGGCCACCATGGTCACTG-CATGCACTCTTAATCAGACCATCTCTT
LYC.ES_D        GGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCACCACTT
                ********     *      *  *     **     *       **  * **** * ***

HUM.JA_A        TT
LYC.ES_D        TT
                **

[Download ClustalW]

#325

Mean pairwise ID: 43.09%


HUM.LU_C        GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTGGGT
TRY.BR_A        AGCCGGAGCGCATTGCTC-TGTAACCT--TCGGGGGCTGATCCCGCTTAGCG----GGGA
                 * *  ***   *** ** *******     ******   *      * *      *** 

HUM.LU_C        CAACCCAGTGGTNCGGGNCCAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAAGCCGGGA
TRY.BR_A        CGTCTTGGACAAGCGGGGGTTCTGTTG--CGTTGACTTGGTGTTCTGCTT--GGTTGCGT
                *  *   *     ****     ** *    * * **  **    *   *    *  * * 

HUM.LU_C        GGTGG-GCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACTCCTAGACTGGAGGGCAAT
TRY.BR_A        GTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGG-AAC
                *  ** * *****   *      *  *         *** *   ** * *** *** ** 

HUM.LU_C        GCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGATAAC
TRY.BR_A        GGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAAGCAC
                * ** **** **  * ** *******  * ****  *** *    * **   ** *  **

HUM.LU_C        GGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGACCATTTC
TRY.BR_A        ACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTG--TCGTCGCGAGGCGG---------
                     ** **  **   * *    *    *** **    * * *      *         

HUM.LU_C        TTTT
TRY.BR_A        ----
                    

[Download ClustalW]

#326

Mean pairwise ID: 43.09%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                   *  * * *   *  *  * *** *  **  *    *   ** *   *  *    * *

HUM.LU_C        GGTCAACCCAGTGGTNCGGGNCCAGT-GCTAGCTGC-TTACCCGGCTGCCCATTCCAAGC
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
                 ** *    **  ** * *     ** * *  *  * *   ***   * ** * ******

HUM.LU_C        CGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACTCCTAGACTGGAGGG
CAE.EL_C        GCTGCGTCA--CCAGGGGA--TGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAG
                   * *     *   ****  **   *  **     **   *  *     *  *   * *

HUM.LU_C        CAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAG
CAE.EL_C        TGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCG
                   **  **   * **    * **  *****  *  * *  **** *   *******  *

HUM.LU_C        GATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGAC
CAE.EL_C        GACAGC--GCTTGTGAG--TTGA--CACGTATACACAGCCTTCTCAATACCT--TCAGAC
                ** * *  **  *** *  ****  **    *   ** *       *  * *  *  ***

HUM.LU_C        CATTTCTTTT-
CAE.EL_C        CACTTGTCACT
                ** ** *    

[Download ClustalW]

#327

Mean pairwise ID: 43.09%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****       *** * *  **  *****       ***  *  *   * ***

LYC.ES_J        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT-CTGGCCTGCCCTGTCCAAGCACA
YAR.LI_A        TGCGTTC---GAGTCTTGGGCTC--TGCACTTGGCCATTTGGTTGTCCTTTCCGAATTCT
                 ** **    **   *******   **  *** *    * *  ** *** *** *   * 

LYC.ES_J        GAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGA
YAR.LI_A        GCGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAA
                * * * ***   * * * *      *   ** *****   **** *     *  *    *

LYC.ES_J        CCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATA
YAR.LI_A        CTGGGAAACTTCAGTGGAGCAATCCAGCAGAGA--TCCAGTT----GCCGTGG--GTATG
                * *    *     *     **   ***   * *  *** * *    ** ****  * ** 

LYC.ES_J        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
YAR.LI_A        GCGG-TGGGATCGCAACCAAGTGGTATATGTTATGGAAGATATTTACGATCA-CGATT--
                  ** * **      * *****    **     *    * *   * * ** * * *    

LYC.ES_J        CTTT
YAR.LI_A        ----
                    

[Download ClustalW]

#328

Mean pairwise ID: 43.09%


LYC.ES_J        ---GTCGAGCTTAGTAACGTGGGC--TTGTAATCCAAGTGGA---GACATCAAAGTGGTT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                       ** ** * * * *  *   *     * *     *    **        ***  

LYC.ES_J        GAATATTGGGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCC
DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGC-GGACCAGCTCATGTTGAC---GGAACGTCCGCACT
                  *   **** * ***      *  ** *  * *    **      **   * **   * 

LYC.ES_J        AAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTG
DRO.MEL.        AAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAG
                ****      *        * * *    * **     ***  ***  * *  **** * *

LYC.ES_J        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
DRO.MEL.        GGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
                **  * ****    ***  **    *   *****  ** ** *****   *  ***** *

LYC.ES_J        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
DRO.MEL.        TGGGATAGCGTACCGGAGTGGACTGCCGTT--ATCAGCCCAACCGATATGGT----TGGA
                  *****  *   *** **    *   ***   * *  ** *  *   ** *    *  *

LYC.ES_J        CAACCACCTTT
DRO.MEL.        CCACAATCTTT
                * ** * ****

[Download ClustalW]

#329

Mean pairwise ID: 43.09%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGT--CTGATTGTGGGATGG
YAR.LI_B        ------------------AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTG
                                    *******  *  **    *  **     ** *     * *

DRO.MEL.        CCTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAA
YAR.LI_B        TTGTGCGTTCGAGTT--CTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCT
                      * * *  *   ***      * **  *   *  ***  *     **** * *  

DRO.MEL.        GC--TTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAG
YAR.LI_B        GCGGTTGATGGGCGTCTCGGT-CTGAGTAATCGGCTTTGAGATTTCCGTT--CTAAGATT
                **  ***       * * *** *   * *   * *  **  ***   ***  *****   

DRO.MEL.        GGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAG-AGTTCCCGTGGTAGGCAGTAGT
YAR.LI_B        AACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGG-GTATGGCGGT
                   **        *** ** * ** *******  *   **** ******      *  **

DRO.MEL.        GGGATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCACAAT
YAR.LI_B        GGGATAGC--AACAAAGTGGTATAT-GTTATGGAA------GGTATT-TGCAATCACGAC
                ********  * *  *****  *   *****          * ***  *   * *** * 

DRO.MEL.        CTTT
YAR.LI_B        TCTC
                  * 

[Download ClustalW]

#330

Mean pairwise ID: 43.09%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
LYC.ES_L        ---------------------------------------------------------GTT
                                                                         * *

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
LYC.ES_L        GGGTTGA-CCCAGATGGT-TGGGTT-CGGTAGGCTTATAGTCTGGCCTGCCCTCTCCAAG
                 * **** *****  * * **** *   **  ***       ***  ** ** * * ***

HOM.SA_B        TTCGGCATCA-ATATGGTGACCTC-CCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LYC.ES_L        CATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATT-CCTAAAGTGG
                   **  *   **   *** * *   **  **    **    *  * ** ***** * **

HOM.SA_B        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                **** ** *    ***  **    ** *****    * * ** ***  ***  **** * 

HOM.SA_B        GGGAT--CGCGCCTGTGAATAGCCACTGCACTC--CAGCCTGAGCAACA----TAGCGAG
LYC.ES_L        AGGATAACGGGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAA
                 ****  ** * * ***   *** * * ** *   *  *****    *      * * * 

HOM.SA_B        ACCCCGTCTCT
LYC.ES_L        ACCACCACTTT
                *** *  ** *

[Download ClustalW]

#331

Mean pairwise ID: 43.09%


LYC.ES_A        ---GGCGAGCTTAGTAACGTGGGC--TTGTAATCCAAGTGGA---GACATCAAAGTGGTT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                    *  ** ** * * * *  *   *     * *     *    **        ***  

LYC.ES_A        GAATATTGGGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCC
DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGC-GGACCAGCTCATGTTGAC---GGAACGTCCGCACT
                  *   **** * ***      *  ** *  * *    **      **   * **   * 

LYC.ES_A        AAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTG
DRO.MEL.        AAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAG
                ****      *        * * *    * **     ***  ***  * *  **** * *

LYC.ES_A        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAAC-GCTCCCGCTCTGTGCAGTGG
DRO.MEL.        GGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
                **  * ****    ***  **    *   *****  **  * *****   *  ***** *

LYC.ES_A        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
DRO.MEL.        TGGGATAGCGTACCGGAGTGGACTGCCGTT--ATCAGCCCAACCGATATGGT----TGGA
                  *****  *   *** **    *   ***   * *  ** *  *   ** *    *  *

LYC.ES_A        CAACCACCTTT
DRO.MEL.        CCACAATCTTT
                * ** * ****

[Download ClustalW]

#332

Mean pairwise ID: 43.13%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGG-GGCAATAAGGTGGTGTTGGATG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** ***   ****** *  *        * *  **     **** *   *

ORY.SA_B        CCTGGTCGTTTGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTCC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGT---CGTCGTCTACGTCG-ACCGAGCGTCCGTGCC
                  **   *   * *    * ** **     ** ** * *      * *  ** **** **

ORY.SA_B        AAGTTGCGTAGCGTGTGTGGGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCACCTAGAGT
CAE.EL_D        AAGCGCTACGTCAC-CAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                ***        *      ***    ***   ******        **  *  * **  * 

ORY.SA_B        GGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCCAACGGTG
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                * ** * ** *     * * *     *   *****  *  * ** **** *    * ***

ORY.SA_B        GAAGGATAACGGGCCGCTGCAGCCCTG-GCCCGCTTCCGGCCCAAGTGCCTTCCATGGCA
CAE.EL_D        GCCGGACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGA-TACCTTC--AGACC
                *  ***   **       *  * *       * *  **  * * * * *****   * * 

ORY.SA_B        GACCACCACCTTT
CAE.EL_D        ACTTATCATTT--
                    * **  *  

[Download ClustalW]

#333

Mean pairwise ID: 43.14%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAG-GCTGAGGCTGGCGGAT
SCH.POM.        -------------------CGCTGTAAT--GGCTTGGTCGAAGTGTTTAGTACTCCCAAT
                                     *******      *  * * ** * * **     *  **

FUG.RUB.        CGCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAG
SCH.POM.        AGTGCATGTTCGGTGGTCTCGGGTTCGAGTCT-CGCTTTCGATCCCTCGATC-TGCCACG
                 *     * ** *  **   *** *  **    *  * ******    *  * * * * *

FUG.RUB.        TTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGG
SCH.POM.        TCTGTT--CGA-AGAGTAGTCTTCGTGGCAACTGGCA--GTTAAACCGTGTA--------
                *  * *  *** *  **  ** * * **   * ** *     *   **  **        

FUG.RUB.        TGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGGA
SCH.POM.        -GTACCGATGGAGGTTGGAAACAATGCACATCA---CTACCGGGTC-TTGGGCAGTGCGA
                 *  ***    **** ****** * ***  ***   *  *** * *  *  * **** **

FUG.RUB.        TCGCGCCCGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAGTCTTT
SCH.POM.        TAGCGAT-GGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAA-CGGTCGTT
                * ***   * ** *   *   * **      *   * *  * *     *  * *** **

[Download ClustalW]

#334

Mean pairwise ID: 43.14%


HUM.LU_C        GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTGGGT
TRI.AE_C        ------------------------------------------------------------
                                                                            

HUM.LU_C        CAACCCAGTGGTNCGGGNCCAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAAGCCGGGA
TRI.AE_C        ----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAGT
                                                      * ****** *******  * * 

HUM.LU_C        GGTGGGCTGA--GGGACCTGGGCGAAGGCTNNNGGNGCGCACTCC-TAGACTGGAGGGCA
TRI.AE_C        AGTGGACCGCTTGGGGCCTATGCGAAAG-TTGGGCCTCACGGTCCATAATGTGGCAGGCA
                 **** * *   *** ***  ***** * *   *   * *  *** **   ***  ****

HUM.LU_C        ATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                  ***************************** **  ******  *  * ***********

HUM.LU_C        ACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGACCATT
TRI.AE_C        ACGGGCCGCTGCACTCCTAGGCCGC-TTGGGCCTCGTAGCCTACTCCAGCGACCACCATC
                ******** *** *    ** *  *  **  *  *   **  ****     *  ***** 

HUM.LU_C        TCTTTT
TRI.AE_C        ------
                      

[Download ClustalW]

#335

Mean pairwise ID: 43.17%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGAATGC
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     ***** *** 

ZEA.MA_A        TTTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCT---TGCCCATCC
CAE.EL_D        AGTGAGAGGAG-----GAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGC
                  ** ** *       * * **** *   ** **       * ** *     * ** * *

ZEA.MA_A        CAAGT-TGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGA
CAE.EL_D        CAAGCGCTACGTCACCAGGGGATAACTGTCG-GAAGGCGGTTAGTCCCGGGTG-CATAAG
                ****           * ** *    ** * * *** **  *  *** * *  * * *   

ZEA.MA_A        GCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGG
CAE.EL_D        GAGTCGTGGATGGTTCAGGACCGA------AAGGTAGCAGACAAAAGCGACCGCGTGGTG
                * * *  * ****   * * * *       *  * ***   **    ****  *     *

ZEA.MA_A        TGGGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCT-CAGAACCTCACTAAG
CAE.EL_D        CAGTGGCCGGACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGA
                  *  *    **   **   *    *   *  *  ** *** ** *   *   *   *  

ZEA.MA_A        CAAACCACCATCTTT
CAE.EL_D        CCACTTATCATTT--
                * *   * *** *  

[Download ClustalW]

#336

Mean pairwise ID: 43.18%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATG-TGGGGACATTTAGATGGTGGAACACT
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
                * ** *    **  *  * ** ***** *** * *   *  *    ** * ***   *  

ARA.TH_E        GGTTCGGGTCCACGGGCCGGTTCTGTTGTTGGC-ATGTTTCTGGGCTGCCCAGTCCAAGC
FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
                * **  * **    *  * *  **   *  * * ****   * ** ** **   * *** 

ARA.TH_E        TGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAGG
FUG.RUB.        TCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGGT
                *  *  *       ***   *  * * ** *  ** ***   **   *  ***  ** * 

ARA.TH_E        GTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGG
FUG.RUB.        GCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGG
                *    *    ***  **    **  *****     *   ****       **** *  **

ARA.TH_E        ATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTG-CTGGTCCGATCTCATATGAACC
FUG.RUB.        ATCGCGCC-------CGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTC
                *** *          **   * *  * ** * *     *  *    *        **  *

ARA.TH_E        ACCATTTT
FUG.RUB.        AGTCTTT-
                *   *** 

[Download ClustalW]

#337

Mean pairwise ID: 43.18%


CIN.HYB.        -ACCGG--GCTTGGTAACGCTAGTCTATA-ACTCAAGTGAGGGTATCAAAGTGGTTGAAC
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGG-TCTGATTGTGGGATGGC
                 ** **  * **** * *    **    *  **   ****** * * *  ****     *

CIN.HYB.        TTTGAGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAG
DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAG
                 *   *** ** *   **   * *      **     *     **   * ***  * ***

CIN.HYB.        TCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGGG
DRO.MEL.        CTTGCCATCAATATGGGTGCCATG-GAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGG
                       *   *    **  * ** * * ** *   **   *  *        *   ***

CIN.HYB.        GGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGAA
DRO.MEL.        ATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTG
                  * *  * *  ***  ***   *   *** ** ** *  **      * * * ** *  

CIN.HYB.        GGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGCCCAACAGGACAC
DRO.MEL.        GGATAGCGTACCGGAGTG-----GACTGCCGTTATCAGCCCAACCGATATGGTTGGACCA
                ****  *   ********     * **    * * *****   *          ****  

CIN.HYB.        CCATTT--
DRO.MEL.        CAATCTTT
                * ** *  

[Download ClustalW]

#338

Mean pairwise ID: 43.19%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAGTCAGA
LYC.ES_L        ---------------------------------------------GTTGGGTTGACCCAG
                                                             *** *  *   *   

TET.ROS.        GTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGAGTTGCT
LYC.ES_L        ATGGTTGGGTTCGGTAGGCTTATAGTCT---GGCCTGCCCTCTCCAAGCATGGAGTTGG-
                 *    * *** * *  *    *   **    *  *****  ***** **  ******  

TET.ROS.        ATGGTGGAAACCTAGTAATAGGACTT----CACCAGGGCATTAAAGAGCTGAGGAACCGC
LYC.ES_L        ATCACGTGG-CTTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGG-GGTGGACTGC
                **   *    * ****   * *** *      *  *     ***** *  *  * ** **

TET.ROS.        CTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATAACA-
LYC.ES_L        GTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGGATAACGG
                 * *******    ***** **  *** *  * *****   **  *************  

TET.ROS.        --TACTCATTAACT-GTCAAGCTAAT---CGGTTCTGCTATTCTGATCAGAC-ACT----
LYC.ES_L        GTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAACCACCACTT
                   * *  * * *  *** ** ***    * * *  ***  **  *  * ** **     

TET.ROS.        -
LYC.ES_L        T
                 

[Download ClustalW]

#339

Mean pairwise ID: 43.19%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATC-CAAGCTACTGGGAGGCTGAGGCTGGCGGAT
TET.THE.        ----GCCAGGGTAGCA-ATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTG-AT
                    *  * *** **   * *****      * *   *    *   **  * * * * **

FUG.RUB.        CGCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAG
TET.THE.        AGATAGGATATGAGAGTTTGATGAGACAG-----TTTGCTAAGAGTGTGCCCGCTCCAAA
                 * * *       *****    *   ***     * **   *  * *** ***  * ** 

FUG.RUB.        TTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                    *  * * ******* *      * *    *    ******* *    ***      

FUG.RUB.        TGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 *   ** * ****  ** ***  * ****  ***    ***         ** *  ***

FUG.RUB.        T--CGCGCCCGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAGTCTT
TET.THE.        TAACATACTCATTAACTGTCAAACTAAT-CGGTTCTACTATCAAAGCCAGACATT-----
                *  *   * * * **  * *    ** * *      * ** ** ***  ***        

FUG.RUB.        T
TET.THE.        -
                 

[Download ClustalW]

#340

Mean pairwise ID: 43.23%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC--
                    ***       * * *   ***** *   * **    ***    *    *   *   

LYC.ES_J        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRY.BR_A        GTCTTGGACAAGCGG--GGGTTCTGTTGCGTTGACTTGG---TGTTCTGCTTGGTTGC-G
                * ***   **   **  *** *  ** *  **   *  *   **  ***        * *

LYC.ES_J        AGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGAC
TRY.BR_A        TGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGAA
                 ** **       * * * * ** * * * * * *          ********** *** 

LYC.ES_J        CGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAA
TRY.BR_A        CGGGTCAGGCCGG--TGACGGAGCAGCC--CACCTTGCGCACGTTCCCGTTCGAGAAGCA
                **  * **** **  * ** ******    ** **  *** *  * * **   ** *  *

LYC.ES_J        TGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACC
TRY.BR_A        CACCGAGGAG-CATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG-------
                      ** * * * *** *     *  ****  * * ** *   * *            

LYC.ES_J        TTT
TRY.BR_A        ---
                   

[Download ClustalW]

#341

Mean pairwise ID: 43.23%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCA---TGTGGGGACATTAAGATGGTGGGACA
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGC--TGGCGGA
                * ** *    **  *    ** ***** ***   *   ****   * **    ***   *

ARA.TH_F        CTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCAA
FUG.RUB.        TCGCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAA
                  * **  * **    * ** *  **   * ** * ****   *  * ** **   * **

ARA.TH_F        GCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCAGGTT-CTAGAGTCGGA
FUG.RUB.        GTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGG
                * *  *  *   **  **     ** * **   *  *     *****  *   **  ** 

ARA.TH_F        GGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGAC
FUG.RUB.        GTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTG
                * *    *    ***  **    **  *****     *   ****       **** *  

ARA.TH_F        GGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTG-CTGGTCCGATCTCATATGAA
FUG.RUB.        GGATCGCGCC-------CGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGAC
                ***** **         **   * *  * ** * *     *  *    *        ** 

ARA.TH_F        CCACCATTTT
FUG.RUB.        TCAGTCTTT-
                 **   *** 

[Download ClustalW]

#342

Mean pairwise ID: 43.23%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATG-
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGG-GGCAATAAGGTAGTGTGGATGT
                 ******   ** *** * ****** *  *        * *  **    ********** 

CAE.EL_C        -GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAA
ZEA.MA_H        CAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTG---GACCACCCATTCCAA
                  * ** *  *      **** ** *   * *   ***   *   ** *  ** * ****

CAE.EL_C        GCGCTGC-GTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGT
ZEA.MA_H        GTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAA---CACTAA-AGT
                *    *  **       ***** **    ***     *   ****     **  *  ***

CAE.EL_C        GGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCACCGCGCGGTGCAGTGGCCG
ZEA.MA_H        GGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCAC--CAGCGG
                ** ***   * *  **        *   *** **      ***** **   *    ** *

CAE.EL_C        GACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTC
ZEA.MA_H        TGGAAGGATAATGAGTCGCTATGC-TATA-GGCCCAAT----------------------
                   *  * *  ***** *  * *  ** *  ***   *                      

CAE.EL_C        ACT
ZEA.MA_H        ---
                   

[Download ClustalW]

#343

Mean pairwise ID: 43.23%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
TRY.BR_A        ------------AGCCGGAGCGCATTGCT----CTGTAACCTTCGGGGGCTGATCCCGCT
                            ***  ****   *  *     * *   * **  ** * **      **

ZEA.MA_E        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
TRY.BR_A        TAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTT--G
                * ***  * * *  *** *  * *   * * ***  * *** *  *     * *      

ZEA.MA_E        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGG
                ****   ** * **  *  * *   *  * *       **     *     * ****** 

ZEA.MA_E        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCG-ATCACTCGCCGGCTTCCAACGGTGG
TRY.BR_A        GGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCG-AG
                 **** ** ** **** **  * ** *******  * *   ***  * * **    *  *

ZEA.MA_E        GAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAGAC
TRY.BR_A        AAGCACACCGAGGAGC---ATCTCAGG---ACTTTGCGCCCCAAGTGTCGTCGCG-AGGC
                 ** * * ** *  **   *  **  *   *  *   ****  **  **     * ** *

ZEA.MA_E        CACCATCTTT
TRY.BR_A        GG--------
                          

[Download ClustalW]

#344

Mean pairwise ID: 43.23%


CAE.EL_B        -ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGT-GGCATAAACAATGTAGGTTGTGATAGATA
                  * * *   *    *  * *  * *  **  ** *    *  **** *     * *** 

CAE.EL_B        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
TET.THE.        GGATATGAG----AGTTTGATG-AGACAGTT-----TGCTAAGAGTGTGCCCGCTCCAAA
                *  *  ***    ***    ** *    ***      *   *  * * * ***  **** 

CAE.EL_B        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                *  ** **  * * **    *   * * ** * *      ** ***     ***   *  

CAE.EL_B        TGGA-TGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 * *  *  *****   * **   * ***  ****    ****  * **  ****  ***

CAE.EL_B        CTGCG--CTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTT
TET.THE.        TAACATACTCATTAACTGTCAAAC-TAATCGGTTCTACTATCAAAGCCAGAC-ATT----
                   *   **  * *  ** **    **  * *   *   *  *    ***** * *    

CAE.EL_B        TTT
TET.THE.        ---
                   

[Download ClustalW]

#345

Mean pairwise ID: 43.23%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG-
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGG-GGCAATAAGGTAGTGTGGATGT
                 ******   ** *** * ****** *  *        * *  **    ********** 

CAE.EL_B        -GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAA
ZEA.MA_H        CAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTG---GACCACCCATTCCAA
                  * ** *  *      **** ** *   * *   ***   *   ** *  ** * ****

CAE.EL_B        GCGCTGC-GTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGT
ZEA.MA_H        GTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAA---CACTAA-AGT
                *    *  **       ***** **    ***     *   ****     **  *  ***

CAE.EL_B        GGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCACCGCGCGGTGCAGTGGCCG
ZEA.MA_H        GGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTG
                ** ***   * *  **        *   *** **      ***** **   *    *  *

CAE.EL_B        GACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTT
ZEA.MA_H        GA--AGGATAATGAGTCGCTATGC-TATA-GGCCCAAT----------------------
                **    * *  ***** *  * *  ** *  ***   *                      

CAE.EL_B        TTT
ZEA.MA_H        ---
                   

[Download ClustalW]

#346

Mean pairwise ID: 43.24%


LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCTGG
ZEA.MA_H        ------NCCGAGCTCTGTAGC----GAGTGCTTGTA--ACCCGAGCGGGGG---------
                       **  ******** *    * * ****  *  * * ** * ***          

LEP.COL.        ACCAGCATAGGGTGCTTGCGGCGTTGAC-GTGGTGC-TCTGCTTGGCTGTGTGTCGGAGG
ZEA.MA_H        --CA--ATAAGGTAGTGTGGATGTCAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAA
                  **  *** ***  *   *  **  *  ******* * *** *** * *    *     

LEP.COL.        CCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAGGAACTGGGT
ZEA.MA_H        ACTGTGGACCACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG
                 **  **    *** ** **    * *         ** * *    * * * **      

LEP.COL.        CAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGCAGAACCACACCGCGG
ZEA.MA_H        CATCCCAACACTAAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCG----AG
                **  **  **    **  **  ** * ***   * *** * *   *** *  *      *

LEP.COL.        AGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT--------------
ZEA.MA_H        TACCGCCCGCCACCAGCGGTGGAAG-GATAATGAGTCGCTATGCTATAGGCCCAAT
                  **   *  **** ***    * * ***  ** *  *** *              

[Download ClustalW]

#347

Mean pairwise ID: 43.27%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGC-----TACTCGGGAGGCTGAGGCCGG
                 ******  ***  ***  * ** **   * **      **     * ** ***     *

CIN.HYB.        AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCGA
ORI.CUN.        AGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGC--GCTATGCCGATCGGGTGTCCG
                **  * ****   *    * **     *    **  *  *   ****  *     ***  

CIN.HYB.        GAGTGGGTTCATGTTTCCTG-AGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCG----G
ORI.CUN.        CACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAA
                 * *  ****    *   *   * **   * **** *  * *  *       * *     

CIN.HYB.        GGGGCAATGCGTTAGGCTGGTTTC---ACAGAGCTGCGAAAACCTCTACCTCTCGACTGT
ORI.CUN.        GGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
                ** *   **     * *  * *     ** **** *   *** ***     **   * **

CIN.HYB.        GGAAGGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGCCCAACAGG
ORI.CUN.        AGTGGGATCGCGCCTGTGAATAGCCACTGCACT-----CCAGCCTGGGCAACATAGCGAG
                 *  ****  *      ** *  *    ** *      *********  * *  * *  *

CIN.HYB.        ACACCCATTT--
ORI.CUN.        AC-CCTGTCTCC
                ** **  * *  

[Download ClustalW]

#348

Mean pairwise ID: 43.32%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATGTTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTT--CGGGGGC--TGATCCCGCTTAGCG--G
                    ***       * * *   *******     ******    **   *   *  *  *

LYC.ES_F        GGTCCATCTTGATGGATGGG---CTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAGC
TRY.BR_B        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                ** *    * **     ***     **  * * * *  *  **  ****   **      

LYC.ES_F        ACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAGCCACTTGGCCTTTAGAGTGGGATG
TRY.BR_B        TCGGTGTTGAGGTCGCCA--CTGTAGAGAGGCGTTCTCGC---GCCGTTAAAGTGGGGGG
                 * * **** *         ** **   * *  *   * *   *** *** ******  *

LYC.ES_F        GACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAAGGA
TRY.BR_B        AACGG-GTCAGGCCGGT--GACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGAA
                 ** * ** **** ***   ** ***** *  * *     *** *  * * ** * ** *

LYC.ES_F        TCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCAT
TRY.BR_B        GCACACCGAGGAGCATCTCAGGACTTTGC----GCCCCAAGTGTCGTC--GCGAGGCGGT
                 ***      * **   *   * * *  *     **  *   ** * *     *  *  *

LYC.ES_F        CACTTTT
TRY.BR_B        TT-----
                       

[Download ClustalW]

#349

Mean pairwise ID: 43.32%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCT--TCGGGGGC--TGATCCCGCTTAGCG--G
                    ***         * *   *******     ******  * **   *   *  *  *

LYC.ES_B        GGCTGTACCAGATGGTTGGG---CTTGGTGGGCTAATTTC-TGACTTGCCCTATCCAAGC
TRY.BR_B        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                **  **    **     ***     ** ** * * * **  **   ***    *      

LYC.ES_B        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
TRY.BR_B        TCGGTGTTGAG----GTCGCC--ACTGTAGAGA-GGCGTTCTCGCGCCGTTAAAGTGGGG
                *  * ****      ** ***  * ** *** * **  * ** *   *** **   *** 

LYC.ES_B        GGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTGGAAGG
TRY.BR_B        GGAACGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGA
                **** * ** **** ***   ** ***** *    *  ** *** *    * ** * ** 

LYC.ES_B        ATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAACCAC
TRY.BR_B        AGCACACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT-
                *  **     ** *        * *   *   ***  * * *  *     *         

LYC.ES_B        CACTTTT
TRY.BR_B        -------
                       

[Download ClustalW]

#350

Mean pairwise ID: 43.33%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
SCH.POM.        ------------------CGC-TGTAATGGC--TTGGTCGAAGTGTTTAGTACTCCCAAT
                                  *** **** *  *   *  ***    * * ** **     **

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
SCH.POM.        AGTGCATGTTCGGTGGTCTCGGGTTCGAGT-CTCGCTTTCGATCCCTCGATC-TGCCACG
                 *     ** * *  **   *** *  *** * *  *  *****    *  *   * * *

RAT.RAT.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
SCH.POM.        TCTG---TTCGAAGAGTAGTCTTC--GTGGCAACTGGCAGTTAAACCGTGTA--------
                *  *   *    *  **   ** *  *  **    * *    *    *  **        

RAT.RAT.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
SCH.POM.        -GTACCGATGGAGGTTGGAAACAATGCACATC---ACTACCG-GGTCTTGGGCAGTGCGA
                 * ****    **** ******   ***  **   *** *** * *  *  * **** **

RAT.RAT.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTCTT
SCH.POM.        TAGCGA-TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATA--AACACAACGGTCGTT
                * ***  ** ** *  **   ***       *  ** *  ***   * **  **    **

[Download ClustalW]

#351

Mean pairwise ID: 43.34%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAAT-------CGCCTT
                         **  *  *  ** * *   *  ** **      ****        **  * 

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
YAR.LI_B        CTTGTTGTGCGTTCGAGTTCTGGACTCTGCACTGG-GCTACTTTG-----TTGTCCTTTC
                 *** ****  ***   * **** * *     **  *  *  ***     *** ** ***

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
YAR.LI_B        CGAATTCTGCGGTTGAT--GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTC
                * * **  *  ** *    * * * **  * *  **   *  ******    * * *  *

ORY.SA_A        TAAAGT-GGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATC--ACTGCC-CGCT
YAR.LI_B        TAAGATTAACTGGGATA-CTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGG
                ***  *   * ** * * * * **  ***    *   ***** ****    ****  *  

ORY.SA_A        TCCATCGGTGGAAGGATAACAGGCTGCTGCACCTTG-GGCCCGCTTCTGGCCCAGAGTCC
YAR.LI_B        TATGGCGGTGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACT
                *    ****** *    ****   ** *  *  **  **   *  * **       * * 

ORY.SA_A        CTCTACAACAGACCACCATCTTT
YAR.LI_B        CTC--------------------
                ***                    

[Download ClustalW]

#352

Mean pairwise ID: 43.37%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTT--CGGGGGCT----GATCCCGCTTAGCGG
                    ***       *       *******     **** **    ***   *     * *

ARA.TH_G        GATCGGCCC--ACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAGCT
TRY.BR_A        GGACGTCTTGGACAAGCGGGGGTT-CTGTTG-CGTTGACTTGG--TGTTCTGCTTG-GTT
                *  ** *    **  *  **  **  ***** * * *   ***  **  *       * *

ARA.TH_G        GTGAGTGAACCGTATGAAC-CAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAGG
TRY.BR_A        GCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAG--TGGGG
                * * **      *  *  * * *  * **    *     *   *  * *****  ** **

ARA.TH_G        GTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACGG
TRY.BR_A        GGAACGGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGA
                * *  * ** **** **  * ** *******  * ****  *** *    * **    * 

ARA.TH_G        ACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGC-TCGTAACCCGCTTGAAC
TRY.BR_A        AGCACACCGAGGAGCATCTCAGG---ACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG---
                *  **     *  **  * **     *** **  ** *  *  ****  *  *   *   

ARA.TH_G        CACCATTTT
TRY.BR_A        ---------
                         

[Download ClustalW]

#353

Mean pairwise ID: 43.38%


TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
LYC.ES_L        ----------------------------------------------GTTGGGTTGACCCA
                                                              **** * *      

TET.THE.        GATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGAGTTGC
LYC.ES_L        GATGGTTGGGTTCGGTAGGCTTATAGTCTG---GCCTGCCCTCTCCAAGCATGGAGTTGG
                ***    * *** * *  *    *   **    *  ***** ****** **  ****** 

TET.THE.        TATGGTGGTAACCTAGTAATAGGACTC----CACCAGGGCATTAAAGAGCTAAGGAAACG
LYC.ES_L        -ATCACG-TGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGG-GGTGGACTG
                 **   * *  * ****   * ***        *  *     ***** *     * *  *

TET.THE.        CCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGATAACA
LYC.ES_L        CGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGGATAACG
                * * *******    ***** **  *** *  * *****   **  ************* 

TET.THE.        ------TACTCA------TTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAG-ACA
LYC.ES_L        GGTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTAAACCACCACT
                      * ****        *  *  *   ** ** ** *   * * * ** ***  ** 

TET.THE.        TT
LYC.ES_L        TT
                **

[Download ClustalW]

#354

Mean pairwise ID: 43.41%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCA---TGTGGGGACATTAAGATGGTGGGACA
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGC--TGGCGGA
                * ** *    **  *    ** ***** ***   *   ****   * **    ***   *

ARA.TH_A        CTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCAA
FUG.RUB.        TCGCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAA
                  * **  * **    * ** *  **   * ** * ****   *  * ** **   * **

ARA.TH_A        GCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGG
FUG.RUB.        GTTCGGTATCGATA-TGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGG
                * *  *  *   ** ** **      * * ** *  ** ***    *   *   **  **

ARA.TH_A        AGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGA
FUG.RUB.        GGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGT
                 * *    *    ***  **    **  *****     *   ****       **** * 

ARA.TH_A        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTG-CTGGTCCGATCTCATATGA
FUG.RUB.        GGGATCGCGCC-------CGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGA
                 ***** **         **   * *  * ** * *     *  *    *        **

ARA.TH_A        ACCACCATTTT
FUG.RUB.        CTCAGTCTTT-
                  **   *** 

[Download ClustalW]

#355

Mean pairwise ID: 43.42%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
LEI.MAJ.        -------------GCCGGAGCTC-TGCTCTGTAACCTT--CGGGGGCTAACCAGGCTTAG
                             ** ** ***  **         ***  ***  * * *    *  * *

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
LEI.MAJ.        CGGGGAGGACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGC
                 * *   *  *  * ** * *   **  **  *  *** ***   * *  * ***   **

CAE.EL_C        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCA----TAAGGAG
LEI.MAJ.        TGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGT--GGCGCGGGTCCGCCGTTGAAGCG
                  ** ***     **  ** *   * * *** ***  * * ***** *     * * * *

CAE.EL_C        TGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGT-GCAGTGGCC
LEI.MAJ.        AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCAC--CCCACGCACGTCCGCCGTTGCA
                 **     ** ***** * **** * ***** * *   **  *** **   ** ** ** 

CAE.EL_C        GGACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGT
LEI.MAJ.        GAATCACACCGCGGAGCATGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT----
                * *   * *    ***      ** *       **  * *     *   *  **      

CAE.EL_C        CACT
LEI.MAJ.        ----
                    

[Download ClustalW]

#356

Mean pairwise ID: 43.42%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTA--CTCGGGAGGCTGAGACAGGAG-
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                       ** *  **      *****  *   *      *      *****    **** 

RAT.NOR.        -GATCGATTGAGTCCAGGAGTTCTG-GGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCA
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTG--
                 *   *    **   ***     ** ***  *   * * *   * * * ** ***  *  

RAT.NOR.        CTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LEP.COL.        ------TCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGT
                      ****   *     **** ** *  *     ****  *  **     *   *** 

RAT.NOR.        AGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
LEP.COL.        AGAG--GAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCC-GTTG
                ** *  **** **  **** *** **********  **   * * *  *     * ** *

RAT.NOR.        TGGGATCGCGCCTGTGAATA-GCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGT
LEP.COL.        CAGAACCACACCGCGGAGCCTGTCATCAC-CTGCGCCCCAGGCGATCCTGTGAAGCTTT-
                  * * * * **   **    * **   * ** *  **  *** *    * **  *    

RAT.NOR.        CTCT
LEP.COL.        ----
                    

[Download ClustalW]

#357

Mean pairwise ID: 43.42%


LYC.ES_G        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****   *   *** * *   *  * ***      ***   *      *****

LYC.ES_G        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACAG
YAR.LI_A        ---TGCGTTCGAGTCTTGGGCTCTGCAC-TTGGCCATTTGGTTGTCCTTTCCGAATTCTG
                   **     **   *******  *     *      * *  ** *** *** *   * *

LYC.ES_G        AGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGAC
YAR.LI_A        CGGTTGATGG-GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                 * * ***   * *   *  *   *  *** ****   ***** *     *  * *  **

LYC.ES_G        CGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATAA
YAR.LI_A        TGGGAAACTTCAGTGGAGCAATCCAGCAGAGA---TCCAGTT---GCCGTGG--GTATGG
                 * *  *     **    **   ** *  * *   ***  **   ** ****  * **  

LYC.ES_G        CGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCAC
YAR.LI_A        CGGTGGGATCGCAACCAAGTGGTAT--ATGTTATGGAAGATATT----TACGATCACGAT
                ***   * *  *  ******   **  ***        * *  *    *   * *** * 

LYC.ES_G        TTTT
YAR.LI_A        T---
                *   

[Download ClustalW]

#358

Mean pairwise ID: 43.42%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LEI.MAJ.        -------------GCCGGAGCTC-TGCTCTGTAACCTT--CGGGGGCTAACCAGGCTTAG
                             ** ** ***  **         ***  ***  * ***    *  * *

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
LEI.MAJ.        CGGGGAGGACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGC
                 * *   *  *  * ** * *   **  *   ** *** ***   * *  * ***   **

CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCA----TAAGGAG
LEI.MAJ.        TGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGT--GGCGCGGGTCCGCCGTTGAAGCG
                  *  ***     **  *  *   * * **  ***  * * ***** *     * * * *

CAE.EL_D        TCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCG
LEI.MAJ.        AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAG
                  *     ** ***** * **** * ***** * *   *   * ***   ** ** ** *

CAE.EL_D        GACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTATC
LEI.MAJ.        AATCACACCGCGGAGC--ATGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT---
                 * * * *     **   *    *  **     *  * ** * * *   **   ***   

CAE.EL_D        ATTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#359

Mean pairwise ID: 43.44%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG-ACGGTAGATGAGTGTGGATG
                 ******   ** *** * ** *** *  **       * **   ** **  ** *****

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGT-AATCTTGCTGGCTTGCCCGTT
CAE.EL_C        G--AGTGAGAGGAGGAGTCCTGTGT---ATGTCGTTGTCAACGTCGACCGAGCGTCCGTG
                    *** *        ***** *    **** ***** **  * *   *   * **** 

ORY.SA_A        CCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCC
CAE.EL_C        CCAAGCGCTGCGTC--ACCAGGGGATGACTGTCGGAAGA---TGGTCAGTCCCGGGTGCA
                *****    *       ** * **     ** ** * *    ** *  *   *    ** 

ORY.SA_A        CTAA-AGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
CAE.EL_C        TAAGGAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCACCGCGCGGTGC
                  *  *****  *      *  **        *  **** **     *** ** ** * *

ORY.SA_A        CATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTC
CAE.EL_C        AGTGGCCGGACAGCGCTTGTGAGTTGACACGTATACACAGCCTT---CTCAATACCTTCA
                  * *  ***  *       *      *** *     * ** *    * **    *    

ORY.SA_A        TACAACAGACCACCATCTTT
CAE.EL_C        GACCACTTGTCACT------
                 ** **    ***       

[Download ClustalW]

#360

Mean pairwise ID: 43.45%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGG-GGCAATAAGGTGGTGTTGGATG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** ***   ****** *  *        * *  **     **** *   *

ORY.SA_B        CCTGGTCGTTTGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTCC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGT---CGTTGTCTACGTCG-ACCGAGCGTCCGTGCC
                  **   *   * *    * ** **     ** ** * *      * *  ** **** **

ORY.SA_B        AAGTTGCGTAGCGTGTGTGGGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCACCTAGAGT
CAE.EL_A        AAGCGCTACGTCAC-CAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                ***        *      ***    ***   ******        **  *  * **  * 

ORY.SA_B        GGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCCAACGGTG
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                * ** * ** *     * * *     *   *****  *  * ** **** *    * ***

ORY.SA_B        GAAGGATAACGGGC-CGCTGCAGCCCTGGCCCGCTTCCGGCCCAAGTGCCTTCCATGGCA
CAE.EL_A        GCCGGACCGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGA-TACCTTC--AGACC
                *  ***   **     *      * *     ***  **  * * * * *****   * * 

ORY.SA_B        GACCACCACCTTT
CAE.EL_A        ACTTATCATTT--
                    * **  *  

[Download ClustalW]

#361

Mean pairwise ID: 43.46%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG-
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGG-GGCAATAAGGTAGTGTGGATGT
                 ******   ** *** * ****** *  *        * *  **    ********** 

CAE.EL_D        -GAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAA
ZEA.MA_H        CAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTG---GACCACCCATTCCAA
                  * ** *  *      **** ** *   *      **   *   ** *  ** * ****

CAE.EL_D        GC-GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGT
ZEA.MA_H        GTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAA-CAC-TAAAGTGG
                *  **   **       ****  **    *** **  *   ****     * *** * * 

CAE.EL_D        CGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGC
ZEA.MA_H        CGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGA
                **   ** *     * * *     *   *****  *  * ** ****     ** **** 

CAE.EL_D        CGGACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTA
ZEA.MA_H        AGGA------TAATGAGTCGCTATGC-TATA-GGCCCAAT--------------------
                 ***      *  * *** *  *  * ** *  ***   *                    

CAE.EL_D        TCATTT
ZEA.MA_H        ------
                      

[Download ClustalW]

#362

Mean pairwise ID: 43.46%


LYC.ES_E        GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_E        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGTACAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     *** ******  *******  **

LYC.ES_E        AGTTGGATCATGTGGT-CCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGA
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCA
                   **** *   ***  ** **   **   *****  *  * * * *** ****   * *

LYC.ES_E        CC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                ** *********** *********** *** **    ******    * ***********

LYC.ES_E        ACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGTTCTAGTTAAACTACCA
TRI.AE_C        ACGGGCCGCTGCACTCCTAGG-CCGCTTGGGCCTCGTAGCCTACTCCAGC--GACCACCA
                **** *** ***  *** **  **  *   ****  * * **  ** **    ** ****

LYC.ES_E        CATTTT
TRI.AE_C        TC----
                      

[Download ClustalW]

#363

Mean pairwise ID: 43.49%


HUM.LU_C        ------GGTCTTAGCAACTTG-GTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAAC
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                          ** *** ***  **  *    *    *** ** *   * *      *  *

HUM.LU_C        TTTGGGTCA-ACCCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGCTGCCCATTCC
DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATG----TTGACGGAACGTCCGCACT
                *  ** *   * * * ** **   ** ****  *  *    **  * *   * **   * 

HUM.LU_C        AAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACTCCTAGACTGG
DRO.MEL.        AAGCTTGCCATCAATATGGGTGCCATGGAGGAG----TCCGTGGCATTCAGGTTGGCTAA
                ****  *         ** * * * ***  **        *  **   *   * * **  

HUM.LU_C        AGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTAC---CTCCCGCTCTCGGCAGT
DRO.MEL.        GGAGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGT
                 * *  ***     ***  *      * * ****  * *     *****   * ******

HUM.LU_C        GGAAGGATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAAT
DRO.MEL.        AGTGGGATAGCGTACCGGAG-----TGGACTGCCGTTAT-CAGCCCAACCGATA--TGGT
                 *  ***** **  **** *     **  *   *  * * ** *    * **    *  *

HUM.LU_C        AGGACCATTTCTTTT
DRO.MEL.        TGGACCACAATCTTT
                 ******     ***

[Download ClustalW]

#364

Mean pairwise ID: 43.49%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGAATGC
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     ***** *** 

ZEA.MA_A        TTTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCT---TGCCCATCC
CAE.EL_A        AGTGAGAGGAG-----GAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGC
                  ** ** *       * * **** *   ** **       * ** *     * ** * *

ZEA.MA_A        CAAGT-TGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGA
CAE.EL_A        CAAGCGCTACGTCACCAGGGGATAACTGTCG-GAAGGCGGTTAGTCCCGGGTG-CATAAG
                ****           * ** *    ** * * *** **  *  *** * *  * * *   

ZEA.MA_A        GCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGG
CAE.EL_A        GAGTCGTGGATGGTTCAGGACCGA------AAGGTAGCAGACAAAAGCGACCGCGTGGTG
                * * *  * ****   * * * *       *  * ***   **    ****  *     *

ZEA.MA_A        TGGGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCT-CAGAACCTCACTAAG
CAE.EL_A        CAGTGGCCGGACCGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGA
                  *  *    **   **   **   *   *  *  ** *** ** *   *   *   *  

ZEA.MA_A        CAAACCACCATCTTT
CAE.EL_A        CCACTTATCATTT--
                * *   * *** *  

[Download ClustalW]

#365

Mean pairwise ID: 43.51%


LYC.ES_B        ---GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATG-GGGGCATTAATGTGGTGGAAT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTG-TAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGC
                       ** ** * *   *  * *  * ** *   ** * **  * * *****      

LYC.ES_B        GTTGGGCTGTACCAGATGGTTGGGCTTGGTGGGCTA-ATTTCTGACTTGCCCTATCCAAG
DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAG
                 *  *****      *  *    **      *   *  **   *    * **   * ***

LYC.ES_B        CTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGG
DRO.MEL.        CTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGA
                ***    *        *** *      **     ***  * *  * *   *** * *** 

LYC.ES_B        CGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTGGAAG
DRO.MEL.        TGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGG
                 * *  * *  ***  ***   *   **** * *  **** ***   ** ** ** *  *

LYC.ES_B        GATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAACCA
DRO.MEL.        GATAGCGTACCGGAGT------GGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCA
                **** **   *** **       * *      *  * *     * * * *  **  ****

LYC.ES_B        CCACTTTT
DRO.MEL.        CAATCTTT
                * *  ***

[Download ClustalW]

#366

Mean pairwise ID: 43.51%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
TRY.BR_A        ------------AGCCGGAGCGCATTGCT----CTGTAACCTTCGGGGGCTGATCCCGCT
                            ***  ****   *  *     * *   * **  ** * **      **

ZEA.MA_G        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
TRY.BR_A        TAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTT--G
                * ***  * * *  *** *  * *   * * ***  * *** *  *     * *      

ZEA.MA_G        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGG
                ****   ** * **  *  * *   *  * *       **     *     * ****** 

ZEA.MA_G        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCAACGGTGGGA
TRY.BR_A        GGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTC--CCGTTCGA
                 **** ** ** **** **  * ** *******   *  *** * * * *  * **  **

ZEA.MA_G        GGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAGACCA
TRY.BR_A        GAAGCACACCGAGGAGCATCTCAGGAC---TTTGCGCCCCAAGTGTCGTCGCG-AGGCGG
                * *  **     *  ***  **  * *    *   ****  **  **     * ** *  

ZEA.MA_G        CCATCTTT
TRY.BR_A        --------
                        

[Download ClustalW]

#367

Mean pairwise ID: 43.51%


LYC.ES_G        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTT--CGGGGGCTTTCAC-CAGCTGAACAGGG
                          * *   * *   *******     ****** ** *    *  ***    *

LYC.ES_G        GGCTGT----ACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 *****    *****      * *****  * * * *  *   **    * *  *   * 

LYC.ES_G        ACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGT
LEP.COL.        GTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG-
                   *        *  ***  **  *  * *    * **  *        ****** * * 

LYC.ES_G        GGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGG
LEP.COL.        GAACTGGGTCAGGCCGGC--AACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTTGCAGA
                * ** * ** **** **    ** ***** *  *   *   * * *  *** ** * ** 

LYC.ES_G        ATAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCA
LEP.COL.        ACCACACCGCGGAGCCTGTCA----TCACCTGCGCCCCAGG---CGATCCTGTGAAGCTT
                *  **    *** ****  **     **     ***  * *    * ***  * ** *  

LYC.ES_G        CCACTTTT
LEP.COL.        T-------
                        

[Download ClustalW]

#368

Mean pairwise ID: 43.51%


HUM.JA_A        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACTTTG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                     ** * *   ** * ** *** *  **  *    *   ** *   *  *    * *

HUM.JA_A        GGTCAGCCCATTGGATCGG-GTCCAGTGTTAGCTGC-TTGCTGGTCTGCCCATTCCAAGC
CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
                 ** **   *   *  * * **     ***  *  * * *   *   * ** * ******

HUM.JA_A        CGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCCTAAAGAGGAGG
CAE.EL_B        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGGT
                   * **      * *    ***   ****   *      *   *  * *** ***  * 

HUM.JA_A        GCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGG
CAE.EL_B        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGG
                * *  *     * * *     *   *****  *  * *  **** *   *******  **

HUM.JA_A        ATAACGGGTCGGTGCTACTTGGGCCACCATGGTCACTGCATGCACTCTTAATCAGACCAT
CAE.EL_B        ACTGCGCTTGTGAGTTGACACGTATAC-ACAGCCTTCTCA-ATACCTT----CAGACCAC
                *   **  *  * * *     *   ** *  * *    **   **  *    ******* 

HUM.JA_A        CTCTTTT-
CAE.EL_B        TTGTTTTT
                 * **** 

[Download ClustalW]

#369

Mean pairwise ID: 43.51%


LYC.ES_H        -GTTG--AGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                   **  ** ** * * * *  *     *  *      ***   * *  ****       

LYC.ES_H        TTGGGCTGTACCAGATGGTTGGGCTTGGTGGGCTA-ATTTCTGACTTGCCCTATCCAAGC
DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAGC
                *  *****      *  *    **      *   *  **   *    * **   * ****

LYC.ES_H        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
DRO.MEL.        TTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGAT
                **    *        *** *      **     ***  * *  * *   *** * ***  

LYC.ES_H        GGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGG
DRO.MEL.        GAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGGG
                * *  * *  ***  ***   *   *****  ** ** *****   *  ***** *  **

LYC.ES_H        ATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAAC
DRO.MEL.        ATAGCGTACCGGAGTGGACTGCCGTT--ATCAGCCCAACCGATATGGT----TGGACCAC
                ***  *   *** **    *   ***   * *  ** *  *   ** *    *  ** **

LYC.ES_H        CACCTTTT
DRO.MEL.        AATCTTT-
                 * **** 

[Download ClustalW]

#370

Mean pairwise ID: 43.52%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGC
                             **  * **   * *  *      **  ** ******  * *      

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRY.BR_A        GGGGACGTCTTGGACAAGCGGGGGTTC----TGTTGCGTTGACTTGGTGTTC-TGCTTGG
                 *      *   *     * *** * *     * *  *  **   ***** *   **  *

CAN.SPE.        TTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
TRY.BR_A        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGGG
                **  *  **  * * * *  * ** * * ** * **      *  *  *  *** * ***

CAN.SPE.        GTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGG
TRY.BR_A        GGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTCGAGA
                * **** **  **** ***  *********  **   **  **  *    * **    * 

CAN.SPE.        ATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTC
TRY.BR_A        AGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG------
                * * * **   **  * * **   *  * *  **   *   * * ***** *        

CAN.SPE.        T
TRY.BR_A        -
                 

[Download ClustalW]

#371

Mean pairwise ID: 43.55%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

HUM.LU_A        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
TRI.AE_C        -------------------------------------GGTGGTCTGCCCGTTCCAAGTTG
                                                       ********** *******  *

HUM.LU_A        GGAGTTGGGCTGAGTGA--CCTGGGCGAAGGGCTGGGTTGCGCACGTCCTAGAGTGGAGG
TRI.AE_C        AGTAGTGGACCGCTTGGGGCCTATGCGAAAG-TTGGGCCTCACGGTCCATAATGTGGCAG
                 *   *** * *  **   ***  ***** *  ****   * *    * **  ****  *

HUM.LU_A        GCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGG
TRI.AE_C        GCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGG
                ***  ***************************** **  ******  *  * ********

HUM.LU_A        ATAACGGGCCGGTGC-TACCTGGGTCCACCATGCTTCACTAGGCTGACTCTTAATAGGAC
TRI.AE_C        ATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGT--AGCCTACTCCAGCGACCAC
                *********** ***   *** ** *      ** **     **  ****     *  **

HUM.LU_A        CATTTCTTTT
TRI.AE_C        CATC------
                ***       

[Download ClustalW]

#372

Mean pairwise ID: 43.55%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAAT-----GGGGGCATTAATGTGGTGGAA
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                **** **   **   *   ** ****  ** *       *** *  * *    *  *** 

LYC.ES_I        TGTTGGGCTGTACCAGATGGTTGGGCT-TGGTGGGCTAATTTCTG-ACTTGCCCTATCCA
GAL.GAL.        CGCTTGA--GCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTA
                 * * *   *  *  **    ******   *** ****      *     * **   * *

LYC.ES_I        AGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGG
GAL.GAL.        AGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGG
                **    *  *           ****    **    * * **  *  * * * *** * **

LYC.ES_I        GGCGGAATGCGTGAGGCTGGTTTCACAGAGCAA-CGATAAGTTTCGCTCTAAGCGGTGGA
GAL.GAL.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAAC
                ** * *  *    ***  **    ** *****    * ** *  **  *    * **   

LYC.ES_I        AGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAAC
GAL.GAL.        GGGAT--CGCGCCTGTGAATAGCCACTGCAGCGTAGCCTG----GGCAACATAGCGAGAC
                 ****  ** * * ***       * * ***    *****    *       *   * **

LYC.ES_I        CACCATTTTT
GAL.GAL.        C-CTGTCTCC
                * *  * *  

[Download ClustalW]

#373

Mean pairwise ID: 43.56%


CAE.EL_C        -ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATG
TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGT-GGCATAAACAATGTAGGTTGTGATAGATA
                  * * *   *    *  * *  * *  **  ** *    *  **** *     * *** 

CAE.EL_C        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
TET.THE.        GGATATGAG----AGTTTGATG-AGACAGTT-----TGCTAAGAGTGTGCCCGCTCCAAA
                *  *  ***    ***    ** *    ***      *   *  * * * ***  **** 

CAE.EL_C        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                *  ** **  * * **    *   * * ** * *      ** ***     ***   *  

CAE.EL_C        TGGA-TGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 * *  *  *****   * **   * ***  ****    ****  * **  ****  ***

CAE.EL_C        CAGCG--CTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTC
TET.THE.        TAACATACTCATTAACTGTCAAAC-TAATCGGTTCTACTATCAAAGCCAGAC-ATT----
                 * *   **  * *  ** **    **  * *   *   *  *    ***** * *    

CAE.EL_C        ACT
TET.THE.        ---
                   

[Download ClustalW]

#374

Mean pairwise ID: 43.59%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAA--GGTGGTGCGGATT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTT--CGGGGGCTTTCACCAGCTGAACAGGGA
                        * * ***       *******    ******* ** *   *  *  * *   

ZEA.MA_E        CTTTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC-
LEP.COL.        GCTGTCTGGACCAGCATAGG---GTGCTTGCGGCGTTGACGTGGT-GCTCTGCTTGGCTG
                  *  *     *    * **   * *** **   **     ***  *  ****  * *  

ZEA.MA_E        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
LEP.COL.        TGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCG--TTAAAGT
                   ** **  *   * **  *   * **   * * *     * * *  * *   * ****

ZEA.MA_E        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTTCCAACGGT
LEP.COL.        AG-AGGAACTGGGTCAGGCCGGCA--ACGGAGCAGC--CCACCTCGCGCACGTCTGCCGT
                 * *****  * ** **** ***   ** *******   ***    **     *  * **

ZEA.MA_E        GGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAG
LEP.COL.        TGCAGAACCAC--ACCGCGGAGCCT--GTCATCACCTGCGCCCCAGGCGATCCTGTGAAG
                 * ** *  **   **** *  * *    *   **    ****   **    **  * **

ZEA.MA_E        ACCACCATCTTT
LEP.COL.        CTTT--------
                            

[Download ClustalW]

#375

Mean pairwise ID: 43.59%


ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
SCH.POM.        ------CGCTGTAATG---GCTTG--GTCGAAGTGTTTAGTACTCCCAATAGTGCATGTT
                      * *****  *   *****    *  ** *      *      *  *** **** 

ZEA.MA_H        AATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAAGTTG
SCH.POM.        CG--GTGGT-CTCGGGTTCGAGTCTCGC-TTTCGATCCCTCGATCTGCCACGTCTGTTCG
                    ***** *  * *   * **** *   * * * *  * ** *  ***   *   * *

ZEA.MA_H        CGTAGTGGGTTTCGGATGCCTTGGCGA--AAGCTTTGCATCCCAACACTAAAGTGGCGGA
SCH.POM.        AAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTACCG-ATGGAGGTTGGAAA
                   *** *  ****       ****    ** *  ** *   *   *   * ** *   *

ZEA.MA_H        CATTGCGTGAGGCTGGCTT-CATAGAGCAGCGAG-TACCGCCCG---CCACCAGCGGTGG
SCH.POM.        CAATGCACATCACTACCGGGTCTTGGGCAGTGCGATAGCGATGGGATTCACCTTCGCAGG
                ** ***      **  *     * * **** * * ** **   *    ****  **  **

ZEA.MA_H        AAGGATAATGAGTCGCTATGCTATAGGCCCAAT
SCH.POM.        ATGTGCATGGAAGTA-TAAACACAACGGTCGTT
                * *   *  **     **  *   * *  *  *

[Download ClustalW]

#376

Mean pairwise ID: 43.61%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATGTTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGGGGAGG
                          * * *   *   *******   * ****  *** * *    *    *  *

LYC.ES_F        GGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAGCACA
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCT-TGGCTGTGTGTC
                       *  *   *   *  ***  * * * * **  **  ****  ** *   *    

LYC.ES_F        GAGTTGGGTCAAGTGGTCTATACGAAAGTATAGCCACTTGGCCTTTAGAGTGGGATGGAC
LEI.MAJ.        G-GTGTGGCTTGCCCCCCTGCA-GAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGG-GAAC
                * **  **         **  * **  **   **   *  *** **  ** * *  * **

LYC.ES_F        TGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC-TGTGCAGTGGAAGGATC
LEI.MAJ.        CGGGTCAGGCCGGA--AACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCAGAATC
                 * ** **** **    ** ***** *  * *  ** *** * *  ** ** * ** ***

LYC.ES_F        ACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCATCA
LEI.MAJ.        ACACCGCGGAGC-----ATGTCCGCACTTGAGCCCCACGCTTCGTC--GCGAAGCCTT--
                **      * **       ****  **   * **  *    * * *     ** ** *  

LYC.ES_F        CTTTT
LEI.MAJ.        -----
                     

[Download ClustalW]

#377

Mean pairwise ID: 43.61%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTAGTTC
TRI.AE_C        ------------------------------------------------------------
                                                                            

HUM.JA_B        GGCCCATTGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCATTCCAAGCCGAGAG
TRI.AE_C        ---------------------------------GGTGGTCTGCCCGTTCCAAGTTGAGTA
                                                 * *** ****** *******  ***  

HUM.JA_B        TTGAGCTGTGTGAG--CCGGACGAAGGTCTGGCTTGGTCAGCTCCTAAAGCGGAGGGCAA
TRI.AE_C        GTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCA-CGGTCCATAATGTGGCAGGCAC
                 **  * *  ** *  *    **** **  *** *   * *  * *** * **  **** 

HUM.JA_B        TGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGAAGGATAA
TRI.AE_C        CGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAA
                 ************ *******************  ******  *  * ************

HUM.JA_B        CGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGGACCATTT
TRI.AE_C        CGGGCCGCTGCACTCCTAGGCCGCT-TGGGCCTCGTAGCCTACTCCAGCGACCACCATC-
                ******* ***         ** *  ***  * *  ***  ****     *  *****  

HUM.JA_B        CTTTT
TRI.AE_C        -----
                     

[Download ClustalW]

#378

Mean pairwise ID: 43.61%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATG-
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGG-GGCAATAAGGTAGTGTGGATGT
                 *** *    ** *** * ** *** *  *        * *  **    ********** 

CAE.BRI.        -GAGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAA
ZEA.MA_H        CAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTG---GACCACCCATTCCAA
                  * **  * *      **** *  *  **     *** * *   ** *  ** * ****

CAE.BRI.        GCGCTGCGTCGCCAG----GGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGG
ZEA.MA_H        GT--TGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCC--AACACTAAAGT
                *   ***** *   *    ** *  *  * ** ***  * **   **    * *  *** 

CAE.BRI.        AGTGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGC
ZEA.MA_H        GGCGG-ACATTGCGTGAGGCTGGCTT-CATAGAGCAGCGAGTACCGCCCGCCAC--CAGC
                 * **  **  **    *** *     **    ***      ***** **   *    **

CAE.BRI.        CGGATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTTG
ZEA.MA_H        GGTGGAAGGATAATGAGT---CGCTATGCTATAGGCCCAAT-------------------
                 *   *  * *  *****   ****   * * ** * *  *                   

CAE.BRI.        TCATT
ZEA.MA_H        -----
                     

[Download ClustalW]

#379

Mean pairwise ID: 43.61%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_J        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     *** ******  ******   **

LYC.ES_J        AGTTGGATCAC--GAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGG
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCACGGTCCATAATGTGGCAGGC
                   **** * *  * **** *   **** * ***** **  * * * *** ****   * 

LYC.ES_J        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
TRI.AE_C        ACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGAT
                ***** ********************** **  *   ******     * **********

LYC.ES_J        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCA
TRI.AE_C        AACGGGCCGCTGCACT-CCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCA-CCA
                ** *** ** **   *  * **  *  *   ****  * *  * *****   * ** ***

LYC.ES_J        CCTTT
TRI.AE_C        TC---
                 *   

[Download ClustalW]

#380

Mean pairwise ID: 43.62%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACC-------TTCGGGGGCTAACCAGGCTTAGCG
                       ** *  **      ****** *       ** * **  *   * * *  * **

XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
LEI.MAJ.        GGGAGGACGTGGACCAGCGAGG-GTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGCT
                     * *  ***     * *  *   *  ***  ** **   ****  *   **  * *

XEN.LAE.        CGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGGT
LEI.MAJ.        GTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGG
                  ** **  * ***  * **     *      *   * *  *   **  *      * * 

XEN.LAE.        GAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGGAT
LEI.MAJ.        GAACCGGGTCAGGCCGGAAACGGAGCAGCCCACCCCACGCACGTCCGCC-GTTGCAGAAT
                *******  **** **************  **   * * *  * *   * ** *  * **

XEN.LAE.        CGCGCCTGTGAATA-GCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGTTCT
LEI.MAJ.        CACACCGCGGAGCATGTCCGCACTTGA-GCCCCACGCTTCGTCGCGAAGCCTT-----
                * * **   **  * * * *  *   *   **    *  *   ****  *        

[Download ClustalW]

#381

Mean pairwise ID: 43.67%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGC
                             **    **   * *  *      **  ** ****** *****     

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
TRY.BR_B        GGGGACGTCTTGGACAAGCGGGGGTTC----TGTTGCGTTGACTTGGTGTTC-TGCTTGG
                 *      *   *     * *** * *     * *  *  **   ** ** *  ***  *

GAL.GAL.        GCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGGG
TRY.BR_B        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG
                    *  **  * * * *  * **   *    *****   *  *      *** * ****

GAL.GAL.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACGGGA
TRY.BR_B        GGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGAA
                 **** **  **** ***  *********  **   **  **  *    * **  * * *

GAL.GAL.        TCGCGCCTGTGAATAGC-CACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCTGTCTCC
TRY.BR_B        GCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT----
                 * * **   **  * * **   *   *   **   *   * * ***** *  * *    

[Download ClustalW]

#382

Mean pairwise ID: 43.67%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTT-CGGGGGCTGATCCCGCTTAG
                             ** ** **   *   ** *   * *  ***  *   *    *  * *

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
TRY.BR_B        CGGGGACGTCTTGGACAAGCGGGGGTTCT--GTTGCGTTGACTTGGTGTTC-TGCTTGGT
                 * * * *     * *  * *** *** *  *   **  ***   * ** * ***   * 

CAE.BRI.        GCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTGGT
TRY.BR_B        TGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGG
                   * ****     *   **    * * **   **** ** ** **   *** * * ** 

CAE.BRI.        GCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCCGGATA
TRY.BR_B        GAACGGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGAAGC
                * **** ***** * *  * * ***** * *   *   *** ** * * ** ** * *  

CAE.BRI.        GCGCTTGTGAGT-TGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTTGTCATT
TRY.BR_B        ACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT------
                 * *    ***  * **         *  **    **    *   ** *   **      

[Download ClustalW]

#383

Mean pairwise ID: 43.69%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

HUM.LU_D        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
TRI.AE_C        -------------------------------------GGTGGTCTGCCCGTTCCAAGTTG
                                                       ********** *******  *

HUM.LU_D        GGAGTTGGGCTGAGTGA--CCTGGGCGAAGGCTGGGTTGCGCAGCTCCTAGAGTGGAGGG
TRI.AE_C        AGTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGG
                 *   *** * *  **   ***  ***** * ****   * * *  * **  ****  **

HUM.LU_D        CAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGA
TRI.AE_C        CACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGA
                **  ***************************** **  ******  *  * *********

HUM.LU_D        TAACGGGCCGGTGC-TACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGGACC
TRI.AE_C        TAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGT--AGCCTACTCCAGCGACCACC
                ********** ***   *** *  *      ** **     **  ****     *  ***

HUM.LU_D        ATTTCTTTT
TRI.AE_C        ATC------
                **       

[Download ClustalW]

#384

Mean pairwise ID: 43.69%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
TRY.BR_B        ------------AGCCGGAGCGCATTGCT----CTGTAACCTTCGGGGGCTGATCCCGCT
                            ***  ****   *  *     * *   * **  ** * **      **

ZEA.MA_G        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
TRY.BR_B        TAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTT--G
                * ***  * * *  *** *  * *   * * ***  * *** *  *     * *      

ZEA.MA_G        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGG
                ****   ** * **  *  * *   *  * *       **     *     * ****** 

ZEA.MA_G        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGC-TTCCAACGGTGGG
TRY.BR_B        GGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGA
                 **** ** ** **** **  * ** *******   *  *** * * ****    *  * 

ZEA.MA_G        AGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAGACC
TRY.BR_B        AGCACACCGAGGAGC---ATCTCAGG---ACTTTGCGCCCCAAGTGTCGTCGCG-AGGCG
                ** * * ** *  **   *  **  *   *  *   ****  **  **     * ** * 

ZEA.MA_G        ACCATCTTT
TRY.BR_B        GTTT-----
                         

[Download ClustalW]

#385

Mean pairwise ID: 43.69%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGA
                          * * *       *******   * ***      * * *    *   *   

ARA.TH_G        GATCGGCCCACGGGTCGGATTTGTTG--TTGGCATAGGTCTGGACTGCCCAATCCAAGCT
LEI.MAJ.        CGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCT---CTGCTTGGCTGTGTGT
                  * * **  ** *   ****** **  *** * * *  **   ****           *

ARA.TH_G        GTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAGGG
LEI.MAJ.        CGGTGTGGCTTGCCC---CCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAG--CGAGGG
                  * ***    *      **  **  *** * *  * *  * *  * * ***   *****

ARA.TH_G        TATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTC-TCAGCAGTGGACGG
LEI.MAJ.        AACCGGGTCAGGCCGGAA--ACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCAGA
                 *  * ** **** **    ** *******  * *** * *** * ** ** ** *  * 

ARA.TH_G        ACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCC-GCTTGAAC
LEI.MAJ.        ATCACA---CCGCGGAGCATGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT---
                *  **    *  **   **      ****   * **   *  ****  *   ** *    

ARA.TH_G        CACCATTTT
LEI.MAJ.        ---------
                         

[Download ClustalW]

#386

Mean pairwise ID: 43.71%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCG-GA
TET.THE.        ----GCCAGGGTAGCA-ATACCTGTG--TCTATATGTGGCATAAACAATGTAGGTTGTGA
                    * *  *** **  *  *****    * *  *       *  *   *   *  * **

GAL.GAL.        TCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAA
TET.THE.        TAGATAGGATATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGCTCCAA
                * * * *       *****    *   ****  ****     ** * * * **** * **

GAL.GAL.        GGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGG
TET.THE.        ACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTA
                     *  *   *******    **  * *   *     *******      ***     

GAL.GAL.        GTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACGGG
TET.THE.        AGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGG
                  *** ** * ****  ** *** ** ****  ***  * ***         **    **

GAL.GAL.        AT--CGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCTGTCT
TET.THE.        ATAACATACTCATTAACTGTCAAACTAAT-CGGTTCTACTATCAAAGCCAGACATT----
                **  *   *   * **  * **    *     *       * ** *** ****  *    

GAL.GAL.        CC
TET.THE.        --
                  

[Download ClustalW]

#387

Mean pairwise ID: 43.71%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTA--CTCGGGAGGCTGAGGTGGGAGG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAG-
                       ** *  **      *****  *   *      *      *****   ***** 

HOM.SA_B        ATCGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTA
LEP.COL.        -CTGTCTGGACC--AGCATAGGGTGCT-TGCGGCGTTGACGTGGTGCTCTGCTTG-GCTG
                   *  **  **   *  *   * *** *   *** *     * **   **   *  ** 

HOM.SA_B        AGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LEP.COL.        TGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAG
                 **   * *    *  **   ** **  * **  ****  * **   *    *** *  *

HOM.SA_B        GGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
LEP.COL.        AG-GAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCC-GTTGCAG
                 * **** **  **** *** **********  **   * * *  *     * ** *  *

HOM.SA_B        GATCGCGCCTGTGAATA-GCCACTGCACTCCAGCCTGAGCAACATAGCGAGACCCCGTCT
LEP.COL.        AACCACACCGCGGAGCCTGTCATCAC-CTGCGCCCCAGGCGATCCTGTGAAGCTTT----
                 * * * **   **    * **   * ** *  **   ** *    * **  *       

HOM.SA_B        CT
LEP.COL.        --
                  

[Download ClustalW]

#388

Mean pairwise ID: 43.71%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC--
                    ***       * * *   ***** *   * **    ***    *    *   *   

LYC.ES_A        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRY.BR_A        GTCTTGGACAAGCGG--GGGTTCTGTTGCGTTGACTTGG---TGTTCTGCTTGGTTGC-G
                * ***   **   **  *** *  ** *  **   *  *   **  ***        * *

LYC.ES_A        AGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGAC
TRY.BR_A        TGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGAA
                 ** **   *   * * * * ** * * * * * *          ********** *** 

LYC.ES_A        CGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCTGTGCAGTGGAAGGATAAT
TRY.BR_A        CGGGTCAGGCCGG--TGACGGAGCAGCCCAC-CTTGCGCACGTTCCCGTTCGAGAAGCAC
                **  * **** **  * ** ******   ** **  *** *  * * **   ** *  * 

LYC.ES_A        GGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCT
TRY.BR_A        ACCGAGGAG-CATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG--------
                     ** * * * *** *     *  ****  * * ** *   * *             

LYC.ES_A        TT
TRY.BR_A        --
                  

[Download ClustalW]

#389

Mean pairwise ID: 43.71%


DRO.MEL.        ---------GACTG-GAAGGTTGGCAGCTTCTGTA-----ATCACGCTTCTGTGAGGTCT
TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
                            ** **  * * * * *    **      ** *   *  *****   **

DRO.MEL.        G--ATTGTGGGATGGCCTGAGGCTGGGAT--CTACTGCGTAGCGGACCAGCTCATGTTGA
TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGTTGC
                *   * * *    ** *   * *****    *******    * * **    ** **** 

DRO.MEL.        CGGAACGTCCGCACTAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTC
TRI.AE_A        GTAGTGGACCGCCTGGGGCTTATGCGAAAGCTGGGTCTCACGGTCCATAATGTGGCAGGC
                      * ****     ****      **  *****  ** **   *    ******  *

DRO.MEL.        AGGTTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCG
TRI.AE_A        ACAGCG--TGAGGCTGGCTTCACAGAGC-AGCGACAACTGCCCGCTTCCAA------CGG
                *    *  * ***  ** *  ** * ** ** *   *   ** **  ****      * *

DRO.MEL.        TGGTAGGCAGTAGTGGGATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATAT
TRI.AE_A        TGGAAGGATAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAG--
                *** ***     * *     **   **   *   * **    *  ***** *  * *   

DRO.MEL.        GGTTGGACCACAATCTTT
TRI.AE_A        ---CAGACCACC------
                     ******       

[Download ClustalW]

#390

Mean pairwise ID: 43.73%


LYC.ES_K        -GTTG--AGCTTAGTAACGTGGGC--TTGTAATCCAAGTGGA---GACATCAAAGTGGTT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                   **  ** ** * * * *  *   *     * *     *    **        ***  

LYC.ES_K        GAATATTGGGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCC
DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGC-GGACCAGCTCATGTTGAC---GGAACGTCCGCACT
                  *   **** * ***      *  ** *  * *    **      **   * **   * 

LYC.ES_K        AAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCG
DRO.MEL.        AAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAG
                ****      *        * * *    * **     ***  ***  * *  **** * *

LYC.ES_K        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
DRO.MEL.        GGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
                **  * ****    ***  **    *   *****  ** ** *****   *  ***** *

LYC.ES_K        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
DRO.MEL.        TGGGATAGCGTACCGGAGTGGACTGCCGTT--ATCAGCCCAACCGATATGGT----TGGA
                  *****  *   *** **    *   ***   * *  ** *  *   ** *    *  *

LYC.ES_K        CAACCACCTTT
DRO.MEL.        CCACAATCTTT
                * ** * ****

[Download ClustalW]

#391

Mean pairwise ID: 43.73%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGCT
TRY.BR_A        ------------AGCCGGAGCGCATTGCT----CTGTAACCTTCGGGGGCTGATCCCGCT
                            ***  ****   *  *     * *   * **  ** * **     ***

ZEA.MA_A        TTGCGATGGCTTTCTGGGCCC-TGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCCAA
TRY.BR_A        TAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTG--CTTG
                * ***  * * *  *** *    ***     ***  *  ** *  * *   *    *   

ZEA.MA_A        GTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCGG
TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTC-GCGCCGTTAAAGTGG
                ****   **   ** ** ** * * *  * *       * **** **     *  ** **

ZEA.MA_A        CAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGAC-TCCCAACGGTGG
TRY.BR_A        GGGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCGAG
                  **** ** ** **** **  * ** *******   *  ***  ** * **       *

ZEA.MA_A        GAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGCAAA
TRY.BR_A        AAGCACACCGAGGA----GCATCTCAGGACT---TTGCGCCCCAAGTGTCGTC--GCGAG
                 ** * * *** *     ***  *   * **   *   ** *  *   **     ** * 

ZEA.MA_A        CCACCATCTTT
TRY.BR_A        GCGG-------
                 *         

[Download ClustalW]

#392

Mean pairwise ID: 43.75%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LEI.MAJ.        -------------GCCGGAGCTC-TGCTCTGTAACCTT--CGGGGGCTAACCAGGCTTAG
                             ** ** ***  **         ***  ***  * ***    *  * *

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
LEI.MAJ.        CGGGGAGGACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGC
                 * *   *  *  * ** * *   **  **  *  *** ***   * *  * ***   **

CAE.EL_B        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCA----TAAGGAG
LEI.MAJ.        TGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGT--GGCGCGGGTCCGCCGTTGAAGCG
                  ** ***     **  ** *   * * *** ***  * * ***** *     * * * *

CAE.EL_B        TGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGT-GCAGTGGCC
LEI.MAJ.        AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCAC--CCCACGCACGTCCGCCGTTGCA
                 **     ** ***** * **** * ***** * *   **  *** **   ** ** ** 

CAE.EL_B        GGACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGT
LEI.MAJ.        GAATCACACCGCGGAGCATGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT----
                * *   * *    ***      ** *       **  * *     *   *  **      

CAE.EL_B        TTTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#393

Mean pairwise ID: 43.75%


LYC.ES_I        GCCG-AGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTT
LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGC--TTAGCGGGGAGGACG---
                **** ****  *   ***   ***      * **   **   ***  * ** ***     

LYC.ES_I        GGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTTA
LEI.MAJ.        ----TGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTC
                    ** *****   *   *  *** ** * * *  *    **   * *  *   *  * 

LYC.ES_I        GAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
LEI.MAJ.        GGTGTGGCT----TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAA
                *   *** *    ** ***  *  *     ***      *    ***  *   * * * *

LYC.ES_I        ATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTC-TAAGCGGTGGAAGGATA
LEI.MAJ.        CCGGGTCAGGCCGGAA--ACGGAGCAGCC-CACCCCACGCACGTCCGCCGTTGCAGAATC
                  * ** **** **    ** ***** *   *     *** * *  ** ** * ** ** 

LYC.ES_I        ACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCAT
LEI.MAJ.        ACACCGCGGAGCA---TGTCCGCACTTGAGCCCCACGCTTCGTCGCGA---AGCCTT---
                **    *** *     **    ** *   ***  * *  * *   * *   * **     

LYC.ES_I        TTTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#394

Mean pairwise ID: 43.75%


TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
YAR.LI_B        --------AGCTGTAATGGCATTT---TGTCGGAGTGGTAAATCGCCTTCTTGTTG--TG
                        ***  **   *  * *   *** * *     **      ** *  * *   *

TET.THE.        GATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATG-AGTTG
YAR.LI_B        CGTTCGAGTTCTGGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTG
                  *  ***   * **     ** *  ****      ** **  *** **   **  ****

TET.THE.        CTATG-GTGGTAACCT-AGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAG-GAAACG
YAR.LI_B        ATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATA
                 *  * **      ** ****** **  *  *      * **  *    ***  *  *  

TET.THE.        CCTCAGGCTGGCAACAGAACAGGGAAA-ACTTGCCGCTTGTTGTGGTGGAAGGATAACAT
YAR.LI_B        CTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCG-TGGGTATGGCGGTGGGATAGCAA
                * ****    ****   * *** **   * ****** * * * *** **  ***** ** 

TET.THE.        ACTCATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT
YAR.LI_B        CAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC----
                     *    * *   *   *  *  * * * ****   *        

[Download ClustalW]

#395

Mean pairwise ID: 43.77%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG---ACGGTAGATAAG--TGTG
                 ***  * * *   ** * ** *** *  **  *    *     ** * **  *  * **

HUM.LU_A        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
CAE.EL_D        GATGGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGC--GTCCG
                * *  *   ** ***  * **** ****  *  *    **     * **   *    ***

HUM.LU_A        GGAGTTGGGCTGAGTGACCTGGGCG-AAGGGCTGGGTTGCGCACGTCCTAGAGTGGAGGG
CAE.EL_D        TGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAA
                 *    * ***  ** *** ***   **  *  **   ***      *  * *** *   

HUM.LU_A        CAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGA
CAE.EL_D        GGAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGC--GTGGTGCAG
                  *  ****       *   ** **   *   *   *    **   **   ****     

HUM.LU_A        TAACGGGCCGGTGCTACCTGGGTCCAC---CATGCTTCACTAGGCTGACTCTTAATAGGA
CAE.EL_D        TGGCCGGACCGCGCT-TGTAAGTTGACACACATACACAGCCTTCTCGATACCT--TCAGA
                *  * ** * * ***   *  **  **   *** *    *      **  * *  *  **

HUM.LU_A        CCATTTCTTTT--
CAE.EL_D        CCACTTATCATTT
                *** ** *  *  

[Download ClustalW]

#396

Mean pairwise ID: 43.79%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT--TCGGGGGCTTTCAC-CAGCTGAACAGGG
                          * * * * *   *******     ****   ** *    *  ***    *

LYC.ES_N        GGCTGT----ACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 *****    *****      * *****  * * * *  *    **   * *  *   * 

LYC.ES_N        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
LEP.COL.        GTCGGAG-GCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG
                 * *    *  **  *  ****  *** ****  **    *    * *** **    *  

LYC.ES_N        GGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGA
LEP.COL.        GAACTGGGTCAGGCCGGCA--ACGGAGCAGCC---CACCTCGCGCACGTCTGCCGTTGCA
                * * ** ** **** **    ** ***** *        **** *    * *  *  * *

LYC.ES_N        TAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACC
LEP.COL.        GAACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGG---CGATCCTGTGAAGCTTT-
                 *** *  * * *    ***    **    ****  * *    * ***  * ** *    

LYC.ES_N        ATTTTT
LEP.COL.        ------
                      

[Download ClustalW]

#397

Mean pairwise ID: 43.79%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG-
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGG-GGCAATAAGGTAGTGTGGATGT
                 ******   ** *** * ****** *  *        * *  **    ********** 

CAE.EL_A        -GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAA
ZEA.MA_H        CAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTG---GACCACCCATTCCAA
                  * ** *  *      **** ** *   * *    **   *   ** *  ** * ****

CAE.EL_A        GC-GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGT
ZEA.MA_H        GTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAA-CAC-TAAAGTGG
                *  **   **       ****  **    *** **  *   ****     * *** * * 

CAE.EL_A        CGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGC
ZEA.MA_H        CGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGA
                **   ** *     * * *     *   *****  *  * ** ****     ** **** 

CAE.EL_A        CGGACCGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTA
ZEA.MA_H        AGGA------TAATGAGTCGCTATGC-TATA-GGCCCAAT--------------------
                 ***      *  ***** *  *  * **    ***   *                    

CAE.EL_A        TCATTT
ZEA.MA_H        ------
                      

[Download ClustalW]

#398

Mean pairwise ID: 43.81%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAG-GCTTGGGCTGTCGGATC
SCH.POM.        -------------------CGCTGTAATG-GCTTGGTCGAAGTGTTTAGTACTCCCAATA
                                     *******     *  * * ** * ** *     *  ** 

XEN.LAE.        GCTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGT
SCH.POM.        GTGCATGTTCGGTGGTCTCGGGTTCGAGTCT-CGCTTTCGATCCCTCGATC-TGCCACGT
                *     ** * *  **   *** *  * *   *  * ******    *  *   * * **

XEN.LAE.        TCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGG
SCH.POM.        CTGTTCGAAGAGTAGTCTTCGTGG-------------CAACTGGCAGT--TAAACCGTGT
                  * *   *   * ** *** ***             ** * **  *   ***   * * 

XEN.LAE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGGA
SCH.POM.        AGTACCGATGGAGGTTGGAAACAATGCACATCA---CTACCGGGTCT-TGGGCAGTGCGA
                 * ****    **** ******   ***  ***   *  *** * *  *  * **** **

XEN.LAE.        TCGCGCCTGTGAATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGTTCT-
SCH.POM.        TAGCGA-TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACA-ACGGTCGTT
                * ***  ** ** *  **   **** *    *     *  * *   * * ** **  * 

[Download ClustalW]

#399

Mean pairwise ID: 43.83%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

ARA.TH_E        GTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGTCCAAGCTG
LYC.ES_D        ---------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCAC
                                                 *  ****** ****** ********  

ARA.TH_E        TGAGTAAGA-CGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAGGG
LYC.ES_D        AGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGC-GGGGCG
                 ***** ** *  * *   ***  ***    ***       *  * ******  ** * *

ARA.TH_E        TAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGA
LYC.ES_D        GACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA
                 *  ** ********* ************ **  *  *******    ******** ***

ARA.TH_E        TCACAGTTTAGCGTCGC-TCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCA
LYC.ES_D        TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAAC-TAAACCA
                * *  * *  * ***   ***    ** **  ****  ***   * **  *  * *****

ARA.TH_E        CCATTTT-
LYC.ES_D        CCACTTTT
                *** *** 

[Download ClustalW]

#400

Mean pairwise ID: 43.83%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCTTTCACCAGCTGAACAGGG
                          * * * * *   ***** *    * * *   *   *   * **** *  *

LYC.ES_K        GGCTTT----ACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 *** *    ***** *    * *****  * * * *  *   **    * ** *   * 

LYC.ES_K        ACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGC
LEP.COL.        GTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG-
                   *        *  * * ***     * **   * **  *        *****  * * 

LYC.ES_K        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTC-TGTGCAGTGGAAG
LEP.COL.        GAACTGGGTCAGGCCGGCA--ACGGAGCAGCC--CACCTCGCGCACGTCTGCCGTTGCAG
                * ** *  * **** ***   ** ******    ** *** *** * * *** ** * **

LYC.ES_K        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAA
LEP.COL.        AACCACACCGCGGAGCCT-GTCA---TCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT-
                 *  *     *** * **  ***   ***    ****  * * * * **   *       

LYC.ES_K        CCACCTTT
LEP.COL.        --------
                        

[Download ClustalW]

#401

Mean pairwise ID: 43.85%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
TET.THE.        ----GCCAGGGTAGCA-ATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTG-AT
                    * *  *** **     *****      *  *       *   **  *   * * **

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.THE.        AGATAGGATATGAGAGTTTGATG-----AGACAGTTTGCTAAGAGTGTGCCCGCTCCAAA
                 * * *  *    *****    *        *  * ***  *  * *** **** * ** 

ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                    *  *   *******    **  * *   **   ********      ***      

ORI.CUN.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 *** ** * ****  ** *** ** ****  ***  * ***         ** *  ***

ORI.CUN.        TCGCGCCTGTGAATAGCCACTGCACT--CCAGCCTGGGCAACATAGCGAGACCCTGTCTC
TET.THE.        TAACATAC-TCATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT-----
                *  *     * * ** *      ***   * *       * ** *** ****  *     

ORI.CUN.        C
TET.THE.        -
                 

[Download ClustalW]

#402

Mean pairwise ID: 43.85%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
TET.ROS.        ----GCCAGGGTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTA--GAAT
                    * *  *** **  * ******   * *   *       *   **        * **

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGTTCCAAA
                 *   ***     *****    *   ****  ****     ** * * * ***  * ** 

GAL.GAL.        GCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGGG
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                    *  *   *******    **  * *   *     *******      ***    * 

GAL.GAL.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ****** * ****  ** *** ** ****  ***  * ***         **    ***

GAL.GAL.        T--CGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCTGTCTC
TET.ROS.        TAACATACTCATTAACTGTCAA-GCTAATCGGTTCTGCTATTCTGATCAGACACT-----
                *  *   *   * **  * **  **      *    *  *   *    **** **     

GAL.GAL.        C
TET.ROS.        -
                 

[Download ClustalW]

#403

Mean pairwise ID: 43.86%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAA---TAGTC
LEP.COL.        GCCGGAGCCTTGCT--CTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCT
                *** * *      *  **** ****   * *** *  ** *  *    **     *    

TET.ROS.        AGAGTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGAGTT
LEP.COL.        GGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTCGGAGG
                 **  *  * **  ** *      ***  *   * *     *    *        *    

TET.ROS.        GCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAGGAACCGCC
LEP.COL.        CCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAA-AGTAGAGGAACTGGG
                 **  **  *   *** * *  ***    * **    *  * ** **  ******* *  

TET.ROS.        TCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATAACATACT
LEP.COL.        TCAGGCCGGCAACGGAGCAGCCCAC-CTCGCGCACGTCTGCCGTTGCAGAACCACAC-CG
                ****** ****** ** ***   *  ** **       **  ** * ** *  ***  * 

TET.ROS.        CATTAACTGTCAAGCTAATCGGTTCTGCTATTCTGATCAGACACT
LEP.COL.        CGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT
                *     ******       **   * *    **   * *  *  *

[Download ClustalW]

#404

Mean pairwise ID: 43.87%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGAACTT
RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
                   ** *   *   *     ******  ** **      ** * *  *  *  ***   *

HUM.LU_C        TGGGTCAACCCAGTGGTNCGGGNCCAGTGCTAGCTGC-TTACCCGGCTGCCCATTCCAAG
RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                 *  * *  ****  ** * ** *    *   ***        *** ** **   * ***

HUM.LU_C        CCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACT-CCTAGACTGGAG
RAT.NOR.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
                   **        **  *  *    * **  *         *    * ****    ** *

HUM.LU_C        GGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAG
RAT.NOR.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
                 * *  *    ***  **    ** ******     * ******  **   **** *  *

HUM.LU_C        GATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGAC
RAT.NOR.        GAT--CGCGCCTGTGAAT----AGCCACTGCACTCCAGCCTGGGCAACA--TAGCGAGAC
                ***  ** *** ***       *****   *  * ** *  **   **   **    ***

HUM.LU_C        CATTTCTTTT
RAT.NOR.        CCGTCTCT--
                *  *   *  

[Download ClustalW]

#405

Mean pairwise ID: 43.87%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGA--CATTAAGATGGTGGGACAC
LEP.COL.        -----GCCGG--AGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                     **     * *  *    *******   * ***    **  *        **   *

ARA.TH_A        TGGTTCGGTTC-CTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAG
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGT-
                **  * *     *   *   * **  *  ** * * ** * **  ***   * **     

ARA.TH_A        CTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGGA
LEP.COL.        CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCG---TTAAAGTAGAG
                * * *        ***     ***    * **    ** *   * *    ** *** *  

ARA.TH_A        GGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-CAGCAGTGGA
LEP.COL.        GAAC--TGGGTCAGGCCGGCA--ACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGC
                *     ** ** **** ***   ** *******  * ** ** ***    * ** ** * 

ARA.TH_A        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAA
LEP.COL.        AGAACCACACCGCGGAGCCTGTCATCACC----TGCGCCCCAGG--CGATCC--TGTGAA
                 * * ***      * * *  ***  ***    **  *  * **  *****   * ****

ARA.TH_A        CCACCATTTT
LEP.COL.        GCTTT-----
                 *        

[Download ClustalW]

#406

Mean pairwise ID: 43.89%


LYC.ES_O        GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****       *** * *   *  *****      ***   *      * ***

LYC.ES_O        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACAG
YAR.LI_A        TGC-GTTCGAGTC--TTGGGCTCTGCAC-TTGGCCATTTGGTTGTCCTTTCCGAATTCTG
                 ** ** * **     ******  *     *      * *  ** *** *** *   * *

LYC.ES_O        AGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGAC
YAR.LI_A        CGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                 * * ***   * *   *  *   *  *** ****   ***** *     *  * *  **

LYC.ES_O        CGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATAA
YAR.LI_A        TGGGAAACTTCAGTGGAGCAATCCAGCAGAGA---TCCAGTT---GCCGTGG--GTATGG
                 * *  *     **    **   ** *  * *   ***  **   ** ****  * **  

LYC.ES_O        CGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCAC
YAR.LI_A        CGGTGGGATCGCAACCAAGTGGTAT--ATGTTATGGAAGATATT----TACGATCACGAT
                ***   * *  *  ******   **  ***        * *  *    *   * *** * 

LYC.ES_O        TTT
YAR.LI_A        T--
                *  

[Download ClustalW]

#407

Mean pairwise ID: 43.93%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT------TCGGGGGCTTTCACCAGCTGAACA
                       ** *  ** *    ****** *       * ** *****   *   * ** * 

XEN.LAE.        CTTGAGT-CCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTG-TCCGC---ACT
LEP.COL.        GGGAGCTGTCTGGACCAGCATAGGGTGCTT-GCGGCGTTGACGTGGTGCTCTGCTTGGCT
                      *  * ***          *  **  **   ** **   **** ** **    **

XEN.LAE.        AAGT-TCGGTATCAATATGGTGTTCC--TGGGGGAGCCTCGGATCACCAGGTTGCTCTAA
LEP.COL.        GTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCC----TCCGTTAA
                  ** ****   *     ****  **  **  * **   **   * **    * *  ***

XEN.LAE.        GGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGT
LEP.COL.        AGTAGAG-GAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCC-GT
                 *  * * **** **  **** *** **********  **   * * *  * *   * **

XEN.LAE.        AGTGGGATCGCGCCTGTGAATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACA
LEP.COL.        TGCAGAACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT
                 *  * * * * **   **        *      *  **    * *  * * **  *   

XEN.LAE.        GTTCT
LEP.COL.        -----
                     

[Download ClustalW]

#408

Mean pairwise ID: 43.93%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGA-AATGGGACTTTAGTT
TRY.BR_A        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT--CT
                 ***      * * *  ********   * ***   **   *   *  ***    *   *

HUM.JA_B        CGGCCCATTGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCA-TTCCAAGCCGAG
TRY.BR_A        TGGACAAGCGG---GGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGT
                 ** * *  **   ** * * **        **** **  ****    ** *  * **  

HUM.JA_B        AGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCTAAAGCGGAGGGCAA
TRY.BR_A        GTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGC-------GCCGTTAAAGTGGGGGG-AA
                  *   *  *     *  *   *  * *** **       **   ***** ** *** **

HUM.JA_B        TGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGAAGGATAA
TRY.BR_A        CGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAAGCA
                 * ** **** ***   ** *******  * ****  *** *    * **   ** *  *

HUM.JA_B        CGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGGACCATTT
TRY.BR_A        CACCGAGGAGCATCTCAGGACT-TTGCGCCCCAA-GTGTCGTCGCGAGGCGG--------
                *     ** **  **  *  *      *   **  * *  * * *      *        

HUM.JA_B        CTTTT
TRY.BR_A        -----
                     

[Download ClustalW]

#409

Mean pairwise ID: 43.93%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_A        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     *** ******  ******   **

LYC.ES_A        AGTTGGATC--TCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGG
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCACGGTCCATAATGTGGCAGGC
                   **** *  * * **** *   **** * ***** **  * * * *** ****   * 

LYC.ES_A        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCT-CCCGCTCTGTGCAGTGGAAGGAT
TRI.AE_C        ACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGAT
                ***** ********************** **   ** ******     * **********

LYC.ES_A        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCA
TRI.AE_C        AACGGGCCGCTGCACT-CCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCA-CCA
                ** *** ** **   *  * **  *  *   ****  * *  * *****   * ** ***

LYC.ES_A        CCTTT
TRI.AE_C        TC---
                 *   

[Download ClustalW]

#410

Mean pairwise ID: 43.95%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTCTTGTTG
                         **   *   *** * *   *  * ***      ***   *      *****

LYC.ES_B        GGCTGTACCAGATGGTTGGGCTTGG---TGGGCTAATTTCTGACTTGCCCTATCCAAGCT
YAR.LI_B        TGC-GTTCGAGTT--CTGGACTCTGCACTGGGCTACTTTGT----TGTCCTTTCCGAATT
                 ** ** * ** *   *** **  *   ******* *** *    ** *** *** *  *

LYC.ES_B        TAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG-----TAAAGTG
YAR.LI_B        CTGCGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                  * * * ***   * * * *  *   ** *** * **    ****       ***  * 

LYC.ES_B        GGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATA-AGTTTCCGCTCTAA--GCGG
YAR.LI_B        AACTGGGATACTTCAG--TGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGG
                    ** ** * * **  ***    *   ****  ***  **** ***     *  ****

LYC.ES_B        TGGAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATT
YAR.LI_B        TGGGATAGCAACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCACGACTCTC-----
                *** *    *** *   *** *    *  *    *** *  *      *   ***     

LYC.ES_B        AAACCACCACTTTT
YAR.LI_B        --------------
                              

[Download ClustalW]

#411

Mean pairwise ID: 44.01%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

ARA.TH_G        GATCGGCCCACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAGCTGT
TRI.AE_C        ------------------------------------GGTGGTCTGCCCGTTCCAAGTTGA
                                                      *** ******  ****** ** 

ARA.TH_G        G-AGTGAACCGTATGAA--CCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAGG
TRI.AE_C        GTAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGG-CCTCACGGTCCATAATG-TGGCAG
                * **** ****  **    * * ***** *** *  **  *****   *** * * *  *

ARA.TH_G        GTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACGG
TRI.AE_C        GCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGG
                * *  **** ************************ **  ******  ** * ***** **

ARA.TH_G        ACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAACC
TRI.AE_C        ATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCC-------TCGTAGCCTACTCCAGCG
                * *****  **  **    * *  ** **  ** *       ***** **  **  * * 

ARA.TH_G        ACCATTTT-
TRI.AE_C        ACCACCATC
                ****   * 

[Download ClustalW]

#412

Mean pairwise ID: 44.03%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTA---CTCGGGAGGCTGAGACAGGAG
                **** ** * ** ***   *******  ** ***     * *   ***  *   * *  *

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
RAT.NOR.        GATCGATTGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCAC
                  * *  **  * * *    *  *  *  *  **  *  **   * * *  ** ***  *

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
RAT.NOR.        TAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG------CC
                 *****  * *       ** *       **    **          * **       **

ORY.SA_A        TAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCA
RAT.NOR.        TAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGA
                *** * **   * ** *    ***  **    ** ******     *   ****     *

ORY.SA_A        TCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCTA
RAT.NOR.        TCAGTAGTGGGAT--CGCGCCTGTGAATAGCCACTGCACT-CCAGCCTGGG----CAACA
                ** ** *  ****  *  **   ** *         * ** *  ***  *     *   *

ORY.SA_A        CAACAGACCACCATCTTT
RAT.NOR.        TAGCGAGAC-CCGTCTCT
                 * *    * ** *** *

[Download ClustalW]

#413

Mean pairwise ID: 44.03%


LYC.ES_M        --------------CAAGTGGGGATGTTAAGGTGGTGGAATATTGGGCTGTCCCAGATGG
YAR.LI_B        AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGC-GTTCGAGTT--
                                 ** **  ** ***   *      * *** ** ** * ** *  

LYC.ES_M        CTGGGCTTGG---TGGGCTAATTTCTGGCCTGCCCTGTCCAAGCACAGAGTTGGATCACG
YAR.LI_B        CTGGACTCTGCACTGGGCTACTTTGT----TGTCCTTTCCGAATTCTGCGGTTGAT-GGG
                **** **  *   ******* *** *    ** *** *** *   * * * * ***   *

LYC.ES_M        AGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGACCGCATGAGGCTG
YAR.LI_B        CGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTG-----GGATA
                 * * *      *   ** *****   **** *     *  *    ** *     ** * 

LYC.ES_M        GCTTCACAGAGCAGTGAACAGCTCCCGCTCTGT-GCAGTGGA-AGGATAATGGGTCGGTG
YAR.LI_B        CTTCAGTGGAGCAATC--CAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATAGCA
                  *     ***** *   ****       * ** ** ****  * *    ****   *  

LYC.ES_M        TCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCTTT
YAR.LI_B        ----ACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCA-CGACTCTC---
                    *  ****    **     *    ***   * **** * * **   *   

[Download ClustalW]

#414

Mean pairwise ID: 44.05%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAA--GGTGGTGCGGATT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTT--CGGGGGCTTTCACCAGCTGAACAGGGA
                        * * ***       *******    ******* ** *   *  *  * *   

ZEA.MA_G        CTTTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC-
LEP.COL.        GCTGTCTGGACCAGCATAGG---GTGCTTGCGGCGTTGACGTGGT-GCTCTGCTTGGCTG
                  *  *     *    * **   * *** **   **     ***  *  ****  * *  

ZEA.MA_G        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
LEP.COL.        TGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCG--TTAAAGT
                   ** **  *   * **  *   * **   * * *     * * *  * *   * ****

ZEA.MA_G        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCAACGGTG
LEP.COL.        AG-AGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCACCTCGCGCACGTCTGCCG-TT
                 * *****  * ** **** ***   ** *******   *   ** * * **   ** * 

ZEA.MA_G        GGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAGA
LEP.COL.        GCAGAACCACA--CCGCGGAGCCT--GTCATCACCTGCGCCCCAGGCGATCCTGTGAAGC
                * ** *  **   **** *  * *    *   **    ****   **    **  * ** 

ZEA.MA_G        CCACCATCTTT
LEP.COL.        TTT--------
                           

[Download ClustalW]

#415

Mean pairwise ID: 44.05%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                   *  * * *   *  *  * *** *  **  *    *   ** *  **  *    * *

HUM.LU_C        GGTCAACCCAGTGGTNCGGGNCCAGT-GCTAGCTGC-TTACCCGGCTGCCCATTCCAAGC
CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
                 ** *    **  ** * *     ** * *  *  * *   ***   * ** * ******

HUM.LU_C        CGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACTCCTAGACTGGAGGG
CAE.EL_B        GCTGCGTCA--CCAGGGGA--TGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAG
                   * *     *   ****  **   *  **     **   *  *     *  *   * *

HUM.LU_C        CAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAG
CAE.EL_B        TGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCG
                   **  **   * **    * **  *****  *  * *  **** *   *******  *

HUM.LU_C        GATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGAC
CAE.EL_B        GAC--TGCGCTTGTGAG--TTGA--CACGTATACACAGCCTTCTCAATACCT--TCAGAC
                **    * **  *** *  ****  **    *   ** *       *  * *  *  ***

HUM.LU_C        CATTTCTTTT-
CAE.EL_B        CACTTGTTTTT
                ** ** **** 

[Download ClustalW]

#416

Mean pairwise ID: 44.05%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGT----GGGGACAATAAGGTGGTGGAAC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                  ** *    **  ** * ** *****  *   *    *  *  *   * ***  *    

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAA
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACG-GCGACCGAGC-GTCCGTGCCAA
                ****     *    **  ** **   **  *   **      * **** * **   ****

ARA.TH_D        GCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGA
CAE.BRI.        GCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
                **  ** **   * * *     * * ** * *  ** *     ***   *  ***  *  

ARA.TH_D        GGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGAT
CAE.BRI.        GTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCC
                * * *  **    *** *     *   *****  *  *    ** *     *******  

ARA.TH_D        GGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGAC
CAE.BRI.        GGATAGCGCTTGTGAGTTGTC--GCTCGCCCACAGCCTC----TCTGATACCTTC-AGAC
                ****     **   ***      * **  * *  ***      *  ***  ** *  ***

ARA.TH_D        CACCACTTT--
CAE.BRI.        CACTTGTCATT
                ***   *    

[Download ClustalW]

#417

Mean pairwise ID: 44.06%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTA---CTCGGGAGGCTGAGCCCGCCG
                **** ** * ** ***   *******  ** ***     * *   ***  *   * *  *

ORY.SA_A        TTTGGTGTGGATTCTGA--TCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGT
GAL.GAL.        GATCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATG-CCGAGCGGGC--GTCCGC
                  * *  **    * *   * ******  **    * * *   *  ** ***  * *** 

ORY.SA_A        TCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGC
GAL.GAL.        GCTAAGGCCGGCATCAATATGGTGAGCCC----CGGGGAGCCGAGGCACACCAGGTTG--
                 * ***    * *       ** * * *     **  *  *   *     *      *  

ORY.SA_A        CCTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
GAL.GAL.        CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC
                ***** * **   * ** *    ***  **    ** ******     *   ****   *

ORY.SA_A        CATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTC
GAL.GAL.        GGTCAGTAACGGGATCGCGC----CTGTGAATAGCCACTGCAGCGTAGCCTGGG---CAA
                  ** **    ****  *      ***    * *   * **  *    ** * *   *  

ORY.SA_A        TACAACAGACCACCATCTTT
GAL.GAL.        CATAGCGAGACCCTGTCTCC
                 * * *    * *  ***  

[Download ClustalW]

#418

Mean pairwise ID: 44.08%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
TET.THE.        ----GCCAGGGTAGCAATACCTGT------GTCTATATGTGGCATAAACAATGTAGGTTG
                    *  *** * ***    ****      *  * * ** **  * *     * * *   

DRO.MEL.        TGA-GGCTGGGATCT-ACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAA
TET.THE.        TGATAGATAGGATATGAGAGTTTGATGAGACAGTT--TGCTAAGAGTGTGCCCGCTCCAA
                ***  * * **** * *  *  *   *   *** *  ** * *  *   * **** * **

DRO.MEL.        GCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGG
TET.THE.        ACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTA
                 *      *   *****  *  *   ** * *  *   *   ****      ***     

DRO.MEL.        ATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGGG
TET.THE.        AGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGG
                * *** **   ****   * **   * ***  ** * ** ***      *  ** *  **

DRO.MEL.        ATAGCGTACCGGAGTGGACTGCCG---TTATCAGCCCAACCGATATGGTTGGACCACAAT
TET.THE.        ATAACATACTC--ATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT---
                *** * ***     *  **** *    * *** *  * **    *  *   ***      

DRO.MEL.        CTTT
TET.THE.        ----
                    

[Download ClustalW]

#419

Mean pairwise ID: 44.08%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LEI.MAJ.        -------------GCCGGAGCTC-TGCTCTGTAACCTT--CGGGGGCTAACCAGGCTTAG
                             ** ** ***  **         ***  ***  * ***    *  * *

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
LEI.MAJ.        CGGGGAGGACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGC
                 * *   *  *  * ** * *   **  **  ** *** ***   * *  * ***   **

CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCA----TAAGGAG
LEI.MAJ.        TGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGT--GGCGCGGGTCCGCCGTTGAAGCG
                  *  ***     **  *  *   * * **  ***  * * ***** *     * * * *

CAE.EL_A        TCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCG
LEI.MAJ.        AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAG
                  *     ** ***** * **** * ***** * *   *   * ***   ** ** ** *

CAE.EL_A        GACCGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTATC
LEI.MAJ.        AATCACACCGCGGAGC--ATGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT---
                 * * * *    ***   *    *  **     *  * ** * * *   **   ***   

CAE.EL_A        ATTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#420

Mean pairwise ID: 44.12%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCAGTGTGGTGGAATGTTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCT--TAGCGGGGAG
                        * * ***   *   ******    * * *   * ***  *  * *   *  *

LYC.ES_C        AACATGC-CCAGAAGGTAGGGCTTG-TGTGACAATTCTCTGGCCTGCCCTGTCCAAGCAA
LEI.MAJ.        GACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCT---GTGT
                 ** **  ****   *   *  *** ** *   *     **  ****   *     *   

LYC.ES_C        AGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCCTAAAGTGGGGTGG
LEI.MAJ.        GTCGGTGTGGCTTGCCC-CCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGG-GA
                   * ** * ****    **  **  *** * * ** * *  **   * *** * ** * 

LYC.ES_C        ACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGTGCAGTGGAAGGAT
LEI.MAJ.        ACCGGGTCAGGCCGGA--AACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAGAAT
                ** * ** **** **    ** ***** *  *   * * * *     ** ** * ** **

LYC.ES_C        AACGAGCCAGTGTCATATAAGTTCAACGAATGTCTGATGGGCTGTTCTAGTTAAACTACC
LEI.MAJ.        CACACCGCGGAG-CATGTCCGC---ACTTGAGCCCCACGCTTCGTC---GCGAAGCCTT-
                 **    * * * *** *  *    **    * *  * *    **    *  ** *    

LYC.ES_C        ACATTT
LEI.MAJ.        ------
                      

[Download ClustalW]

#421

Mean pairwise ID: 44.12%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT--TCGGGGGCTTTCAC-CAGCTGAACAGGG
                          * *   * *   *******     ****** ** *    *  ***    *

LYC.ES_I        GGCTGT----ACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 *****    *****      * *****  * * * *  *    **   * *  *   * 

LYC.ES_I        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
LEP.COL.        GTCGGAG-GCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG
                 * *    *  **  *  ****  *** ****  **    *    * *** **    *  

LYC.ES_I        GGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGA
LEP.COL.        GAACTGGGTCAGGCCGGCA--ACGGAGCAGCC---CACCTCGCGCACGTCTGCCGTTGCA
                * * ** ** **** **    ** ***** *        **** *    * *  *  * *

LYC.ES_I        TAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACC
LEP.COL.        GAACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGG---CGATCCTGTGAAGCTTT-
                 *** *  * * *    ***    **    ****  * *    * ***  * ** *    

LYC.ES_I        ATTTTT
LEP.COL.        ------
                      

[Download ClustalW]

#422

Mean pairwise ID: 44.12%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
TRI.AE_C        ------------------------------------------------------------
                                                                            

HUM.LU_B        CAGCCCAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCGGGA
TRI.AE_C        ----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAGT
                                                    ********** *******  * * 

HUM.LU_B        GTTGGGCTGAGTGA--CCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGGGCA
TRI.AE_C        AGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCACGGTCCATAATGTGGCAGGCA
                  *** * *  **   ***  ***** *  ****   * * *  * **  ****  ****

HUM.LU_B        ATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                  ************ **************** **  ****** **  * ***********

HUM.LU_B        ACGGGCCGGTGC-TACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACCATT
TRI.AE_C        ACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCT-ACTCCAGCGACCACCATC
                ******** ***   * * * ** *   *  * *    *** ****        ***** 

HUM.LU_B        TCCTTT
TRI.AE_C        ------
                      

[Download ClustalW]

#423

Mean pairwise ID: 44.12%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTG-TGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATG
LEP.COL.        ------------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGC-TGAACA
                            * ***   **** *  ** * ****  *    *  *  **  ** *  

CAE.EL_C        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
LEP.COL.        GGG--AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTC-TGCTTGG
                * *  **  *    * ** *  ** *  * *  *  *** ***   * *  * ***   *

CAE.EL_C        CGCTGCGTCA----CCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGA
LEP.COL.        CTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAA-A
                *  ** ***     **   ** ** *     * *** **   *  **   * * * *  *

CAE.EL_C        GTGGTGGA--TGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGG
LEP.COL.        GTAGAGGAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTTG
                ** * ***  *** ***** * * ** * ***** * *   *   * **   *** ** *

CAE.EL_C        CCGGACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTT
LEP.COL.        CAGAACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT--
                * * **  * *    ***         *    *  **    * ** *  * *  *     

CAE.EL_C        GTCACT
LEP.COL.        ------
                      

[Download ClustalW]

#424

Mean pairwise ID: 44.12%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
LYC.ES_D        ------------------------------------------------------------
                                                                            

HUM.LU_B        CAGCCCAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCGGGA
LYC.ES_D        -----------------------------TAGTT-CTGGCCTGCCCTGTCCAAGCACAGA
                                             *  ** **** ******  *******   **

HUM.LU_B        GTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGGGCAAT
LYC.ES_D        GTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGACC
                ** **     * * **     ***    **** * *     ***** ** ** * * *  

HUM.LU_B        GCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAGGATAAC
LYC.ES_D        GCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAAT
                ** ********* ************ **  * *********   *************** 

HUM.LU_B        GGGCCGGTGC--TACTTGGTCCACCA-TGTTCACTGGTCCTGACTCTTAATCGGACCATT
LYC.ES_D        GGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGG--GTTGCTCC-AACTAAACCACC
                *** *****   **    ** **  *  *   * ***   *  ***  **    ****  

HUM.LU_B        TCCTTT
LYC.ES_D        ACTTTT
                 * ***

[Download ClustalW]

#425

Mean pairwise ID: 44.12%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCT--TCGGGGGC--TGATCCCGCTTAGCG--G
                    ***         * *   *******     ******  * **   *   *  *  *

LYC.ES_I        GGCTGTACCAGATGGTTGGG---CTTGGTGGGCTAATTTC-TGACTTGCCCTATCCAAGC
TRY.BR_A        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                **  **    **     ***     ** ** * * * **  **   ***    *      

LYC.ES_I        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
TRY.BR_A        TCGGTGTTGAG----GTCGCC--ACTGTAGAGA-GGCGTTCTCGCGCCGTTAAAGTGGGG
                *  * ****      ** ***  * ** *** * **  * ** *   *** **   *** 

LYC.ES_I        GGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGA
TRY.BR_A        GGAACGGGTCAGGCCGGTG--ACGGAGCAGCC-CACCTTGCGCACGTTCCCGTTCGAGAA
                **** * ** **** ***   ** ***** *   *  ** *** *    * **   ** *

LYC.ES_I        TAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACC
TRY.BR_A        GCACACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG-----
                  **     ** *        * *   *  ****  * * ** *   * *          

LYC.ES_I        ATTTTT
TRY.BR_A        ------
                      

[Download ClustalW]

#426

Mean pairwise ID: 44.12%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTG-TGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
LEP.COL.        ------------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGC-TGAACA
                            * ***   **** *  ** * ****  *    *  *  **  ** *  

CAE.EL_B        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
LEP.COL.        GGG--AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTC-TGCTTGG
                * *  **  *    * ** *  ** *  * *  *  *** ***   * *  * ***   *

CAE.EL_B        CGCTGCGTCA----CCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGA
LEP.COL.        CTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAA-A
                *  ** ***     **   ** ** *     * *** **   *  **   * * * *  *

CAE.EL_B        GTGGTGGA--TGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGG
LEP.COL.        GTAGAGGAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTTG
                ** * ***  *** ***** * * ** * ***** * *   *   * **   *** ** *

CAE.EL_B        CCGGACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTT
LEP.COL.        CAGAACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT--
                * * **  * *    ***         *    *  **    * ** *  * *  *     

CAE.EL_B        GTTTTT
LEP.COL.        ------
                      

[Download ClustalW]

#427

Mean pairwise ID: 44.13%


TRY.BR_A        AGCCGGAGCG-CATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTT
YAR.LI_B        AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCT-TCTTGTTGTGCGTTCGAGTTCT
                *** * *  * ****     * *    *     **   **  * *  ***     **  *

TRY.BR_A        GGAC---AAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGC--TTGGTTG-CGTGTCG
YAR.LI_B        GGACTCTGCACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG
                ****      * *** * ** *   **    *  *  ******  *** * * *** ***

TRY.BR_A        GTGTTGA-GGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAACGGGT
YAR.LI_B        GTCTGAGTAATCGGCTTTG-AGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAG
                ** *      *** *  ** ***    ******            *       *  **  

TRY.BR_A        CAGGCCGGTGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCGAGAAGCACACCGAGGA
YAR.LI_B        CAATCCAGCAGAGATCCAGTT-GCCGTGGGTATGG---CGGTGGGATAGCA-ACAAAGTG
                **  ** *    *   ***    ** ** * * *    ** * *   **** **  **  

TRY.BR_A        GCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
YAR.LI_B        GTATAT----GTTATGGAAGGTATTTGCAATCACGACTCTC
                * ** *      * **      *  **   ** ***  *  

[Download ClustalW]

#428

Mean pairwise ID: 44.16%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

HUM.LU_A        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
LYC.ES_D        --------------------------------TAGTT-CTGGCCTGCCCTGTCCAAGCAC
                                                *  ** **** ******  *******  

HUM.LU_A        GGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCCTAGAGTGGAGGGC
LYC.ES_D        AGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGG
                 **** **     * * **     ***    **** * *     ***** ** ** * * 

HUM.LU_A        AATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGAT
LYC.ES_D        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
                *  ** ********************** **  * **********  *************

HUM.LU_A        AACGGGCCGGTG-CTACCTGGGTCCACCATGCTTCACTAGGCTGACTCTTAATAGGACCA
LYC.ES_D        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCC--AACTAAACCA
                ** *** ***** **      ** **  *      * * ** **   *  **    ****

HUM.LU_A        TTTCTTTT
LYC.ES_D        CCACTTTT
                   *****

[Download ClustalW]

#429

Mean pairwise ID: 44.16%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
TRY.BR_A        ------------AGCCGGAGCGCATTGCT----CTGTAACCTTCGGGGGCTGATCCCGCT
                            ***  ****   *  *     * *   * **  ** * **      **

ZEA.MA_D        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
TRY.BR_A        TAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTT--G
                * ***  * * *  *** *  * *   * * ***  * *** *  *     * *      

ZEA.MA_D        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGG
                ****   ** * **  *  * *   *  * *       **     *     * ****** 

ZEA.MA_D        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTGGG
TRY.BR_A        GGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCAC-CTTGCGCACGTTC--CCGTTCG
                 **** ** ** **** **  * ** *******   * ** ** * * * *  * **  *

ZEA.MA_D        AGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAGACC
TRY.BR_A        AGAAGCACACCGAGGAGCATCTCAGGACT---TTGCGCCCCAAGTGTCGTCGCG-AGGCG
                ** *  ***    *  ***  **  * *    *   ****  **  **     * ** * 

ZEA.MA_D        ACCATCTT
TRY.BR_A        G-------
                        

[Download ClustalW]

#430

Mean pairwise ID: 44.16%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTCTTGTTG
                         **       *** * *  **  *****       ***  *  *   * ***

LYC.ES_H        GGCTGTACCAGATGGTTGGGCTTGG---TGGGCTAATTTCTGACTTGCCCTATCCAAGCT
YAR.LI_B        TGC-GTTCGAGTT--CTGGACTCTGCACTGGGCTACTTTGT----TGTCCTTTCCGAATT
                 ** ** * ** *   *** **  *   ******* *** *    ** *** *** *  *

LYC.ES_H        TAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCG
YAR.LI_B        CTGCGGTTGATGG-GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                  * * * ***   * * * *  *   ** *** * **    ****       *  *   

LYC.ES_H        GAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGA-AGG
YAR.LI_B        AACTGGGATACTTCAGTGGAGCAATCCAGCAG--AGATCCAGTT----GCCGTGGGTATG
                 * ** *  *     **    **   ***     ** *** * *    ** ****  * *

LYC.ES_H        ATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAAC
YAR.LI_B        GCGGTGGGATAGCA----ACAAAGTGGTATATGTTATGGAAGGTATTTGCAATCA-CGAC
                    ****   *      *  ****    **     *    ***   * **** * * **

LYC.ES_H        CACCTTTT
YAR.LI_B        TCTC----
                   *    

[Download ClustalW]

#431

Mean pairwise ID: 44.16%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
LEI.MAJ.        -----GCCGG--AGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAG-G
                     **     * *  *    *******   * ***   *  * * *    **  *  *

ARA.TH_A        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCG------TTGACGTGGTGCTCTGCTTG-GCTG
                    **  *  **     * * ** ** *      **   * * *** * *     ****

ARA.TH_A        TGAGTAATTAGTGTTGAGTTGAGCGAAG-GCTTGGCTCATGCAGGTTCTAGAGTCGGAGG
LEI.MAJ.        TGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCG-AGG
                ** **   *   * *         * ** *  **** *  *   *   * **  ** ***

ARA.TH_A        GTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-CAGCAGTGGACG
LEI.MAJ.        GAACCGGGTCAGGCCGGAA--ACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCAG
                * *  * ** **** **    ** *******  * **  * ***    * ** ** *  *

ARA.TH_A        GATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACC
LEI.MAJ.        AATCACACCGCGGAGCATGTCCG---CACTTGAGCCCCACGCTTCG-TCGCG---AAGCC
                 *****      * *    ** *   ****   ***    * * ** ** *     * **

ARA.TH_A        ACCATTTT
LEI.MAJ.        TT------
                        

[Download ClustalW]

#432

Mean pairwise ID: 44.16%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGG--CAACAATGTGGTGGAATGT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                          * * * * *   *******   * ***    ** **        *   * 

LYC.ES_F        TGGGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAGCA
LEP.COL.        TGTCTGGACCAGCATAGG-GTGCTTGCGGCGTTGACGTGGTGCTCTGCT-TGGCTGTGTG
                **  *  * *   ** *  * *****  * * * * **  **  ****  ** *   *  

LYC.ES_F        CAGAGTTGGGTCAAGTGGTCTAT-ACGAAAGTATAGCCACTTGGCCTTTAGAGTGGGATG
LEP.COL.        TCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG-G
                  *        *  ***  *  *  *  ***    **  *    ** *** *** *   *

LYC.ES_F        GACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC-TGTGCAGTGGAAGG
LEP.COL.        AACTGGGTCAGGCCGGC--AACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCAGA
                 **** ** **** **    ** ***** *  * *   * *** * * *** ** * ** 

LYC.ES_F        ATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCA
LEP.COL.        ACCACACCGCGGAGCCT-----GTCATCACCTGCGCCC--CAGGCGATCCTGTGAAGCTT
                * ***      * **       *** * **     **    ***    *   * ** *  

LYC.ES_F        TCACTTTT
LEP.COL.        T-------
                *       

[Download ClustalW]

#433

Mean pairwise ID: 44.16%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCTTTCACCAGCTGAACAGGG
                          * * * * *   ***** *    * * *   *   *   * **** *  *

LYC.ES_J        GGCTTT----ACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 *** *    ***** *    * *****  * * * *  *   **    * ** *   * 

LYC.ES_J        ACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGC
LEP.COL.        GTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG-
                   *        *  * * ***     * **   * **  *        ****** * * 

LYC.ES_J        GGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTC-TGTGCAGTGGAAG
LEP.COL.        GAACTGGGTCAGGCCGGCA--ACGGAGCAGCC--CACCTCGCGCACGTCTGCCGTTGCAG
                * ** *  * **** ***   ** ******    ** *** *** * * *** ** * **

LYC.ES_J        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAA
LEP.COL.        AACCACACCGCGGAGCCT-GTCA---TCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT-
                 *  *     *** * **  ***   ***    ****  * * * * **   *       

LYC.ES_J        CCACCTTT
LEP.COL.        --------
                        

[Download ClustalW]

#434

Mean pairwise ID: 44.16%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTCT
TRY.BR_B        ------------AGCCGGAGCGCATTGCT----CTGTAACCTTCGGGGGCTGATCCCGCT
                            ***  ****   *  *     * *   * **  ** * **      **

ZEA.MA_D        TTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCCAA
TRY.BR_B        TAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTT--G
                * ***  * * *  *** *  * *   * * ***  * *** *  *     * *      

ZEA.MA_D        GTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTGGC
TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGG
                ****   ** * **  *  * *   *  * *       **     *     * ****** 

ZEA.MA_D        AGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTGGG
TRY.BR_B        GGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCAC-CTTGCGCACGTTC--CCGTTGC
                 **** ** ** **** **  * ** *******   * ** ** * * * *  * ** * 

ZEA.MA_D        AGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAGACC
TRY.BR_B        AGAAGCACACCGAGGAGCATCTCAGGACT---TTGCGCCCCAAGTGTCGTCGCG-AGGCG
                ** *  ***    *  ***  **  * *    *   ****  **  **     * ** * 

ZEA.MA_D        ACCATCTT
TRY.BR_B        GTTT----
                        

[Download ClustalW]

#435

Mean pairwise ID: 44.16%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAGTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

ARA.TH_D        GTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAGCTG
LYC.ES_D        ---------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCAC
                                                 **  ****  ****** ********  

ARA.TH_D        TGAGTAATCT-GTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGAGGG
LYC.ES_D        AGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAG-CGGGGCG
                 *****   *   * **  **   ***    **        *  * ****** *** * *

ARA.TH_D        TAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGATGGA
LYC.ES_D        GACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA
                 *  ** ********* ************ **  *  **** **    ******** ***

ARA.TH_D        TCATAGTTCGAAGTCTC-TCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACCA
LYC.ES_D        TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTC-CAACTAAACCA
                * ** * ***  ****  ***  * ** **  ***   *** * * ** *  **  ****

ARA.TH_D        CCACTTT-
LYC.ES_D        CCACTTTT
                ******* 

[Download ClustalW]

#436

Mean pairwise ID: 44.19%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGG-GGCATTAAGGTGGTGTGGATG-
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *   *       * *  **     ********* 

ZEA.MA_F        --TTTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTC---GACCGAGC-GTCCGTGCC
                  *     ** *  * *** *  **   * ** *  * *   * ***  * * **** **

ZEA.MA_F        AAGTTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAG-ACCTGAAGCG
CAE.EL_D        AAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAG
                ***      **  *  * **    * * ** * * * *    **    *  * * * * *

ZEA.MA_F        GCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTG
CAE.EL_D        TCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGC-AGTGGCC
                 *  * ****     * * *         **     * *   ***  * * * *  **  

ZEA.MA_F        GGAGGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGAC
CAE.EL_D        GGACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCA---GACCACT
                ***        *   * **     **  * ** *    ** * * * ***    **    

ZEA.MA_F        CACCATCTTT
CAE.EL_D        TATCATTT--
                 * *** *  

[Download ClustalW]

#437

Mean pairwise ID: 44.19%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGGATGC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                 *** *    ** *** * ** *** *  *        * *  **     ********* 

ZEA.MA_C        TTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAGT
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
                   * *  * *   *    *****       *   *   *   *   * **** ***** 

ZEA.MA_C        TGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTGGCA
CAE.BRI.        GCTGCGTCGCCAG-GGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTGG
                     ** ***   **      ** ** * * *  * * * **  *  * **  * *   

ZEA.MA_C        GGAACGGCGTGAGGCTGTCTT-CACAGAGCAGCGATCACTGCCGGCTATTAACGGTGGAA
CAE.BRI.        TGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTG----CAGTGGCC
                 * *****    *** *     **    ***     *** **  * *     * ****  

ZEA.MA_C        GGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAGAC
CAE.BRI.        GGATAGC--GCTTGTG-AGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACT
                ***** *  **   ** **     ******  *  ****       *   * *  *    

ZEA.MA_C        CACCATTTTT
CAE.BRI.        TGTCATT---
                   ****   

[Download ClustalW]

#438

Mean pairwise ID: 44.19%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGC
                             **  * **   * *  *      **  ** ******  * *      

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRY.BR_B        GGGGACGTCTTGGACAAGCGGGGGTTC----TGTTGCGTTGACTTGGTGTTC-TGCTTGG
                 *      *   *     * *** * *     * *  *  **   ***** *   **  *

CAN.SPE.        TTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
TRY.BR_B        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGGG
                **  *  **  * * * *  * ** * * ** * **      *  *  *  *** * ***

CAN.SPE.        GTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGG
TRY.BR_B        GGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGA
                * **** **  **** ***  *********  **   **  **  *    * ** *  * 

CAN.SPE.        ATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTC
TRY.BR_B        AGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT---
                * * * **   **  * * **   *  * *  **   *   * * ***** *    *   

CAN.SPE.        T
TRY.BR_B        -
                 

[Download ClustalW]

#439

Mean pairwise ID: 44.19%


CAE.EL_A        -ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCT-TTCACCAGCTGAACAGGGAGCTGTCTG
                  * **** * *    *    ***  * * *   *      * * * *      **  **

CAE.EL_A        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAG
LEP.COL.        GACCAGCATAGGG-----TGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT---G
                **     *   **     **  *  * ***** *   **   * *   * * ***    *

CAE.EL_A        CGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
LEP.COL.        TCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGG-GGCGCGCCCCCTCCGTTAAAGTAGAGG
                    * * * ** ** *    **  * ***** **   * ***    *   *** **  *

CAE.EL_A        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGGAC
LEP.COL.        -AACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTTGCAGAAC
                    *** ***** * * ** * ***** * *   **  * ***  *** ** ** * **

CAE.EL_A        CGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTATCATT
LEP.COL.        CACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT--------
                * * *    ***        **   **  **    **** *  * *  *           

CAE.EL_A        T
LEP.COL.        -
                 

[Download ClustalW]

#440

Mean pairwise ID: 44.19%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG----TGGGGATGTTAA-TGTGGTGGAA
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                *  * **   **  **   ** ****  ** **    * **** * * *    *  *** 

LYC.ES_N        TGTTGGGCTGTACCAGATGGTTGGGCT-TGGTGGGCTAATTTCTG-ACTTGCCCTATCCA
GAL.GAL.        CGCTTGA--GCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTA
                 * * *   *  *  **    ******   *** ****      *     * **   * *

LYC.ES_N        AGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGG
GAL.GAL.        AGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGG
                **    *  *           ****    **    * * **  *  * * * *** * **

LYC.ES_N        GGCGGAATGCGTGAGGCTGGTTTCACAGAGCAA-CGATAAGTTTCGCTCTAAGCGGTGGA
GAL.GAL.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAAC
                ** * *  *    ***  **    ** *****    * ** *  **  *    * **   

LYC.ES_N        AGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAAC
GAL.GAL.        GGGAT--CGCGCCTGTGAATAGCCACTGCAGCGTAGCCTG----GGCAACATAGCGAGAC
                 ****  ** * * ***       * * ***    *****    *       *   * **

LYC.ES_N        CACCATTTTT
GAL.GAL.        C-CTGTCTCC
                * *  * *  

[Download ClustalW]

#441

Mean pairwise ID: 44.19%


CAE.EL_D        -ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCT-TTCACCAGCTGAACAGGGAGCTGTCTG
                  * **** * *    *    ***  * * *   *      * * * *      **  **

CAE.EL_D        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAG
LEP.COL.        GA-CCAGCATAGGGTGCTTGCG-GCGTTGACGTGGTGCTCTGCTTGGC-TGTGTGTCGGA
                **   **   ***   * ** *   ** * ***     **  *   ** *  *** *   

CAE.EL_D        CGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCG
LEP.COL.        GGC-----CTCCGGGTGCCCCCTTGCAGAAGG-GGCGCGCCCCCTCCGTTAAAGTAGAGG
                 **     * ** ** *    **  * ***** **   * ***    *   *** **  *

CAE.EL_D        TGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGGAC
LEP.COL.        -AACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTTGCAGAAC
                    *** ***** * * ** * ***** * *   **  * ***  *** ** ** * **

CAE.EL_D        CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTATCATT
LEP.COL.        CACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT--------
                * * *     **        **    *  **    **** *  * *  *           

CAE.EL_D        T
LEP.COL.        -
                 

[Download ClustalW]

#442

Mean pairwise ID: 44.19%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCA----TGTGGGGACATTTAGATGGTGGAAC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                  ** *    **  *  * ** *** *  **      **  *  *   *  **  *    

ARA.TH_E        ACTGGTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGTCCAA
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACG-GCGACCGAGC-GTCCGTGCCAA
                * **    * *    *  *  ***  *** *    *  *   * * ** * **   ****

ARA.TH_E        GCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGA
CAE.BRI.        GCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
                **  ** **     * *     *   ** * *  ****     ***   *  ***  *  

ARA.TH_E        GGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGAC
CAE.BRI.        GTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCC
                * * *  **    *** *     *   *****  *  *    ****     ******* *

ARA.TH_E        GGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTG-CTGGTCCGATCTCATATGAA
CAE.BRI.        GGATAGCGCTTGTGAGTTGTC--GCTCGCCCACAGCCTCTCTGATAC--CTTCAGACCAC
                ****  *  **  * ** *    *  *  * *  ****  *** * *    *** *  * 

ARA.TH_E        CCACCATTTT
CAE.BRI.        TTGTCATT--
                    ****  

[Download ClustalW]

#443

Mean pairwise ID: 44.19%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATC-CAAGCTACTGGGAGGCTGAGGCTGGCGGAT
TET.ROS.        ----GCCAGGGTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTA--GAAT
                    *  * *** **   ******* * * *  *   *    *   **  * *   * **

FUG.RUB.        CGCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAG
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAG-----TTTGCTAAGAGTGTGCCCGTTCCAAA
                 *   ***     *****    *   ***     * **   *  * *** **** * ** 

FUG.RUB.        TTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGG
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                    *  * * *******        * *    *   ******** *    ***    * 

FUG.RUB.        TGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 *  *** * ****  ** ***  * ****  ***    ***         ** *  ***

FUG.RUB.        T--CGCGCCCGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAGTCTT
TET.ROS.        TAACATACTCATTAACTGTCAAGCTAATCGGTTCTGC-TATTCTGATCAGACACT-----
                *  *   * * * **  * *    ** *     ***  **         *** *      

FUG.RUB.        T
TET.ROS.        -
                 

[Download ClustalW]

#444

Mean pairwise ID: 44.19%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
LYC.ES_M        ---------------------------------CAAGTGGGGATGTTAAGGTGGTGGAAT
                                                 * * * **** * * ***  *  * **

CAN.SPE.        CGCTTGA-GCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAA
LYC.ES_M        ATTGGGCTGTCCCAGATGGCTGGGCT-TGGTGGGCTA-ATTTCTGGCCTGCCCTGTCCAA
                     *  * **  **   *******   *** ****      * *  ** **   * **

CAN.SPE.        GTTCGGCATCA-ATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LYC.ES_M        GCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT-CCTAAAGTGG
                *  * *  *   **   * * **     * *     ** *  *  * ** ***** * **

CAN.SPE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
LYC.ES_M        GGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGA
                ** * ****    ***  **    ** ******   * * ******  ***  **** * 

CAN.SPE.        GGGAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCTG-TGCAACATAGCGAGACCC
LYC.ES_M        AGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAAC
                 ****   * * * ***  *   **  * ** *   ****  **        * * *  *

CAN.SPE.        CGTCTCT---
LYC.ES_M        AACCACCTTT
                   * *    

[Download ClustalW]

#445

Mean pairwise ID: 44.19%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAAT-----GGGGGCATTAATGTGGTGGAA
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                * ** **   **   *   ** ****  ** *       *** *  * *    *  *** 

LYC.ES_B        TGTTGGGCTGTACCAGATGGTTGGGCT-TGGTGGGCTAATTTCTG-ACTTGCCCTATCCA
GAL.GAL.        CGCTTGA--GCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTA
                 * * *   *  *  **    ******   *** ****      *     * **   * *

LYC.ES_B        AGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGG
GAL.GAL.        AGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGG
                **    *  *           ****    **    * * **  *  * * * *** * **

LYC.ES_B        GGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTGGA
GAL.GAL.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAAC
                ** * *  *    ***  **    ** *****     **  * ***  *    * **   

LYC.ES_B        AGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAAC
GAL.GAL.        GGGAT--CGCGCCTGTGAATAGCCACTGCAGCGTAGCC---TGGGCAACA-TAGCGAGAC
                 ****  ** * * ***       * * ***    ***   *****  *  **   * **

LYC.ES_B        CACCACTTTT
GAL.GAL.        CCTGTCTCC-
                *    **   

[Download ClustalW]

#446

Mean pairwise ID: 44.19%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGAACTT
HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
                   ** *   *   *  *  ******  ** **      ** * *  *     ***   *

HUM.LU_C        TGGGTCAACCCAGTGGTNCGGGNCCAGTGCTAGCTGC-TTACCCGGCTGCCCATTCCAAG
HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
                 *  * * *****  ** * ** *    *   ***         ** ** **   * ***

HUM.LU_C        CCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACT-CCTAGACTGGAG
HOM.SA_B        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
                   **        **  *  *    * **  *         *    * ****    ** *

HUM.LU_C        GGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAG
HOM.SA_B        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
                 * *  *    ***  **    ** ******     * ******  **   **** *  *

HUM.LU_C        GATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGAC
HOM.SA_B        GAT--CGCGCCTGTGAAT----AGCCACTGCACTCCAGCCTGAGCAACA--TAGCGAGAC
                ***  ** *** ***       *****   *  * ** *  *    **   **    ***

HUM.LU_C        CATTTCTTTT
HOM.SA_B        CCCGTCTCT-
                *   *** * 

[Download ClustalW]

#447

Mean pairwise ID: 44.20%


ARA.TH_G        ------------GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGAT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCAC-GCTTCTG---TGAGGTCTGATTGTGGGAT
                            * *    * *****  *  **** *      **    ** * *  ***

ARA.TH_G        GGTGGAACACTGGATCGGCCCACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCC
DRO.MEL.        GGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAGCT-----CATGTTGACGGAACGTCC
                **    *  ****      *  **   ****   * *     ***      ***  * **

ARA.TH_G        AATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTAC-GGTTGCTA
DRO.MEL.        GCACTAAGCTTGCCATCAAT-ATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCT
                   * *****     * **   *  *  *** *     **  *   * * * *****   

ARA.TH_G        AAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAG
DRO.MEL.        AAGGAGGGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGG
                ****  *   * *  * *  ***  **    *   ****** *  *  *****   *  *

ARA.TH_G        CAGTGGACGGACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACC
DRO.MEL.        CAGTAGTGGGATAGCGTACCGGAGT------GGACTGCCGTTATCAGCCCAACCG--ATA
                **** *  *** * **   **  *          *  *  *  ** **     **  *  

ARA.TH_G        CGCTTGAACCACCATTTT-
DRO.MEL.        TGGTTGGACCACAATCTTT
                 * *** ***** ** ** 

[Download ClustalW]

#448

Mean pairwise ID: 44.20%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTA---CTCGGGAGGCTGAGGCTGGAG
                **** ** * ** *** * *******  ** ***     * *   ***  *  ** *  *

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
HOM.SA_A        GATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCAC
                  * *  **  * * *    *  *  *  *  **  *  **   * * *  ** ***  *

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
HOM.SA_A        TAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG------CC
                 *****  * *       ** *       **    **          * **       **

ORY.SA_A        TAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCA
HOM.SA_A        TAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGA
                *** * **   * ** *    ***  **    ** ******     *   ****     *

ORY.SA_A        TCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCTA
HOM.SA_A        TCAGTAGTGGGATCGCGC----CTGTGAATAGCCACTGCACTCCAGCCTGTG---CAACA
                ** ** *  ****  *      ***    * *   * **       ** * *   *   *

ORY.SA_A        CAACAGACCACCATCTTT-
HOM.SA_A        TAGCGAGACCCCGTCTCTT
                 * *    * ** *** * 

[Download ClustalW]

#449

Mean pairwise ID: 44.22%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC--
                     **  *    *  *  *** ****    * * *   ***    *    *       

CIN.HYB.        AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCGA
TRY.BR_A        GTCTTGGACAAGCGGG--GGTTCTGTTG-CGTTG-ACTTGGTGTTC---TGCTTGGTTGC
                  *****   ***  *  ** ***** * *   * ** ***  * *   * *   ** * 

CIN.HYB.        GAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGGGGGGC
TRY.BR_A        GTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGG--
                * ** ***       **   *  * **    * **  *     * *** * * *****  

CIN.HYB.        AATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGAAGGAT
TRY.BR_A        AACGGGTCAGGCCGGTG--ACGGAGCAGCCC--ACCTTGCGCACGTTCCCGTTCGAGAAG
                ** * ** **** ***   ** **** **    ****    * *    * **   ** * 

CIN.HYB.        TACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGC-TAGCCCAACAGGACACCCA
TRY.BR_A        CACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG--------
                 ***    ****  *** ***    *    **    ** * * **    * *        

CIN.HYB.        TTT
TRY.BR_A        ---
                   

[Download ClustalW]

#450

Mean pairwise ID: 44.22%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTC-TGTGAGGTCTGATTGTGGGATGGC
TET.ROS.        ----GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAGT
                    *  *** * ***    **** * * **  *    * *    **    * * ** * 

DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAG
TET.ROS.        CAGAGTATGAGAGTT------TGATGAGACAGTT--TGCTAAGAGTGTGCCCGTTCCAAA
                * ***  ** **  *      *   *   *** *  ** * *  *   * ***  * ** 

DRO.MEL.        CTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGA
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                *      *   *****  *  *   ** * *  *       ****      ***    **

DRO.MEL.        TGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ******   ****   * **   * ***  ** * ** ***      *  ** *  ***

DRO.MEL.        TAGCGTACCGGAGTGGACTGCCG---TTATCAGCCCAACCGATATGGTTGGACCACAATC
TET.ROS.        TAACATACTC--ATTAACTGTCAAGCTAATCGGTTCTGCTATTCTGATCAGACACT----
                ** * ***     *  **** *    * *** *  *  *   * ** *  ***       

DRO.MEL.        TTT
TET.ROS.        ---
                   

[Download ClustalW]

#451

Mean pairwise ID: 44.23%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     *** ****  

ZEA.MA_G        TTTGCGATG--GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATG---TCGTCGTCTACGTC-GACCGAGC-GTCCGTGC
                  ** ** *  *  * *** *   *   ***   * * * *  * ***  * * **** *

ZEA.MA_G        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.EL_D        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                ****      **  *  * ***    *    * * **  *     *      * * * * 

ZEA.MA_G        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCAACGGTG
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                * *  * ****     * * *     *   *****  *  *  * **** *    * ***

ZEA.MA_G        GGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCC-CAGAGCCTCACTAAGCAG
CAE.EL_D        GCCGGAC--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCA
                *  ***   ** **   *    *   *  *  ** *** *  *       *   *  *  

ZEA.MA_G        ACCACCATCTTT
CAE.EL_D        CTTATCATTT--
                   * *** *  

[Download ClustalW]

#452

Mean pairwise ID: 44.23%


ARA.TH_C        --GTCGAAC-TCAGTAACGCGGGC--TTGTGATCCAAGTGGAGACAATAAGGGGATGGGA
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                   * ***  *  * * *    *   *   * * *     *     **   *******  

ARA.TH_C        CGTTGGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTC-TGGCCCGCCCATTC
DRO.MEL.        TGA-GGCTGGGATCTACTGCGTAG----CGGACCAGCTCATGTTGACGGAACGTCCGCAC
                 *  ** * *     * ** *  *    ***    *   ** **   **  ** **   *

ARA.TH_C        CAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGT
DRO.MEL.        TAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGA
                 *** * *   *  *     * **   *   **   *  **   *** **   ***  * 

ARA.TH_C        GGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTG
DRO.MEL.        GGGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTA
                ***    **** *  ***  ***   *   ******    *  *****   * * * ** 

ARA.TH_C        GAAGGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGG
DRO.MEL.        GTGGGATAGCGTACCGGAGT------GGACTGCCGTTATCAGCCCAACCGATATGGTTGG
                *  ****  **  **   *        * *  *  * * *     * *** *  * ****

ARA.TH_C        ACCATCACTTT-
DRO.MEL.        ACCACAATCTTT
                ****  *  ** 

[Download ClustalW]

#453

Mean pairwise ID: 44.23%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     *** ****  

ZEA.MA_D        TTTGCGATG--GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATG---TCGTCGTCTACGTC-GACCGAGC-GTCCGTGC
                  ** ** *  *  * *** *   *   ***   * * * *  * ***  * * **** *

ZEA.MA_D        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.EL_D        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                ****      **  *  * ***    *    * * **  *     *      * * * * 

ZEA.MA_D        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGT
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAG-CGACCGCGTGGTGCAGT
                * *  * ****     * * *     *   *****  *  *  ** **** *    * **

ZEA.MA_D        GGGAGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCC-CAGAGCCTCACTAAGCA
CAE.EL_D        GGCCGGAC--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACC
                **  ***   *  **   *    *   *  *  ** *** *  *       *   *  * 

ZEA.MA_D        GACCACCATCTT
CAE.EL_D        ACTTATCATTT-
                    * *** * 

[Download ClustalW]

#454

Mean pairwise ID: 44.26%


LYC.ES_G        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_G        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     *** ******  ******   **

LYC.ES_G        AGTTGGATCATGTGGT-CCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGA
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCA
                   **** *   ***  ** **   **   *****  *  * * * *** ****   * *

LYC.ES_G        CCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                ************** *********** *** **    ******    * ***********

LYC.ES_G        ACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCA
TRI.AE_C        ACGGGCCGCTGCACTCCTAGG-CCGCTTGGGCCTCGTAGCCTACTCCAGC--GACCACCA
                **** *** ***  *** **  **  *   ****  * * ** *****     *******

LYC.ES_G        CTTTT
TRI.AE_C        TC---
                     

[Download ClustalW]

#455

Mean pairwise ID: 44.26%


TET.THE.        GCCAGG----GTAGCAA-TACCTGTGTCTATATGTGGCATAAACAATGTAGGTTG--TGA
ZEA.MA_H        NCCGAGCTCTGTAGCGAGTGCTTGTAACC-CGAGCGGGGGCAATAAGGTAGTGTGGATGT
                 **  *    ***** * * * ***  *     * **    ** ** ****  **  ** 

TET.THE.        TAGATAGGATATGAGAGTTTGATGAGACAGT-TTGCTAAGAGTG---TGCCCGCTCCAAA
ZEA.MA_H        CAATTGTGGTGCATGTGCCTG--GGTCTAGTGCTACAAACTGTGGACCACCCATTCCAAG
                 *  *  * *    * *  **  *    ***  * * **  ***     ***  ***** 

TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
ZEA.MA_H        TTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACACTAAAGTGGCG-
                    *   **   *   * *  * * *  * **   * ** *    ** ***** *    

TET.THE.        GGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAG
ZEA.MA_H        GACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGAAG
                *  *  ** * ********   * *** *** **  **   ****     * ********

TET.THE.        GATAACATACTCATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT
ZEA.MA_H        GATAATGAGTCGCTATGCTATAGGCCCAAT--------------------------
                *****        *   ** *    * ***                          

[Download ClustalW]

#456

Mean pairwise ID: 44.27%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGT-----GGGGGCAACAATGTGGTGGAA
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                **** **   **  **   ** ****  ** **      *** *    *    *  *** 

LYC.ES_F        TGTTGGGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGC-CCTGTCCA
GAL.GAL.        CGCTTGAGCC--CAGGAGTTCTGGGCTGCAGTGCGCTATGC-CGAGCGGGCGTCCGCGCT
                 * * *  **  *  **    ******  *  *    ***  *  **  **  * *  * 

LYC.ES_F        AGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAGC-CACTTGGCC-TTTAGAGTG
GAL.GAL.        AAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAG
                *   * *   *   *   ***  *     * *      ** ***  **     **  * *

LYC.ES_F        GGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGG
GAL.GAL.        GGGTGAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAA
                ** ** ** *    ***  **    ** *****      *   ****  * *  ****  

LYC.ES_F        AAGGATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGA--TAGGTTGCCTAATT
GAL.GAL.        CGGGATCGCG---------CCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCG
                  ***** **          ** *** *    **   * * *    * **   * **   

LYC.ES_F        AAACCATCACTTTT
GAL.GAL.        AGACCCTGTCTCC-
                * *** *  **   

[Download ClustalW]

#457

Mean pairwise ID: 44.30%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACGTTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

ARA.TH_C        GGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCCCGCCCATTCCAAGTT
TRI.AE_C        --------------------------------------GGTGGTCTGCCCGTTCCAAGTT
                                                        *** * **** *********

ARA.TH_C        GGGAGTTGAG--GCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGGG
TRI.AE_C        GAGTAGTGGACCGCTTGGGGCCTATGCGAAAGTT-GGGCCTCACGGTCCATAATGTGGCA
                * *   **    ** ****      ***** * * *** **** *     **  ****  

ARA.TH_C        GAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAAG
TRI.AE_C        GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
                *  *************** ************** * **  ******    **********

ARA.TH_C        GATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACCA
TRI.AE_C        GATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGC--GACCA
                *** *******  ***  *** ** ** **  * **   **  *  ****     *****

ARA.TH_C        TCACTTT
TRI.AE_C        CCATC--
                 **    

[Download ClustalW]

#458

Mean pairwise ID: 44.30%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAGTCAGA
LYC.ES_M        ---------------CAAGTGGGGATGTTAAGGTGGTGGAATAT---TGGGCTGTCCCAG
                               *  ***     **   *       *** *   * *  *   *   

TET.ROS.        GTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGAGTTGCT
LYC.ES_M        ATGGCTGGGCTTGGTGGGCTAATTTCT----GGCCTGCCCTGTCCAAGCACAGAGTTGG-
                 *    * * *** ** *  * ***       *  *****  ***** **  ******  

TET.ROS.        ATGGTGGAAACCTAGTAATAGGACT--TCACCAGGGCATTAAAGAGCTGAGGAACCGCCT
LYC.ES_M        ATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGG-GGCGGACCGCAT
                **   *    ** * * * *  *       *  *     ***** *  *  * ***** *

TET.ROS.        CAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATAACATAC
LYC.ES_M        GAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATGGGT
                 ********   ***** *** *** *  * *****   **  ************     

TET.ROS.        TCATTAACTGTCAAGCTAATCGGTTCT------GCTATTCTGATCAGACACT------
LYC.ES_M        CGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCTTT
                   *    * ***** * *      *       * *  **  ** *   **       

[Download ClustalW]

#459

Mean pairwise ID: 44.30%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACGTTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGGGGAGG
                        * * * * * *   *** * *   * ** *  **  ***    * *  *  *

ARA.TH_C        GGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCT-ATATTCTGGCCCGCCCATTCCAAGT
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTT---GCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTG
                    *  *      **  *  **   * ** * * *  *  **  * **           

ARA.TH_C        TGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGGGG
LEI.MAJ.        TCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGT----TGAAGCGAGGG
                * ** ** *         ** *    *  *** ******    **    *  ** * ***

ARA.TH_C        AGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTC-TTGACGGTGGAAG
LEI.MAJ.        A-ACCGGGTCAGGCCGGA--AACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCAG
                * **** ** **** **    ** *******  ***** * *** * *   * ** * **

ARA.TH_C        GATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACCA
LEI.MAJ.        AATCACACCGCGGAGCATGTC---CGCACTTGAGCCCCACGCTTCGTCGCGA---AGCCT
                 ** **    *   ** *  *   * ****    *** *     **   ***     ** 

ARA.TH_C        TCACTTT
LEI.MAJ.        T------
                *      

[Download ClustalW]

#460

Mean pairwise ID: 44.34%


HUM.JA_A        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACTTTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                     ** * *   ** * ** *** *  **  *    *   ** *   *  *    * *

HUM.JA_A        GGTCAGCCCATTGGATCGG-GTCCAGTGTTAGCTGC-TTGCTGGTCTGCCCATTCCAAGC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 ** **   *   *  * * **     ***  ** * * *   *   * ** * ******

HUM.JA_A        CGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCCTAAAGAGGAGG
CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
                     **      * *  * ***   ****** *      *   *  * *** ***  * 

HUM.JA_A        GCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGG
CAE.EL_A        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGG
                * *  *     * * *     *   *****  *  * *  ****     *******  **

HUM.JA_A        ATAACGGGTCGGTGCTACTTGGGCCACCATGGTCACTGCATGCACTCTTAATCAGACCAT
CAE.EL_A        AC--CGCGCTTGTG--AGTTGACACACATACGCAGCCTTCTCGATACCT--TCAGACCAC
                *   ** *   ***  * ***   ***    *   *    *  *  * *  ******** 

HUM.JA_A        CTCTTTT--
CAE.EL_A        TTATCATTT
                 * *  *  

[Download ClustalW]

#461

Mean pairwise ID: 44.34%


LYC.ES_E        ---GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTG-GGGATGTTAAGGTGGTGGAAT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTG-TAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGC
                       ** ** * * * *  * *  * ** *   ** * * * * *  ****      

LYC.ES_E        ATTGGGCTGTCCCAGATGGCTGGGCTTGGTGGGCTA-ATTTCTGGCCTGCCCTATCCAAG
DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAG
                 *  *****      *  **   **      *   *  **   **   * **   * ***

LYC.ES_E        TACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGG
DRO.MEL.        CTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGA
                       *        ***        **     ***  * *  * *  **** * *** 

LYC.ES_E        TGGACCCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGG
DRO.MEL.        TGAACC-GGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGGG
                ** *** * *     ***   *   **** * ** *  * ***   *  ***** *  **

LYC.ES_E        ATAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGTTCTAGTTAAACTA
DRO.MEL.        ATAGCGTACCGGAGTG----GACTGCCGTTA---TCAGCCCAACCGATATGGTTGGACCA
                *** ** ***** *       * * ** ***    * *     * * * * ***  ** *

LYC.ES_E        CCACATTTT
DRO.MEL.        CAATCTTT-
                * *  *** 

[Download ClustalW]

#462

Mean pairwise ID: 44.34%


ZEA.MA_B        -NCCGAGCTCTGTAGCGAGAGCTTGTAACC-CGAGCGGGGGCATTAAGGTGGCGCGGATG
DRO.MEL.        GACTGGAA--GGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGG
                  * *      ** *  **    ***** * **     * *   *  * * * * *   *

ZEA.MA_B        CTTTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGAC-TCTAGCCGGCTTGCCCATCCCAA
DRO.MEL.        CCTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAA
                * *   * ***  ***    *   **         * * * * ***   * **   * **

ZEA.MA_B        GTTGGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGGC
DRO.MEL.        GCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGG
                * * *   *   *   ** **  * * * *  *  ***   ** *     ***  * ** 

ZEA.MA_B        AGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGTGGG
DRO.MEL.        ATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTT-CCCGTGGTAGGCAGTAGT
                * ***  * *  ***  **    *   ****** *  * *  ***        * ** * 

ZEA.MA_B        AGGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAAACC
DRO.MEL.        GGGATAGCGTACCGGAGTGGACTG---CCGTTATCAGCCCAA--CCGATATGGTTGGACC
                 ***** *   ***  *     **   **   *    ****   **  * *      ***

ZEA.MA_B        ACCATCTTT
DRO.MEL.        ACAATCTTT
                ** ******

[Download ClustalW]

#463

Mean pairwise ID: 44.37%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
TET.THE.        ----GCCAGGGTAGCA-ATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTG-AT
                    * *  *** **  *  *****      *  *       *   **  *   * * **

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.THE.        AGATAGGATATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGCTCCAAA
                 * * *  *    *****    *    ***  ****     *  * *** **** * ** 

RAT.RAT.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                    *  *   *******    **  * *   **   ********      ***      

RAT.RAT.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 *** ** * ****  ** *** ** ****  ***  * ***         ** *  ***

RAT.RAT.        TCGCGCCTGTGAATAGCCACTGCACT--CCAGCCTGGGCAACATAGCGAGACCCCGTCTC
TET.THE.        TAACATAC-TCATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT-----
                *  *     * * ** *      ***   * *       * ** *** ****        

RAT.RAT.        TT
TET.THE.        --
                  

[Download ClustalW]

#464

Mean pairwise ID: 44.37%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC--
                     **  *    *  *  *** ****    * * *   ***    *    *       

CIN.HYB.        AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCGA
TRY.BR_B        GTCTTGGACAAGCGGG--GGTTCTGTTG-CGTTG-ACTTGGTGTTC---TGCTTGGTTGC
                  *****   ***  *  ** ***** * *   * ** ***  * *   * *   ** * 

CIN.HYB.        GAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGGGGGGC
TRY.BR_B        GTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGG--
                * ** ***       **   *  * **    * **  *     * *** * * *****  

CIN.HYB.        AATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGAAGGAT
TRY.BR_B        AACGGGTCAGGCCGGTG--ACGGAGCAGCCC--ACCTTGCGCACGTTCCCGTTGCAGAAG
                ** * ** **** ***   ** **** **    ****    * *    * ** * ** * 

CIN.HYB.        TACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGCCCAACAGGACACCCAT
TRY.BR_B        CACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTC-GTCGCGAGGCGGTTT----
                 ***    ****  *** ***    *    **    ** *   * * *   *        

CIN.HYB.        TT
TRY.BR_B        --
                  

[Download ClustalW]

#465

Mean pairwise ID: 44.37%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC--
                    ***       * * *   ***** *   * **    ***    *    *   *   

LYC.ES_A        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCCTGCCCTGTCCAAGCACAG
TRY.BR_B        GTCTTGGACAAGCGG--GGGTTCTGTTGCGTTGACTTGG---TGTTCTGCTTGGTTGC-G
                * ***   **   **  *** *  ** *  **   *  *   **  ***        * *

LYC.ES_A        AGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGTGGGGCGGAC
TRY.BR_B        TGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGAA
                 ** **   *   * * * * ** * * * * * *          ********** *** 

LYC.ES_A        CGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCTGTGCAGTGGAAGGATAAT
TRY.BR_B        CGGGTCAGGCCGG--TGACGGAGCAGCCCAC-CTTGCGCACGTTCCCGTTGCAGAAGCAC
                **  * **** **  * ** ******   ** **  *** *  * * ** * ** *  * 

LYC.ES_A        GGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCACCT
TRY.BR_B        ACCGAGGAG-CATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGA--GGCGGTTT---
                     ** * * * *** *     *  ****  * * ** *   * *    *        

LYC.ES_A        TT
TRY.BR_B        --
                  

[Download ClustalW]

#466

Mean pairwise ID: 44.37%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCA----TGTGGGGACATTAAGATGGTGGGAC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                  ** *    **  *    ** *** *  **      **  *  *   *  **  *    

ARA.TH_A        ACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAA
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACG-GCGACCGAGC-GTCCGTGCCAA
                * **    *     **   * ***  **  *    *  *   * **** * **   ****

ARA.TH_A        GCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGG
CAE.BRI.        GCGCTGCGTCGCCAGGGGTCT-CCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGT
                **  ** **    ** * *     *  ** * *  ****     * **  *   **  * 

ARA.TH_A        AGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGA
CAE.BRI.        GGTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGC
                 * * *  **    *** *     *   *****  *  *    ****     ******* 

ARA.TH_A        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTG-CTGGTCCGATCTCATATGA
CAE.BRI.        CGGATAGCGCTTGTGAGTTGTC--GCTCGCCCACAGCCTCTCTGATAC--CTTCAGACCA
                *****  ** **  * ** *    *  *  * *  ****  *** * *    *** *  *

ARA.TH_A        ACCACCATTTT
CAE.BRI.        CTTGTCATT--
                     ****  

[Download ClustalW]

#467

Mean pairwise ID: 44.37%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGCT
TRY.BR_B        ------------AGCCGGAGCGCATTGCT----CTGTAACCTTCGGGGGCTGATCCCGCT
                            ***  ****   *  *     * *   * **  ** * **     ***

ZEA.MA_A        TTGCGATGGCTTTCTGGGCCC-TGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCCAA
TRY.BR_B        TAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTG--CTTG
                * ***  * * *  *** *    ***     ***  *  ** *  * *   *    *   

ZEA.MA_A        GTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCGG
TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTC-GCGCCGTTAAAGTGG
                ****   **   ** ** ** * * *  * *       * **** **     *  ** **

ZEA.MA_A        CAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGAC-TCCCAACGGTGG
TRY.BR_B        GGGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAG
                  **** ** ** **** **  * ** *******   *  ***  ** * **    *  *

ZEA.MA_A        GAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGCAAA
TRY.BR_B        AAGCACACCGAGGA----GCATCTCAGGACT---TTGCGCCCCAAGTGTCGTC--GCGAG
                 ** * * *** *     ***  *   * **   *   ** *  *   **     ** * 

ZEA.MA_A        CCACCATCTTT
TRY.BR_B        GCGGTTT----
                 *    *    

[Download ClustalW]

#468

Mean pairwise ID: 44.41%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG---ACGGTAGATAAG--TGTG
                 ***  * * *   ** * ** *** *  **  *    *     ** * **  *  * **

HUM.LU_A        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
CAE.EL_A        GATGGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGC--GTCCG
                * *  *   ** ***  * **** ****  *  * *  **     * **   *    ***

HUM.LU_A        GGAGTTGGGCTGAGTGACCTGGGCG-AAGGGCTGGGTTGCGCACGTCCTAGAGTGGAGGG
CAE.EL_A        TGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAA
                 *    * ***  ** *** ***   **  *  **   ***      *  * *** *   

HUM.LU_A        CAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGA
CAE.EL_A        GGAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGC--GTGGTGCAG
                  *  ****       *   ** **   *   *   *    **   **   ****     

HUM.LU_A        TAACGGGCCGGTGCTACCTGGGTCCAC---CATGCTTCACTAGGCTGACTCTTAATAGGA
CAE.EL_A        TGGCCGGACCGCGCT-TGTGAGTTGACACACATACGCAGCCTTCTCGATACCT--TCAGA
                *  * ** * * ***   ** **  **   *** *    *      **  * *  *  **

HUM.LU_A        CCATTTCTTTT--
CAE.EL_A        CCACTTATCATTT
                *** ** *  *  

[Download ClustalW]

#469

Mean pairwise ID: 44.41%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGA-GACAATAAGGGGATGGGACGTT
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTG--GAT
                  *** *   **  ** * ********  **  *    ***  **   *  ** *  * *

ARA.TH_C        GGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCC---CGCCCATTCCA
CAE.EL_C        GGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCA
                **   **    *  * * *  **    ** *   *  *    * **   ** ** * ***

ARA.TH_C        AGTTGGGAGTTG---AGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGT-CTTCTAGA
CAE.EL_C        AGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTC--AGTCCCGGGTGCATAAGGA
                **    * **      ** ***    ***   ** **     *** *  ** * *   **

ARA.TH_C        GTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGG
CAE.EL_C        GTGGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCACCGCGCGGT----GCAG
                **** ***     *  **        *  **** **    ***** * ** *     * *

ARA.TH_C        TGGAAGGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATT
CAE.EL_C        TGGCCGGACAGCGC-TTGTGAGTTGACACGTATAC-ACAGCCTTCTCAATACCTTCAGAC
                ***  ***   **     *    *  *  *   ** *   **   * *    ** *    

ARA.TH_C        GGACCATCACTTT
CAE.EL_C        CACTTGTCACT--
                      *****  

[Download ClustalW]

#470

Mean pairwise ID: 44.41%


LYC.ES_O        GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
TRI.AE_C        ------------------------------------------------------------
                                                                            

LYC.ES_O        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACAG
TRI.AE_C        -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG
                                                     *** ******  ******   **

LYC.ES_O        AGTTGGATCATGTGGT-CCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGA
TRI.AE_C        TAGTGGACCGCTTGGGGCCTATGCGAAAGTTGGGCCTCACGGTCCATAATGTGGCAGGCA
                   **** *   ***  ** **   **   *****  *  * * * *** ****   * *

LYC.ES_O        CCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
TRI.AE_C        CCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATA
                ************** *********** *** **    ******    * ***********

LYC.ES_O        ACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCA
TRI.AE_C        ACGGGCCGCTGCACTCCTAGG-CCGCTTGGGCCTCGTAGCCTACTCCAGC--GACCACCA
                **** *** ***  *** **  **  *   ****  * * ** *****     *******

LYC.ES_O        CTTT
TRI.AE_C        TC--
                    

[Download ClustalW]

#471

Mean pairwise ID: 44.44%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCT--TCGGGGGC--TGATCCCGCTTAGCG--G
                    ***         * *   *******     ******  * **   *   *  *  *

LYC.ES_I        GGCTGTACCAGATGGTTGGG---CTTGGTGGGCTAATTTC-TGACTTGCCCTATCCAAGC
TRY.BR_B        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                **  **    **     ***     ** ** * * * **  **   ***    *      

LYC.ES_I        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
TRY.BR_B        TCGGTGTTGAG----GTCGCC--ACTGTAGAGA-GGCGTTCTCGCGCCGTTAAAGTGGGG
                *  * ****      ** ***  * ** *** * **  * ** *   *** **   *** 

LYC.ES_I        GGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGA
TRY.BR_B        GGAACGGGTCAGGCCGGTG--ACGGAGCAGCC-CACCTTGCGCACGTTCCCGTTGCAGAA
                **** * ** **** ***   ** ***** *   *  ** *** *    * ** * ** *

LYC.ES_I        TAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACC
TRY.BR_B        GCACACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT--
                  **     ** *        * *   *  ****  * * ** *   * *          

LYC.ES_I        ATTTTT
TRY.BR_B        ------
                      

[Download ClustalW]

#472

Mean pairwise ID: 44.44%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG----TGGGGACAATAAGGTGGTGGAAC
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGC--CGGAGG
                * ** **   **  ** * ** ***   ** **    * ****   * ***    ***  

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGC-TGACATATATCTGAGCTGCCCAGTCCA
ORI.CUN.        ATCGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTA
                *  * ** * * *    * ** *  ***  *   *  **     *  * ** **   * *

ARA.TH_D        AGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-CTAAAGTCG
ORI.CUN.        AGTTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
                ** *  *  * *  * **  *  *   **   **  *   *   * * ** *  ***  *

ARA.TH_D        GAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGG
ORI.CUN.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
                * * * *  *    ***  **    ** ******     *  ****      * **** *

ARA.TH_D        ATGGATCATA---GTTCGAAGTCTCTCAGATCCACTATGGCCCGC-TGGTTCGATCTCTC
ORI.CUN.        TGGGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGT
                  *****      **    ** * **    ****   *** *  * * *   ** *    

ARA.TH_D        CTGGACCACCACTTT
ORI.CUN.        CTCC-----------
                **             

[Download ClustalW]

#473

Mean pairwise ID: 44.48%


HOM.SA_A        ------GCCGGGCGCGGTGGCGCGTGCCTGTAGTC-CCAGCTACTCGGGAGGCTGAGGCT
LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGT--CT
                      ***  ** * **  *    *   *   ** ******   * **  ****   **

HOM.SA_A        GGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCG
LEP.COL.        GGACCAGCATA-------GGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTG
                ***  * *           ** * *   ***  *   * * *   * * * ** ***  *

HOM.SA_A        CACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAA
LEP.COL.        --------TCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAA
                        ****   *     **** ** *  *     ****  *  **     *   **

HOM.SA_A        GGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
LEP.COL.        GTAGAGG--AACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCC-GT
                * ** **  *** **  **** *** **********  **   * * *  *     * **

HOM.SA_A        AGTGGGATCGCGCCTGTGAATA-GCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCC
LEP.COL.        TGCAGAACCACACCGCGGAGCCTGTCATCAC-CTGCGCCCCAGGCGATCCTGTGAAGCTT
                 *  * * * * **   **    * **   * ** *  **   ** *    * **  *  

HOM.SA_A        CGTCTCTT
LEP.COL.        T-------
                        

[Download ClustalW]

#474

Mean pairwise ID: 44.48%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT--TCGGGGGCTTTCAC-CAGCTGAACAGGG
                          * *   * *   *******     ****** ** *    *  ***    *

LYC.ES_B        GGCTGT----ACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 *****    *****      * *****  * * * *  *    **   * *  *   * 

LYC.ES_B        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
LEP.COL.        GTCGGAG-GCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG
                 * *    *  **  *  ****  *** ****  **    *    * *** **    *  

LYC.ES_B        GGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTC-TAAGCGGTGGAAG
LEP.COL.        GAACTGGGTCAGGCCGGCA--ACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCAG
                * * ** ** **** **    ** ***** *    *  *  *** * *  ** ** * **

LYC.ES_B        GATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAACCA
LEP.COL.        AACCACACCGCGGAGC---CTGTCATCACCTGCGCCCCAGG---CGATCCTGTGAAGCTT
                 *  **    *** *    ***    **     ***  * *    * **   * ** *  

LYC.ES_B        CCACTTTT
LEP.COL.        T-------
                        

[Download ClustalW]

#475

Mean pairwise ID: 44.52%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGAACTT
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
                   ** *   *   *  *  ******  ** **      ** * *  *     ***   *

HUM.LU_C        TGGGTCAACCCAGTGGTNCGGGNCCAGTGCTAGCTGC-TTACCCGGCTGCCCATTCCAAG
ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                 *  * *  ****  ** * ** *    *   ***        *** ** **   * ***

HUM.LU_C        CCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACT-CCTAGACTGGAG
ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
                   **        **  *  *    * **  *         *    * ****    ** *

HUM.LU_C        GGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAG
ORI.CUN.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
                 * *  *    ***  **    ** ******     * ******  **   **** *  *

HUM.LU_C        GATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGAC
ORI.CUN.        GAT--CGCGCCTGTGAAT----AGCCACTGCACTCCAGCCTGGGCAACA--TAGCGAGAC
                ***  ** *** ***       *****   *  * ** *  **   **   **    ***

HUM.LU_C        CATTTCTTTT
ORI.CUN.        CCTGTCTCC-
                * * ***   

[Download ClustalW]

#476

Mean pairwise ID: 44.52%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
TET.ROS.        ----GCCAGGGTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTT--AGAAT
                    * *  *** **    ******   * *   *       *   **  *    ** **

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.ROS.        AGTCAGAGTATGAGAGTTTGATG-----AGACAGTTTGCTAAGAGTGTGCCCGTTCCAAA
                 *   ****    *****    *        *  * ***  *  * *** ***  * ** 

ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                    *  *   *******    **  * *   **    *******      ***    * 

ORI.CUN.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ****** * ****  ** *** ** ****  ***  * ***         ** *  ***

ORI.CUN.        T--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGTCTC
TET.ROS.        TAACATACTCATTAACTGTCAA-GCTAATCGGTTCTGCTATTCTGATCAGACACT-----
                *  *   *   * **  * **  **    * *    *  *   *    **** **     

ORI.CUN.        C
TET.ROS.        -
                 

[Download ClustalW]

#477

Mean pairwise ID: 44.52%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
TET.THE.        ----GCCAGGGTAGCA-ATACCTGTGTCTATATGTGGCATAAACAATGTAG-GTTGTGAT
                    * *  *** **   * *****      *  *       *   **  * *    ***

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
TET.THE.        AGATAGGATATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGCTCCAAA
                 * * *       *****    *    ***  ****     *  * *** **** * ** 

HOM.SA_B        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                    *  *   *******    **  * *   **   ********      ***      

HOM.SA_B        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 *** ** * ****  ** *** ** ****  ***  * ***         ** *  ***

HOM.SA_B        TCGCGCCTGTGAATAGCCACTGCACT--CCAGCCTGAGCAACATAGCGAGACCCCGTCTC
TET.THE.        TAACATAC-TCATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT-----
                *  *     * * ** *      ***   * *    *  * ** *** ****        

HOM.SA_B        T
TET.THE.        -
                 

[Download ClustalW]

#478

Mean pairwise ID: 44.52%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGAACTT
RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
                   ** *   *   *     ******  ** **      ** * *  *   *  **   *

HUM.LU_C        TGGGTCAACCCAGTGGTNCGGGNCCAGTGCTAGCTGC-TTACCCGGCTGCCCATTCCAAG
RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                 *  * *  ****  ** * ** *    *   ***        *** ** **   * ***

HUM.LU_C        CCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACT-CCTAGACTGGAG
RAT.RAT.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
                   **        **  *  *    * **  *         *    * ****    ** *

HUM.LU_C        GGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAG
RAT.RAT.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
                 * *  *    ***  **    ** ******     * ******  **   **** *  *

HUM.LU_C        GATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGAC
RAT.RAT.        GAT--CGCGCCTGTGAAT----AGCCACTGCACTCCAGCCTGGGCAACA--TAGCGAGAC
                ***  ** *** ***       *****   *  * ** *  **   **   **    ***

HUM.LU_C        CATTTCTTTT
RAT.RAT.        CCCGTCTCTT
                *   *** **

[Download ClustalW]

#479

Mean pairwise ID: 44.52%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGG-GGCATTAAGGTGGTGTGGATG-
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *   *       * *  **     ********* 

ZEA.MA_F        --TTTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTC---GACCGAGC-GTCCGTGCC
                  *     ** *  * *** *  **   **** *  * *   * ***  * * **** **

ZEA.MA_F        AAGTTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAG-ACCTGAAGCG
CAE.EL_A        AAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAG
                ***      **  *  * **    * * ** * * * *    **    *  * * * * *

ZEA.MA_F        GCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTG
CAE.EL_A        TCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGC-AGTGGCC
                 *  * ****     * * *         **     * *   ***  * * * *  **  

ZEA.MA_F        GGAGGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGAC
CAE.EL_A        GGACCGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCA---GACCACT
                ***        *   * **     **  * ** *    ** * * * ***    **    

ZEA.MA_F        CACCATCTTT
CAE.EL_A        TATCATTT--
                 * *** *  

[Download ClustalW]

#480

Mean pairwise ID: 44.52%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATG------GGGGCATTAATGTGG-TGG
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                  ** *  * **   * * ** *** *  **  *       **   *  * ***** ***

LYC.ES_B        AATGTTGGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCA
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAA--CGGCGACCGAGC-GTCCGTGCCA
                * **  ***  *   *   *** **   * **           * **   * **   ***

LYC.ES_B        AGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGG
CAE.BRI.        AGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGT
                ***   * ** *      **  **     ****    *   * *  *   * *** * * 

LYC.ES_B        GGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTGGA
CAE.BRI.        GGTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGC
                ** * *  **    *** *     *   ****   * ***   **** *   ** **** 

LYC.ES_B        AGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAAAC
CAE.BRI.        CGGATAGCGCTTGTGAGTTGTC--GCTCGCCCACAGCCTCTCTGATACCTTCAGACCACT
                 ***** **  *  * *** **    **    *  ****    *    **  *    *  

LYC.ES_B        CACCACTTTT
CAE.BRI.        TGTCATT---
                   ** *   

[Download ClustalW]

#481

Mean pairwise ID: 44.59%


TRI.AE_B        -NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGGCATTGAGGCGGTGTGGATGCT
LEP.COL.        GCCGGAGCC--TTGC-----TCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                  * ****   ****       *** ***   * ***         ** *    *     

TRI.AE_B        TGGTGCGGTTTGTTGGCCTGGGCTTGTGATGTAACCTTGCTGGCCTGCCCGTTCCAAGTT
LEP.COL.        TG-TCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGT
                ** *  **           * ***** *  **   * ** **  ****  *        *

TRI.AE_B        GGTAGTGGGCTGGGTGGCTGGG-GCGAAAGCTTCGCCTTCTCAGGCCTTAAGTGGCAGGC
LEP.COL.        CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAG-AGGA
                 * **    * ***** *     **  ***   ***   * *     * **** * *** 

TRI.AE_B        ACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCCGCTT-CCAACGGTGGAAGGAT
LEP.COL.        ACTGGGTCAGGCCGGCA--ACGGAGCAGCC-CACCTCGCGCACGTCTGCCGTTGCAGAAC
                **   ** **** **    ** *******  ** **  ***    *  * ** * ** * 

TRI.AE_B        AACAGGCCGCTGCAGCATGGGCCCGCTCTGGGCCTCCTACCCCGCCATAGCAGACCACCA
LEP.COL.        CACA--CCGCGG-AGCCTGTCATCAC-CTGCGCCCCAGGCGATCCTGTGAAGCTTT----
                 ***  **** * *** **    * * *** *** *   *    *  *            

TRI.AE_B        TCTTT
LEP.COL.        -----
                     

[Download ClustalW]

#482

Mean pairwise ID: 44.62%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG-ACGGTAGATAAGTGTGGATG
                 ******   ** *** * ** *** *  **       * **   ** *   ** *****

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGT-AATCTTGCTGGCTTGCCCGTT
CAE.EL_B        G--AGTGAGAGGAGGAGTCCTGTGT---ATGTCGTTGTCAACGTCGACCGAGCGTCCGTG
                    *** *        ***** *    **** ***** **  * *   *   * **** 

ORY.SA_A        CCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCC
CAE.EL_B        CCAAGCGCTGCGTC--ACCAGGGGATGACTGTCGGAAGA---TGGTCAG--TCCCGGGTG
                *****    *       ** * **     ** ** * *    ** *  *  ** * **  

ORY.SA_A        CTAAAGTGGCAG-GCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
CAE.EL_B        CATAAGGAGTGGTGGATGGTTCAGGACCGA------AAGGTAGCAGACAAAAGCCACCGC
                *  ***  *  * * *  *     * * *       *  * ***   **    ** *  *

ORY.SA_A        CATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTC
CAE.EL_B        -----GCGGTGCAGTGGCCGG--ACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCT
                     * **     *  * **   **** * *  *    *   *     ** ** *    

ORY.SA_A        TACAAC----AGACCACCATCTTT-
CAE.EL_B        CAATACCTTCAGACCACTTGTTTTT
                 *  **    *******    *** 

[Download ClustalW]

#483

Mean pairwise ID: 44.63%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCA-GTGTGGTGGAATGTT
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGG------
                    ***      ** * *   ******    * * *   ***  *  * * **      

LYC.ES_C        GAACATGCCCAGAAGGTAGGGCTTGTGTGACAATTCTCTGGCCTGCCCTGTCCAAGCAAA
TRY.BR_A        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGG--TGTTCTG-CTTGGTTGC
                * ** *       * *  *** ** ***  *  *    ***  **  *** *   *    

LYC.ES_C        GAGTTGGGTCTTGTGGGC-CAAGCGAAGGCTTGGGCTGCTGGGCTCCTAAAGTGGGGTGG
TRY.BR_A        GTGTCGG-TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGA
                * ** ** * *** ** * * *  * **    * * *   * **   ********** * 

LYC.ES_C        ACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGTGCAGTGGAAGGAT
TRY.BR_A        ACGG-GTCAGGCCGGTGACGGAGCAGCCCACCTTGCGCACGTTCC-CGTTCGAGAAGCAC
                ** * ** **** ***  *  **     *   * ** * ** **   *     **** * 

LYC.ES_C        AACGAGCCAGTGTCATATAAGTTCAACGAATGTCTGATGGGCTGTT-CTAGTTAAACTAC
TRY.BR_A        ACCGAGG-AGCATCTCAGGACTTTG-----CGCCCCAAGTGTCGTCGCGAGGCGG-----
                * ****  **  **  *  * **        * *  * * *  **  * **         

LYC.ES_C        CACATTT
TRY.BR_A        -------
                       

[Download ClustalW]

#484

Mean pairwise ID: 44.65%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTA---CTCGGGAGGCTGAGGTGGGAG
                **** ** * ** *** * *******  ** ***     * *   ***  *  * **  *

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
HOM.SA_B        GATCGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATGGGGTGTCCGCAC
                  * *  **    * *    *  *  *  *  **  *  **   * ***  ** ***  *

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
HOM.SA_B        TAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG------CC
                 *****  * *       ** *       **    **          * **       **

ORY.SA_A        TAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCA
HOM.SA_B        TAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGA
                *** * **   * ** *    ***  **    ** ******     *   ****     *

ORY.SA_A        TCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCTA
HOM.SA_B        TCAGTAGTGGGATCGCGC----CTGTGAATAGCCACTGCACTCCAGCCTGAG---CAACA
                ** ** *  ****  *      ***    * *   * **       ** ***   *   *

ORY.SA_A        CAACAGACCACCATCTTT
HOM.SA_B        TAGCGAGACCCCGTCTCT
                 * *    * ** *** *

[Download ClustalW]

#485

Mean pairwise ID: 44.66%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTG---GGGACAATAAGGTGGTGGAACA
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGC--TGGCGGA
                * ** *    **  ** * ** *** * ** **     ****   * ***   ***   *

ARA.TH_D        GTGGTTCAATTCCTCGGGTCGGACCTGATGCTGAC-ATATATCTGAGCTGCCCAGTCCAA
FUG.RUB.        TCGCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAA
                  * ** *  **    * ** *  **   ** *** ** *   *  * ** **   * **

ARA.TH_D        GCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGA
FUG.RUB.        GTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGG
                * *  *  *       ***   * ** * ** *  *  ***   **   *  ***  ** 

ARA.TH_D        GGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGAT
FUG.RUB.        GTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTG
                * *    *    ***  **    **  *****     *   ***        **** *  

ARA.TH_D        GGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGAC
FUG.RUB.        GGATCGCGCCCGTGAAT-----AGA--CGCTGTAGTTCAACCTGAGTAACACAGCGGGAC
                *****         * *     ***  * ** * *  *         * * *  * ****

ARA.TH_D        CACCACTTT
FUG.RUB.        TCAGTCTTT
                     ****

[Download ClustalW]

#486

Mean pairwise ID: 44.69%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTAGTT-
TET.THE.        ----------GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTG
                              **   * **  *  ***     ****** * *    *  *  *** 

HUM.JA_B        CGGCCCATTGGATCGGATCCAGTGTTAG--CTGCTTGCTGGGC---TGCCCATTCCAAGC
TET.THE.        TGATAGATAGGATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAAC
                 *    ** ****  **     ** *    * * *****  *    *****  ***** *

HUM.JA_B        CGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCTAAAGCGG--A
TET.THE.        AATGAGTT--GCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTA
                   *****  *** **   *           *  * **    ***  * * **   *  *

HUM.JA_B        GGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGAA
TET.THE.        AGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAA
                 ** ** ** * *******    ***** *** ** *** * *****    *  ******

HUM.JA_B        GGATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGGA
TET.THE.        GGATAACATACTCATTAACTGTCAAACTAATCGGTTCTACTA--TCAAAGCCAGACATT-
                *******   *   *      *  * * *    * *  ***      *  *   * *   

HUM.JA_B        CCATTTCTTTT
TET.THE.        -----------
                           

[Download ClustalW]

#487

Mean pairwise ID: 44.69%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGG-TGGCTGCGGAT
RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTA---CTCGGGAGGCTGAGGACAGAG
                **** ** * ** ***   *******  ** ***     * *   *** **    * ** 

ORY.SA_A        GTTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTT
RAT.RAT.        GATCGCT-TGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCA
                * * * * **  * * *    *  *  *  *  **  *  **   * * *  ** ***  

ORY.SA_A        CCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCC
RAT.RAT.        CTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG------C
                * *****  * *       ** *       **    **          * **       *

ORY.SA_A        CTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCC
RAT.RAT.        CTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTG
                **** * **   * ** *    ***  **    ** ******     *   ****     

ORY.SA_A        ATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCT
RAT.RAT.        ATCAGTAGTGGGAT--CGCGCCTGTGAATAGCCACTGCACT-CCAGCCTGGG----CAAC
                *** ** *  ****  *  **   ** *         * ** *  ***  *     *   

ORY.SA_A        ACAACAGACCACCATCTTT-
RAT.RAT.        ATAGCGAGACCCCGTCTCTT
                * * *    * ** *** * 

[Download ClustalW]

#488

Mean pairwise ID: 44.69%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTA---CTCGGGAGGCTGAGGCAGGAG
                **** ** * ** *** * *******  ** ***     * *   ***  *  ** *  *

ORY.SA_A        TTTGGTGTGGATTCTGA--TCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGT
CAN.SPE.        GATCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATG---CCGATCGGGTGTCCGC
                  * *  **    * *   * ******  **    * * *      * * *  ** *** 

ORY.SA_A        TCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGC
CAN.SPE.        ACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG------
                 * *****  * *       ** *       **    **          * **       

ORY.SA_A        CCTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
CAN.SPE.        CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT
                ***** * **   * ** *    ***  **    ** ******     *   ****    

ORY.SA_A        CATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTC
CAN.SPE.        GATCAGTAGTGGGATCGCGC----CTGTGAATAGCCACTGCACTCCAGCCTGTG---CAA
                 *** ** *  ****  *      ***    * *   * **       ** * *   *  

ORY.SA_A        TACAACAGACCACCATCTTT
CAN.SPE.        CATAGCGAGACCCCGTCTCT
                 * * *    * ** *** *

[Download ClustalW]

#489

Mean pairwise ID: 44.70%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TET.ROS.        ----GCCAGGGTAGCAA-TGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAAT--
                      *   ** **    ** *****    *  *         *    ***  * **  

CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTT----GCTAAGAGTGTGCCCGTTCCAAAC
                *** **** * ***   *   *  * *  * *    *   *  * * * **** **** *

CAE.EL_B        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGGT
TET.ROS.        AGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAG
                  ** **  * * **    *   * * ** * *      ** ***     ***   **  

CAE.EL_B        GGATGGT-TCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGGAC
TET.ROS.        GAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGAT
                * *  *  *****   * **   * ***  ****    ****    **  ****  *** 

CAE.EL_B        TGCG--CTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTTT
TET.ROS.        AACATACTCATTAACTGTCAAGC-TAATCGGTTCTGCTATTCTGATCAGAC-ACT-----
                  *   **  * *  ** ** *  **  * *   *   * *    ****** ***     

CAE.EL_B        TT
TET.ROS.        --
                  

[Download ClustalW]

#490

Mean pairwise ID: 44.70%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
TET.ROS.        GCCAGG----GTAGCAA-TGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAG
                 ** **    ** **    ********    *  *         *    ***  * ** *

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
TET.ROS.        TCAGAGTATGAGAGTTTGATGAG-ACAGTTTGCTAAGA-----GTGTGCCCGTTCCAAAC
                   **      ****    ** *    **  ** * *      * * * **** **** *

CAE.BRI.        GCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTGGT
TET.ROS.        AGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAG
                  ** ** ** * **        * * **          ** ****    ***   **  

CAE.BRI.        GCACGGCTCAGGGCCGA-AAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCCGGAT
TET.ROS.        GAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGAT
                * ** **    *** *  **   * **** ****    ****    **  ****  ****

CAE.BRI.        AGCG--CTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTTGTCA
TET.ROS.        AACATACTCATTAACTGTCAA--GCTAATCGGTTCTGCTATTCTGATCAGACACT-----
                * *   **  * *  ****    **  *  *  ***   ** *        ****     

CAE.BRI.        TT
TET.ROS.        --
                  

[Download ClustalW]

#491

Mean pairwise ID: 44.72%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAGTCAGA
LEI.MAJ.        GCCGGAGCTCTGCT--CTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGG
                *** * *      *  **** ****   * ***  *       ***   * *      * 

TET.ROS.        GTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGAGTTGCT
LEI.MAJ.        ACCAGCGAG---GGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGCTGTGTGTCGGT
                    * ***   * ***     *  * * *    **** * * *    * *** ** * *

TET.ROS.        ATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAGG-AACCGCCTC
LEI.MAJ.        GTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAACCGGGTC
                 ***      **     * ***    * *  *  *      **   **** *****  **

TET.ROS.        AGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATAACATACTCA
LEI.MAJ.        AGGCCGGAAACGGAGCAGCCCACCCCACGCACGT-CCGCCGTTGCAGAATCACAC-CGCG
                **** ** *** ** ***   *  *    * * *   *  ** * ** ** ***  * * 

TET.ROS.        TTAACTGTCAAGCTAATCGGTTCTGCTATTCTGATCAGACACT-
LEI.MAJ.        GAGCATGTCC-GCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT
                     ****  **   *  *  *  *  ***    *  *  ** 

[Download ClustalW]

#492

Mean pairwise ID: 44.73%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     *** ****  

ZEA.MA_E        TTTGCGATG--GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATG---TCGTTGTCTACGTC-GACCGAGC-GTCCGTGC
                  ** ** *  *  * *** *   *   *** * * * * *  * ***  * * **** *

ZEA.MA_E        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.EL_A        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                ****      **  *  * ***    *    * * **  *     *      * * * * 

ZEA.MA_E        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTTCCAACGGT
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAG-CGACCGCGTGGTGCAGT
                * *  * ****     * * *     *   *****  *  *  ** * ** *    * **

ZEA.MA_E        GGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCC-CAGAGCCTCACTAAGCA
CAE.EL_A        GGCCGGAC--CGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACC
                **  ***   ** **   **   *   *  *  ** *** *  *       *   *  * 

ZEA.MA_E        GACCACCATCTTT
CAE.EL_A        ACTTATCATTT--
                    * *** *  

[Download ClustalW]

#493

Mean pairwise ID: 44.73%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAAC--TCAAGTGAGGGCATCAGTGTGGTGGAATGT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                        * * *** * *   ******  **  * *    ** ***       *   * 

LYC.ES_C        TGAACATGCCCAGAAGGTAGGGCTTGTGTGACAATTCTCTGGCCTGCCCTGTCCAAGCAA
LEP.COL.        TGTCTGGACC---AGCATAGGGTGCTTGCGGCGTTGACGTGG--TGCTCTGCTTGGCTGT
                **      **   *   *****    ** * *  *    ***  *** ***         

LYC.ES_C        AGAGTTGGGTCTTGTGGG-----CCAAGC-GAAGGCTTGGGCTGCTGGGCTCCTAAAGTG
LEP.COL.        GTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCT--CCGTTAAAGTA
                      * * * *  ***     **  ** *****   * **  *    *   ****** 

LYC.ES_C        GGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTC-TGTGCAGTG
LEP.COL.        GAG-GAACTGGGTCAGGCCGGC--AACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTT
                * * * **** ** **** **    ** ***** *    * *** *** * * *** ** 

LYC.ES_C        GAAGGATAACGAGCCAGTGTCATATAAGTTCAACGAATGTCTGATGGGCTGTTCTAGTTA
LEP.COL.        GCAGAACCACACCGCGGAGCCTG------TCATCACCTGCGCCCCAGGCGATCCT-GTGA
                * ** *  **    * * * *        *** *   **       ***  * ** ** *

LYC.ES_C        AACTACCACATTT
LEP.COL.        AGCTTT-------
                * **         

[Download ClustalW]

#494

Mean pairwise ID: 44.74%


HUM.LU_C        GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTGGGT
TRY.BR_B        AGCCGGAGCGCATTGCTC-TGTAACCT--TCGGGGGCTGATCCCGCTTAGCG----GGGA
                 * *  ***   *** ** *******     ******   *      * *      *** 

HUM.LU_C        CAACCCAGTGGTNCGGGNCCAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAAGCCGGGA
TRY.BR_B        CGTCTTGGACAAGCGGGGGTTCTGTTG--CGTTGACTTGGTGTTCTGCTT--GGTTGCGT
                *  *   *     ****     ** *    * * **  **    *   *    *  * * 

HUM.LU_C        GGTGG-GCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACTCCTAGACTGGAGGGCAAT
TRY.BR_B        GTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGG-AAC
                *  ** * *****   *      *  *         *** *   ** * *** *** ** 

HUM.LU_C        GCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGATAAC
TRY.BR_B        GGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGAAGCAC
                * ** **** **  * ** *******  * ****  *** *    * ** * ** *  **

HUM.LU_C        GGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGACCATTTC
TRY.BR_B        ACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTG-------TCGTCGCGAGGCGGTTT-
                     ** **  **   * *    *    *** **       ** *     * *  *** 

HUM.LU_C        TTTT
TRY.BR_B        ----
                    

[Download ClustalW]

#495

Mean pairwise ID: 44.76%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGT--------GGAGACAATAAGGGGATG
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAA-GTGTGGATG
                  **      **  ** * ** *****  **  *        * ******   * *****

ARA.TH_C        GGACGTTGGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCCCGCCCAT
CAE.BRI.        GAGTGAAGGGAGGAGTCCTGTGGGT-GTTGTCGGCAACGGCGACC-----GAGCGTCCGT
                *   *  ***  **   *  ****  *   ****    *** *       *  ** ** *

ARA.TH_C        TCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGC--GAAGGCTCGGGTCTCATGTCTTCTA
CAE.BRI.        GCCAAGCGCTGCGTCG--CCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATA
                 *****    * ** *   ** ***  **  *   ******* * *   *  * *   **

ARA.TH_C        GAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGAC
CAE.BRI.        AGGAGTGGTGCACGGCTCAGGGCCGA---AAGGCAGCAGGCAAAAGCCACCGCGCGGTGC
                  * * **   ** **    *** *     *   *****     * *  **** *    *

ARA.TH_C        GGTGGAAGGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGA
CAE.BRI.        AGTGGCCGGATAGCG--CTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAG
                 ****  ****  **  *   **  **      *  * *   **          ** *  

ARA.TH_C        TTGGACCATCACTTT
CAE.BRI.        ACCACTTGTCATT--
                        *** *  

[Download ClustalW]

#496

Mean pairwise ID: 44.77%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-G
                    ***       * * *   ***** *   * **    ***    *    *   *  *

LYC.ES_H        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTC-TGACTTGCCCTATCCAAGCTTA
TRY.BR_B        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCG
                   ** ** **  **  **   ** ** * * * **  **   ***    *      *  

LYC.ES_H        GAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
TRY.BR_B        GTGTTGAG----GTCGCC--ACTGTAGAGA-GGCGTTCTCGCGCCGTTAAAGTGGGGGGA
                * ****      ** ***  * ** *** * **  * ** *   *** **   *** ***

LYC.ES_H        ATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGC-TCTGTGCAGTGGAAGGAT
TRY.BR_B        ACGGGTCAGGCCGGT--GACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGCAC
                * * ** **** ***   ** ******   **    * * * *    *  *  **** * 

LYC.ES_H        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCA
TRY.BR_B        ACCGAGG-AGCATCTCAGGACTTT-----GCGCCCCAAGTGTCGTCGCG--AGGCGGTTT
                *  * *   *  *** *  *  **      ****  * * ** *   *   *  *     

LYC.ES_H        CCTTTT
TRY.BR_B        ------
                      

[Download ClustalW]

#497

Mean pairwise ID: 44.77%


LYC.ES_O        GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
YAR.LI_B        -------------AGCTGTAATGGCATTTT--GTCGGAGTGGTAAATCGCCTTCTTGTTG
                             *  **   * * *      ** **  ** ***   *      * ***

LYC.ES_O        GGCTGTCCCAGATGGCTGGGCTTGG---TGGGCTAATTTCTGGCCTGCCCTATCCAAGCA
YAR.LI_B        TGC-GTTCGAGTT--CTGGACTCTGCACTGGGCTACTTTGT----TGTCCTTTCCGAATT
                 ** ** * ** *  **** **  *   ******* *** *    ** *** *** *   

LYC.ES_O        CAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTG
YAR.LI_B        CTGCGGTTGAT-GGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                * * * * ***   * *   *  *   *  *** ****   ***** *     *  * * 

LYC.ES_O        GACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGA
YAR.LI_B        AACTGGGATACTTCAGTGGAGCAATCCAGCAGAGA---TCCAGTT---GCCGTGG--GTA
                 ** * *  *     **    **   ** *  * *   ***  **   ** ****  * *

LYC.ES_O        TAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCAC
YAR.LI_B        TGGCGGTGGGATAGCAACAAAGTGGTATATGT-TATGGAAGGTATTTGCAATCACGACTC
                *  ***   * *  *  * ****   **   *   **   **    * **** *   * *

LYC.ES_O        CACTTT
YAR.LI_B        TC----
                      

[Download ClustalW]

#498

Mean pairwise ID: 44.77%


LYC.ES_G        GCCG-AGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTT
LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGG--CTTAGCGGGGAGGACG---
                **** ****  *   ***   ***      * **   **   ***  * ** ***     

LYC.ES_G        GGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACA
LEI.MAJ.        ----TGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTC
                    ** *****   *   *  *** ** * * *  *   **    * *  *   *    

LYC.ES_G        GAGTTGGATCATGTGGTCCAATTGAAAGAATGG-GCTACTAGATTCCTAAAGTGGGGTGG
LEI.MAJ.        GGTGTGGCT----TGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGG-GA
                *   *** *    **  **  *  * **  *** **   *       * *** * ** * 

LYC.ES_G        ACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGAT
LEI.MAJ.        ACCGGGTCAGGCCGGA--AACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAGAAT
                **** ** **** **    ** ***** *  *   *   * * *   ** ** * ** **

LYC.ES_G        AACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACC
LEI.MAJ.        CACACCGCGGAGCATGTC----CGCACTTGAGCCCCACGCTTCGTCGCGA---AGCCTT-
                 **    *** ** *  *      ** *   ***  * *    *   * *   * **   

LYC.ES_G        ACTTTT
LEI.MAJ.        ------
                      

[Download ClustalW]

#499

Mean pairwise ID: 44.81%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG-TGGAGACAATAAGGGGATGGGACGTT
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                * **  * * **  ***  ** ***  *** ** *       *    * *   *   * *

ARA.TH_C        GGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTG-GCCCGCCCATTCCAAG
GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
                 * * ** * **   *  * **   *   ** *****     * *  ** **   * ***

ARA.TH_C        TTGGGAGTTGAGGCA-TGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGG
GAL.GAL.        GCCGGCATCAATATGGTGAGCCCCGGG-GAGCCGAGGCACACCAGGTTGCCTAAGGAGGG
                   **  *  *     ** **  ** * **      *     ** **   ***  * ***

ARA.TH_C        GGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAA
GAL.GAL.        GTGAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACG
                *   ****    ***  **    ** ******     * ******  *  * * **    

ARA.TH_C        GGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACC
GAL.GAL.        GGATCGCG--CCTGTGAATAGCCACTGCAGCGTAGCCTG----GGCAACATAGCGAGACC
                ****  **  **  **  *  * *   **   *  **      * *          ****

ARA.TH_C        ATCACTTT
GAL.GAL.        CTGTCTCC
                 *  **  

[Download ClustalW]

#500

Mean pairwise ID: 44.81%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGGATGCT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTT--CGGGGGCTTTCACCAGCTGAACA-GGG
                        * * ***       *******    ******* ** *   * **   * *  

ZEA.MA_C        TGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAGTT
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 * *  *  * *       **** * **  * *     ** *  **   * *  *    *

ZEA.MA_C        GGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTGGCAG
LEP.COL.        GTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAG-AG
                *   * ****   **  **      * **     * **  **       ** *** * **

ZEA.MA_C        GAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGGAAGG
LEP.COL.        GAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCAC-CTCGCGCACGTCTGCCGTTGCAGA
                **** * ** **** * *   ** *******   * **  **    *   * ** * ** 

ZEA.MA_C        ATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAGACCA
LEP.COL.        ACCACA--CCGCGG-AGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT---
                *  ***  ** * * *** **   ** * *  * ** ** *       * ****      

ZEA.MA_C        CCATTTTT
LEP.COL.        --------
                        

[Download ClustalW]

#501

Mean pairwise ID: 44.81%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
LEI.MAJ.        -----GCCGG--AGCTCTGCTCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGGGGAGG
                     **     * *       *******   * ****  *   **     *       *

ARA.TH_E        GTTCGGGTCCACGGGCCGGTTCTGTTG--TTGGCATGTTTCTGGGCTGCCCAGTCCAAGC
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCT---CTGCTTGG--CTGTG
                    **  *  ** *   * * ** **  *** * ** * **   ****   *  *    

ARA.TH_E        TGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAGG
LEI.MAJ.        TGTCGGTGTGGCTTGC-CCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGC--GAGG
                ***  **  * * **     *  **  *** * *       * **   * ***   ****

ARA.TH_E        GTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA-CAGCAGTGGACG
LEI.MAJ.        GAACCGGGTCAGGCCGGAA--ACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCAG
                * *  * ** **** **    ** *******  * **  * ***    * ** ** *  *

ARA.TH_E        GATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACC
LEI.MAJ.        AATCACACCGCGGAGCATGTCCG---CACTTGAGCCCCACGCTTCG-TCGCG---AAGCC
                 ******     * *    ** *   ****   ***    * * ** ** *     * **

ARA.TH_E        ACCATTTT
LEI.MAJ.        TT------
                        

[Download ClustalW]

#502

Mean pairwise ID: 44.81%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGG--AAATGGGACTT
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                     **       * * *  ********   * ***   **   *   *   ***** *

HUM.LU_D        TGGGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGC
TRY.BR_A        C---TTGGACAAGCGG---GGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                    *    * ** **   **** * **        ***  ** *****    *      

HUM.LU_D        CGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCTGGGTTGCGCAGCTCCTAGAGTGGAGGG
TRY.BR_A        TCGGTGTTGAG----GTCGCCACTGTAGAGAGGCGTTCTCGC-GCCGTTAAAGTGGGGGG
                  ** **** *    **  **   *   **    * *  *** **   ** ***** ***

HUM.LU_D        CAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGA
TRY.BR_A        -AACGGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAA
                 ** * ** **** **  * ** *******  * ****  *** *    * **   ** *

HUM.LU_D        TAACGGGCCGGTGCTACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGGACCA
TRY.BR_A        GCACACCGAGGAGC-ATCTCAGGACTTTGCGCCCCAA-GTGTCGTCGCGAGGCGG-----
                  **     ** ** * **     *     **  **  * *  * * *      *     

HUM.LU_D        TTTCTTTT
TRY.BR_A        --------
                        

[Download ClustalW]

#503

Mean pairwise ID: 44.81%


LYC.ES_G        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTT--CGGGGGC--TGATCCCGCTTAGCG--G
                    ***         * *   *******     ******  * **   *   *  *  *

LYC.ES_G        GGCTGTACCAGATGGTTGGG---CTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCA
TRY.BR_A        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACT--TGG--TGTTCTGCTTGGTTG
                **  **    **     ***     ** ** * * * *  ***  **  **         

LYC.ES_G        CAGAGTTGGATCATGTGGTC-CAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGT
TRY.BR_A        C-GTGTCGG-TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-
                * * ** ** *  ** **** * * ** *   * * * *          ********** 

LYC.ES_G        GGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGG
TRY.BR_A        GGAACGGGTCAGGCCGGT--GACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTCGAGA
                *** ** ** **** ***   ** ***** *  *   *** ***    * * **   ** 

LYC.ES_G        ATAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCA
TRY.BR_A        AGCACACCGAGGAGCATCTCAGGAC---TTTGCGCCCCAAGTGTCGTCGCGAGGCGG---
                *  **     ** ** *  ** *     **   ***  * * *  *   * *        

LYC.ES_G        CCACTTTT
TRY.BR_A        --------
                        

[Download ClustalW]

#504

Mean pairwise ID: 44.82%


GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
SCH.POM.        ------------------CGC-TGTAATGGC--TTGGTCGAAGTGTTTAGTACTCCCAAT
                                  *** **** *  *   *  ***    * * **  * **  **

GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTAAG
SCH.POM.        AGTGCATGTTCGGTGGTCTCGGGTTCGAGT-CTCGCTTTCGATCCCTCGATC-TGCCACG
                 *     *  * *  **   *** *  *** * *  *  *** *   **  *  ** * *

GAL.GAL.        GCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGGG
SCH.POM.        TCTG---TTCGAAGAGTAGTCTTCGTGG----------CAACTGGCAGT-TAAACCGTGT
                 * *   *    *  **   *  ** **          ** * **  *  ***   * * 

GAL.GAL.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACGGGA
SCH.POM.        AGTACCGATGGAGGTTGGAAACAATGCACATCA---CTACCGGGTCT-TGGGCAGTGCGA
                 * ****    **** ******   ***  ***   ** *** * *  *  * *  * **

GAL.GAL.        TCGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCTGTCTCC
SCH.POM.        TAGCGA-TGGGATTCACCTTCGCAGGATGTGCATGGAAGTATAAACACAACG-GTCGTT
                * ***  ** ** *  **   ****  *   *  ** *  ***   * * *  ***   

[Download ClustalW]

#505

Mean pairwise ID: 44.82%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
TRY.BR_A        ------AGCCGGAGCGCAT---TGCTCTGTAAC--CTTCGGGGGCTGATCCCGCTTAGCG
                       ** *  ***  *   **   *  * *  *** * **  **  *   *  * **

XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
TRY.BR_A        GGGACGTCTTGGACAAGCGG---GGGTTCTGTTGCGTTGACTTGGTGTTC-TGCTTGGTT
                     ***  ***     **   *   *  * *  ** **   ***** *   **  ***

XEN.LAE.        CGGTATCAATATGGTGTTC-CTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGG
TRY.BR_A        GCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTT--AAAGTGGGG
                  ** **  * * * * ** *    * **    *  *   *  *  * *  ** * ****

XEN.LAE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGGA
TRY.BR_A        GGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTCGAGAA
                 **** **  **** ***  *********  **   *   **  *    * **    * *

XEN.LAE.        TCGCGCCTGTGAATAGC-CGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGTTCT
TRY.BR_A        GCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG------
                 * * **   **  * * * *  *    *  **  *    *   ***** *        

[Download ClustalW]

#506

Mean pairwise ID: 44.84%


HUM.LU_B        ---GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                   *  * * *   ** * ** *** *  **  *    *   ** *  **  *   ** *

HUM.LU_B        GGTCAGCCCAGTGGATCGG-GTCCAGTGTTAGCTGC-TTACTGGTCTGCCCATTCCAAGC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 ** **   **  *  * * **     **   ** * *     *   * ** * ******

HUM.LU_B        CGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGG
CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
                     **      * *  * ***   ******      * *   *  * **  * *  * 

HUM.LU_B        GCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAGG
CAE.EL_D        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGG
                * *  *     * * *     *   *****  *  * *  ****     *******  **

HUM.LU_B        ATAACGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACCA
CAE.EL_D        AC--CGCGCTTGTA--AGTTGACACAC-ATACACAGCCTTCTCGATACCT--TCAGACCA
                *   ** **  **   * ***   *** **   **    **  **  * *  ** *****

HUM.LU_B        TTTCCTTT--
CAE.EL_D        CTTATCATTT
                 **    *  

[Download ClustalW]

#507

Mean pairwise ID: 44.84%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTG
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
                   ** *   *   * **  ******* ***  *    * * *   *   **     * *

HUM.LU_C        GGTCAACCCAGTGGTNCGGGNCCAGTGCTAGCTGC-TTACCCGGCTGCCCATTCCAAGCC
XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
                  * *  ****  ** * ** *       ****   *    *** ** **   * ***  

HUM.LU_C        GGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACTCCTAGACTGGAGGGC
XEN.LAE.        CGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGGT
                 **        **  *  ****** **            *    * **  *  *  *** 

HUM.LU_C        AATGCG--TGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGG
XEN.LAE.        GAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGG
                 *  **    ***  **    ** ******     * * ****  *    **** *  **

HUM.LU_C        ATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGAC-
XEN.LAE.        AT--CGCGCCTGTGAAT----AGCCGGTGCAGAACAGCCTGAACAACAC--AGCGAGACA
                **  ** *** ***       ****    * *  ** *  *    ** *  *    *** 

HUM.LU_C        CATTTCTTTT
XEN.LAE.        CAGTTCT---
                ** ****   

[Download ClustalW]

#508

Mean pairwise ID: 44.85%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
TET.THE.        ----GCCAGGGTAGCA-ATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTG-AT
                    * *  *** **     *****      *  *       *   **  *   * * **

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.THE.        AGATAGGATATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGCTCCAAA
                 * * *       *****    *   ****  ****     *  * *** **** * ** 

CAN.SPE.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                    *  *   *******    **  * *   **   ********      ***      

CAN.SPE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 *** ** * ****  ** *** ** ****  ***  * ***         ** *  ***

CAN.SPE.        T--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTC
TET.THE.        TAACATACTCATTAACTGTCAAACTAATCGGTTCTAC-TATCAAAGCCAGACATT-----
                *  *   *   * **  * **    * **    **    * ** *** ****        

CAN.SPE.        T
TET.THE.        -
                 

[Download ClustalW]

#509

Mean pairwise ID: 44.85%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAG-
                             **    **   * *  *      **  ** ******  * *      

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCACTAA
TRY.BR_A        CGGGGACGTCTTGGA----CAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTC-TGCTTG
                **     ***  ***       ** *  ** * * *  *  **   ***** *   **  

RAT.NOR.        GTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGG
                ***  *  **  * * * *  * ** * * ** * **      *  *  *  *** * **

RAT.NOR.        GGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
TRY.BR_A        GGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTCGAG
                ** **** **  **** ***  *********  **   **  **  *    * **    *

RAT.NOR.        GATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGTCTC
TRY.BR_A        AAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG-----
                 * * * **   **  * * **   *  * *  **   *   * * ***** *       

RAT.NOR.        T
TRY.BR_A        -
                 

[Download ClustalW]

#510

Mean pairwise ID: 44.86%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG-ACGGTAGATAAGTGTGGATG
                 ******   ** *** * ** *** *  **       * **   ** *   ** *****

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTA-ATCTTGCTGGCTTGCCCGTT
CAE.EL_A        G--AGTGAGAGGAGGAGTCCTGTGT---ATGTCGTTGTCTACGTCGACCGAGCGTCCGTG
                    *** *        ***** *    **** *****  *  * *   *   * **** 

ORY.SA_A        CCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCC
CAE.EL_A        CCAAGCGCTACGTCA--CCAGGGGATAACTGTCGGAAGGC----GGTTAGTCCCGGGTGC
                *****            ** * **     ** ** * * *      **  * *   *  *

ORY.SA_A        CTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCC
CAE.EL_A        ATAAGGAGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGG
                 *** * * *  * *  *     * * *     *   *****  *  *  * **** *  

ORY.SA_A        ATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCC--CAGAGTCCCT
CAE.EL_A        TGCAGTGGCCGGAC--CGCGCTTGTG-AGTTGACACACATACGCAGCCTTCTCGATACCT
                  * ****  ***   *  ***  ** *  *    * *       ***  *    * ***

ORY.SA_A        CTACAACAGACCACCATCTTT
CAE.EL_A        TCA-GACCACTTATCATTT--
                  *  **     * *** *  

[Download ClustalW]

#511

Mean pairwise ID: 44.87%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     *** ****  

ZEA.MA_G        TTTGCGATG--GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATG---TCGTTGTCTACGTC-GACCGAGC-GTCCGTGC
                  ** ** *  *  * *** *   *   *** * * * * *  * ***  * * **** *

ZEA.MA_G        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.EL_A        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                ****      **  *  * ***    *    * * **  *     *      * * * * 

ZEA.MA_G        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCAACGGTG
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                * *  * ****     * * *     *   *****  *  *  * **** *    * ***

ZEA.MA_G        GGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCC-CAGAGCCTCACTAAGCAG
CAE.EL_A        GCCGGAC--CGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACCA
                *  ***   ** **   **   *   *  *  ** *** *  *       *   *  *  

ZEA.MA_G        ACCACCATCTTT
CAE.EL_A        CTTATCATTT--
                   * *** *  

[Download ClustalW]

#512

Mean pairwise ID: 44.87%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCT-----TCTTGACGGTAGATAAGTGTG
                   **** * **  ** * ****** *  **  *     * ** * *      **   **

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_D        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *      ***   * * ** *   ***  **

LYC.ES_N        TTAGAGTTGGATCAT-GTGGCCCAATTGAAGAAATG-GACTACTT---GATTCGTAAAGT
CAE.EL_D        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                  ** * *   ***    **   ** **  * ** * *  ** *    * * * *** * 

LYC.ES_N        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGTG
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                *  * ***  *     * * *     *   ****   * ***    ***     ** ***

LYC.ES_N        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAA
CAE.EL_D        GCCGGAC--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCA
                *  ***   ** *   **    *   *  *    *  ****  * * *  ** **    *

LYC.ES_N        ACCACCATTTTT
CAE.EL_D        CTTATCATTT--
                   * *****  

[Download ClustalW]

#513

Mean pairwise ID: 44.87%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT-G
                  ***** * **   * * ****** *  **  *     * * *  ** *   * *** *

LYC.ES_B        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_D        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *      ***   * * ** *   ***  **

LYC.ES_B        TTAGAGTTGGATCAT-GTGGCCCAATTGAAGAAATG-GACTACTT---GATTCGTAAAGT
CAE.EL_D        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                  ** * *   ***    **   ** **  * ** * *  ** *    * * * *** * 

LYC.ES_B        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTG
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                *  * ***  *     * * *     *   ****   * ***   ****     ** ***

LYC.ES_B        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAA
CAE.EL_D        GCCGGAC--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCA
                *  ***   ** *   **    *   *  *    *  ****  * *    **  *    *

LYC.ES_B        ACCACCACTTTT
CAE.EL_D        CTTATCATTT--
                   * ** **  

[Download ClustalW]

#514

Mean pairwise ID: 44.87%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAA---GGTGGTGTGAAT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTT--CGGGGGCTTTCACCAGCTGAACAGGGA
                        * * ***       *******    ******* ** *   * **    *   

ZEA.MA_A        GCTTTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCC
LEP.COL.        GCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT-
                *** *  *          ***  ** *   *****      **  * ***** *  *   

ZEA.MA_A        AAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGC
LEP.COL.        --GTCGGAGGCCTCCGG-GTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCG--TTAAAGT
                  ** **  *  ** ** * *  * ** **  ***    * * * *  * *   *  ** 

ZEA.MA_A        GGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGGTG
LEP.COL.        AG-AGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTG
                 * *****  * ** **** ***   ** *******   *   **  **  *   ** **

ZEA.MA_A        GGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGCAA
LEP.COL.        CAG----AACCACACCGCGGAGCCT--GTCATCACCTGCGCCCCAGGCGATCCTGTG-AA
                       *** *  **** *  * *    * * **    ** *    *    **  * **

ZEA.MA_A        ACCACCATCTTT
LEP.COL.        GCTTT-------
                 *          

[Download ClustalW]

#515

Mean pairwise ID: 44.87%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG----TGGGGACAATAAGGTGGTGGAAC
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                * ** **   **  **   ** ***   ** **    * ****   * **   *  * * 

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATC---TGAGCTGCCCAGTC
GAL.GAL.        CGC--TTGAGCCCAGGAGTTCTGGGCTG-CAGTGCGCTATGCCGAGCGGGCGTCCGCGCT
                 *   ** *   *    * ** *  ***    **   ***  *    * **  **  *  

ARA.TH_D        CAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTC
GAL.GAL.        AAGGCCGGCATCAATATG-GTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGA
                 * ** *  *  *** ** *** * *  * * ** *  * * **   ** * *  ***  

ARA.TH_D        GGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTG
GAL.GAL.        GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTA
                ** * * *  *    ***  **    ** ******     *  ****        **** 

ARA.TH_D        GATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTG
GAL.GAL.        ACGGGATCGCGCCTGTGAATAGCC--ACTGCAGCGTAGCCTG--GGC---AACATAGCGA
                   *****     *   * *  *     * **   * *** *  **    * *    *  

ARA.TH_D        GACCACCACTTT
GAL.GAL.        GACCCTGTCTCC
                ****    **  

[Download ClustalW]

#516

Mean pairwise ID: 44.87%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     *** ****  

ZEA.MA_D        TTTGCGATG--GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATG---TCGTTGTCTACGTC-GACCGAGC-GTCCGTGC
                  ** ** *  *  * *** *   *   *** * * * * *  * ***  * * **** *

ZEA.MA_D        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.EL_A        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                ****      **  *  * ***    *    * * **  *     *      * * * * 

ZEA.MA_D        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGT
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAG-CGACCGCGTGGTGCAGT
                * *  * ****     * * *     *   *****  *  *  ** **** *    * **

ZEA.MA_D        GGGAGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCC-CAGAGCCTCACTAAGCA
CAE.EL_A        GGCCGGAC--CGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACC
                **  ***   *  **   **   *   *  *  ** *** *  *       *   *  * 

ZEA.MA_D        GACCACCATCTT
CAE.EL_A        ACTTATCATTT-
                    * *** * 

[Download ClustalW]

#517

Mean pairwise ID: 44.88%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCC-GCTTAG
                             **    **   * *  *      **  ** ******   * *   * 

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCACTAA
TRY.BR_A        CGGGGACGTCTTGGA----CAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTC-TGCTTG
                **     ***  ***       ** *  ** * * *  *  **   ***** *   **  

RAT.RAT.        GTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGG
                ***  *  **  * * * *  * ** * * ** * **      *  *  *  *** * **

RAT.RAT.        GGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
TRY.BR_A        GGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTCGAG
                ** **** **  **** ***  *********  **   **  **  *    * **    *

RAT.RAT.        GATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCT
TRY.BR_A        AAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG-----
                 * * * **   **  * * **   *  * *  **   *   * * ***** *       

RAT.RAT.        CTT
TRY.BR_A        ---
                   

[Download ClustalW]

#518

Mean pairwise ID: 44.88%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***       * * *   *******   * **** ** *   *    *    *  *

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTC-TGACTTGCCCTATCCAAGCTTA
TRY.BR_A        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCG
                   ** ** **  **  **   ** ** * * * **  **   ***    *      *  

LYC.ES_N        GAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
TRY.BR_A        GTGTTGAG----GTCGCC--ACTGTAGAGA-GGCGTTCTCGCGCCGTTAAAGTGGGGGGA
                * ****      ** ***  * ** *** * **  * ** *   *** **   *** ***

LYC.ES_N        ATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGATAA
TRY.BR_A        ACGGGTCAGGCCGGTG--ACGGAGCAGCC-CACCTTGCGCACGTTCCCGTTCGAGAAGCA
                * * ** **** ***   ** ***** *   *  ** *** *    * **   ** *  *

LYC.ES_N        CGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCATT
TRY.BR_A        CACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG--------
                *     ** *        * *   *  ****  * * ** *   * *             

LYC.ES_N        TTT
TRY.BR_A        ---
                   

[Download ClustalW]

#519

Mean pairwise ID: 44.90%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGGATGC
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     ********* 

ZEA.MA_C        TTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCC---TGCCCGTTCCA
CAE.EL_A        --AGTGAGAGGAGGAGTCCTGTGTATGTCGT-TGTCTACGTCGACCGAGCGTCCGTGCCA
                   **     *      **** **   * ** ** **  ** * **    * **** ***

ZEA.MA_C        AGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTG
CAE.EL_A        AGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAG-TCCCGGGTGCATAAGGAG
                **      **  **   ***    **   * ****  *  * * **  *  * **  * *

ZEA.MA_C        GCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGG
CAE.EL_A        TCGTGGATGGTTCAGGAC------CGAAAGGTAGCAGACAAAAGCGACCGC--GTGGTGC
                 *  * * **     * *      *  *  * ***   **    ** *       **** 

ZEA.MA_C        AAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAG--GCCTAGACTTCATACTAAAGC
CAE.EL_A        AGTGGCCGGACCGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGAC
                *  *     *   * **   *  * * * * * ** *  ****   *   *   * *  *

ZEA.MA_C        AGACCACCATTTTT
CAE.EL_A        CACTTATCATTT--
                     * *****  

[Download ClustalW]

#520

Mean pairwise ID: 44.97%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGAATGC
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     ***** *** 

ZEA.MA_A        TTTGCGATGGCTTTCTGGGCCCTGGGC---TCGTTGT-GACACTGGCCGGCTTGCCCATC
CAE.EL_C        AGTGAGAGGAG-----GAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGC-GTCCGTG
                  ** ** *       * * **** *    *******  **   * ***    * ** * 

ZEA.MA_A        CCAAGT-TGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGG
CAE.EL_C        CCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGG
                *****    *      * ** *  * ** * *  * *   *  *  *   *   *   **

ZEA.MA_A        AGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACG
CAE.EL_C        AGTGGTGG--ATGGTTCAGGACCGA------AAGGTAGCAGACAAAAGCCACCGC--GCG
                ** **  *  ****   * * * *       *  * ***   **    * **  *   **

ZEA.MA_A        GTGGGAGGATAACGAAGCCGCTGCACTTTGA-GCCTA-ACTCAGGCT-CAGAACCTCACT
CAE.EL_C        GTGCAGTGGCCGGACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTC
                ***    *       ***   **    ****  * ** ** *** ** *  **   *   

ZEA.MA_A        AAGCAAACCACCATCTTT
CAE.EL_C        AGACCACTTGTCACT---
                *  * *     **     

[Download ClustalW]

#521

Mean pairwise ID: 44.98%


ZEA.MA_F        -NCCGAGCTCTGTAGCGAGAGCTTGTAACC-TAAGCGGGGGCATTAAGGTGGTGTGGATG
DRO.MEL.        GACTGGAA--GGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGG
                  * *      ** *  **    ***** *        * *   *  * * *** *   *

ZEA.MA_F        TTTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCCAA
DRO.MEL.        CCTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAA
                  *   *  **  ***    *   **      *  *   * * ***   * ***  * **

ZEA.MA_F        GTTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGACCTGAAGCGGCA
DRO.MEL.        GCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCAT--TCAGGT-TGGCTAAGGA
                * * *   *   *   ** **   ** * ** **  *** *  * **   **     * *

ZEA.MA_F        GGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCG--CCCGCTTCCAACGGTGG
DRO.MEL.        GGGATGAACCGGGCCAGGGGTGA-AAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
                ** ***    * * * **  * * * * ****   **   *  ****       * ** *

ZEA.MA_F        GAGGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGACC
DRO.MEL.        TGGGATAGCGTACCG--GAGTGGACTGCCGTTATCAGCCCAA--CCGATATGGTTGGACC
                  ***** *   ***  *  * *   ***    ** * ***   **    *     ****

ZEA.MA_F        ACCATCTTT
DRO.MEL.        ACAATCTTT
                ** ******

[Download ClustalW]

#522

Mean pairwise ID: 44.98%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGA--CATTAAGATGGTGGGACAC
LEP.COL.        -----GCCGG--AGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                     **     * *  *    *******   * ***    **  *        **   *

ARA.TH_F        TGGTTCGGTTC-CTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAG
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGT-
                **  * *     *   *   * **  *  ** * * ** * **  ***   * **     

ARA.TH_F        CTGTGAGTAATTAGTGTTGAGTTG-AGCGAAGGCTTGGCTTGCAGGTTCTAGAGTCGGAG
LEP.COL.        CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTT--AAAGTAG--A
                * * *        ***     *** **    ***  * *      ***  * *** *   

ARA.TH_F        GGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-CAGCAGTGGAC
LEP.COL.        GGAACTGGGTCAGGCCGGCA--ACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCA
                ** * ** ** **** ***   ** *******  * ** ** ***    * ** ** *  

ARA.TH_F        GGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAAC
LEP.COL.        GAACCACACCGCGGAGCCTGTCATCACC----TGCGCCCCAGG--CGATCC--TGTGAAG
                * * ***      * * *  ***  ***    **  *  * **  *****   * **** 

ARA.TH_F        CACCATTTT
LEP.COL.        CTTT-----
                *        

[Download ClustalW]

#523

Mean pairwise ID: 44.98%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCTTTCACCAGCTGAACAGGG
                          * * * * *   ***** *    * * *   *   *   * **** *  *

LYC.ES_H        GGCTGT----ACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGC
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 *****    *****      * *****  * * * *  *    **   * *  *   * 

LYC.ES_H        TTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGC
LEP.COL.        GTCGGAGGCCTCCGGGTG-CCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG
                 * *        *  *** ***  *** ****  **    *    * *** **    *  

LYC.ES_H        GGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTC-TGTGCAGTGGAAG
LEP.COL.        GAACTGGGTCAGGCCGGC--AACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCAG
                * * ** ** **** **    ** ******    ** *** *** * * *** ** * **

LYC.ES_H        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAA
LEP.COL.        AACCACACCGCGGAG-CCTGTCA---TCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT-
                 *  *     *** * * * ***   ***    ****  * * * * **   *       

LYC.ES_H        CCACCTTTT
LEP.COL.        ---------
                         

[Download ClustalW]

#524

Mean pairwise ID: 45.00%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
TET.ROS.        ----GCCAGGGTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTT--AGAAT
                    * *  *** **  * ******   * *   *       *   **       ** **

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGTTCCAAA
                 *   ****    *****    *    ***  ****     *  * *** ***  * ** 

RAT.NOR.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                    *  *   *******    **  * *   **    *******      ***    * 

RAT.NOR.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ****** * ****  ** *** ** ****  ***  * ***         ** *  ***

RAT.NOR.        T--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGTCTCT
TET.ROS.        TAACATACTCATTAACTGTCAA-GCTAATCGGTTCTGCTATTCTGATCAGACACT-----
                *  *   *   * **  * **  **    * *    *  *   *    **** *      

[Download ClustalW]

#525

Mean pairwise ID: 45.02%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG----TGGGGACAATAAGGTGGTGGAAC
RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAG--GAGG
                * ** **   **  **   ** ***   ** **    * ****   * **   *  **  

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGC-TGACATATATCTGAGCTGCCCAGTCCA
RAT.NOR.        ATCGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                *  * ** * * *    * ** *  ***  *   *  **     *  * ** **   * *

ARA.TH_D        AGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-CTAAAGTCG
RAT.NOR.        AGTTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
                ** *  *  * *  * **  *  *   **   **  *   *   * * ** *  ***  *

ARA.TH_D        GAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGG
RAT.NOR.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
                * * * *  *    ***  **    ** ******     *  ****      * **** *

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGG
RAT.NOR.        TGGGATCGCGCCTGTGAATAGCC--ACTGCACTCCAGCCTG--GG--CAACATAGCGAGA
                  *****     *   * *  *     * ****   *** *  **  * *  *  *  * 

ARA.TH_D        ACCACCACTTT
RAT.NOR.        CCCGTCTCT--
                 **  * **  

[Download ClustalW]

#526

Mean pairwise ID: 45.03%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG-ACGGTAGATAAGTGTGGATG
                 ******   ** *** * ** *** *  **       * **   ** *   ** *****

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTA-ATCTTGCTGGCTTGCCCGTT
CAE.EL_D        G--AGTGAGAGGAGGAGTCCTGTGT---ATGTCGTCGTCTACGTCGACCGAGCGTCCGTG
                    *** *        ***** *    **** ** **  *  * *   *   * **** 

ORY.SA_A        CCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCC
CAE.EL_D        CCAAGCGCTACGTCA--CCAGGGGATAACTGTCGGAAGGC----GGTTAGTCCCGGGTGC
                *****            ** * **     ** ** * * *      **  * *   *  *

ORY.SA_A        CTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCC
CAE.EL_D        ATAAGGAGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGG
                 *** * * *  * *  *     * * *     *   *****  *  *  * **** *  

ORY.SA_A        ATCGGTGGAAGGATAACAGGCTGCTGCACCTTGG-GCCCGCTTCTGGCC--CAGAGTCCC
CAE.EL_D        TGCAGTGGCCGGAC--CGCGCT--TGTAAGTTGACACACATACACAGCCTTCTCGATACC
                  * ****  ***   *  ***  ** *  ***   * *       ***  *    * **

ORY.SA_A        TCTACAACAGACCACCATCTTT
CAE.EL_D        TTCA-GACCACTTATCATTT--
                *  *  **     * *** *  

[Download ClustalW]

#527

Mean pairwise ID: 45.03%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
LEI.MAJ.        ------------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGG
                            * ***    ***      * * *   *  * **  ** *  * *  **

CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAGC
LEI.MAJ.        ----GAGGACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGC
                     ***  *  * ** * * * **  *  **  **  ***   * *  * ***   **

CAE.BRI.        GCTGCGTCGCCAGGGGTCTCCGGTCGG--AAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
LEI.MAJ.        TGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAG
                  ** ****    ** *  **   * *   *** *****       **   * * * * *

CAE.BRI.        GTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGT-GCAGTGGCCGG
LEI.MAJ.        GGAACCGGGTCAGGCCGGAAACGGAGCAGCCCAC--CCCACGCACGTCCGCCGTTGCAGA
                *    *** ***** * **** * ***** * *   **  *** **   ** ** ** * 

CAE.BRI.        ATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTTGTCA
LEI.MAJ.        ATCACACCGCGGAGCA--TGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT----
                **  * *    ***     *  *** *     * *   * * * *   **   ***    

CAE.BRI.        TT
LEI.MAJ.        --
                  

[Download ClustalW]

#528

Mean pairwise ID: 45.03%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
TET.ROS.        ----GCCAGGGTAGCAA-TGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAAT--
                      *   ** **    ** *****    *  *         *    ***  * **  

CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTT----GCTAAGAGTGTGCCCGTTCCAAAC
                *** **** * ***   *   *  * *  * *    *   *  * * * **** **** *

CAE.EL_C        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGGT
TET.ROS.        AGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAG
                  ** **  * * **    *   * * ** * *      ** ***     ***   **  

CAE.EL_C        GGATGGT-TCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCGGAC
TET.ROS.        GAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGAT
                * *  *  *****   * **   * ***  ****    ****    **  ****  *** 

CAE.EL_C        AGCG--CTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTCA
TET.ROS.        AACATACTCATTAACTGTCAAGC-TAATCGGTTCTGCTATTCTGATCAGAC-ACT-----
                * *   **  * *  ** ** *  **  * *   *   * *    ****** ***     

CAE.EL_C        CT
TET.ROS.        --
                  

[Download ClustalW]

#529

Mean pairwise ID: 45.05%


ZEA.MA_D        -NCCGAGCTCTGTAGCGAGAGCTTGTAACC-CGAGCGGGGGCATTAAGGTGGTGCGGATT
DRO.MEL.        GACTGGAA--GGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTG-GGATG
                  * *      ** *  **    ***** * **     * *   *  * * *** **** 

ZEA.MA_D        CTTTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCC
DRO.MEL.        GCCTGAGGCTGGGATCTACTGCGTAGCGGACCA-GCTCATGTTGACGGAACGTCCGCACT
                   ** *   *   ***    *   **   * * *  * * * * ***   * ***  * 

ZEA.MA_D        AAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTG
DRO.MEL.        AAGCTTGCCATCAATA-TGGGTGCCATGGAGGAGTCCGTGGCATT--CAGGT-TGGCTAA
                *** * *   *   *   **  **  * * ***  *  ***  *   ***   **     

ZEA.MA_D        GCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCG--CCCGCTTCCAACGG
DRO.MEL.        GGAGGGATGAACCGGGCCAGGGGTGA-AAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAG
                * *** ***    * * * **  * * * * ****   **   *  ****       * *

ZEA.MA_D        TGGGAGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCA
DRO.MEL.        TAGTGGGATAGCGTACCGGAGTGGACTG---CCGTTATCAGCCCA--ACCGATATGGTTG
                * *  ***** *   ***  *      *   **       *****   **    *     

ZEA.MA_D        GACCACCATCTT-
DRO.MEL.        GACCACAATCTTT
                ****** ***** 

[Download ClustalW]

#530

Mean pairwise ID: 45.06%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCG----GGGGCATTAAGGTGGTGTGGA
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                 *** ** * ** ***   ** ****  ** ***     ***    * **   *   *  

ZEA.MA_C        TGCTTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGC--CCGTTC
GAL.GAL.        CGCTTGAGCCCAGGAGTT---CTGGGCT-GCAGTGCGCTATGCCGAGCGGGCGTCCGCGC
                 *****   **  *  **   ***** *    *** **  *     **  **  ***  *

ZEA.MA_C        CAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGG--ACCTAT
GAL.GAL.        TAAGGCCGGCATCAATATGGTGAGCCCCGG---GGAGCCGAGGCACACCAGGTTGCCTAA
                 ***   *   *     * *  ***   **    *  **  ***   *  **   **** 

ZEA.MA_C        AGTGGCAGGAACGGCGTGAGGCTGTCTTCA---CAGAGCAGCGATCAC-TGCCGGCTATT
GAL.GAL.        GGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGT
                 * **   **** *    ***  *    *    ***  **    ** * ******  * *

ZEA.MA_C        AACGGTGGAAGG---ATAACAGGCCACTGCAGCATGGGCTCGCTTA-AGGCCTAGACTTC
GAL.GAL.        AACGGGATCGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGAGACCCT
                *****      *    * *   *********** * * ** *   * *   * ****   

ZEA.MA_C        ATACTAAAGCAGACCACCATTTTT
GAL.GAL.        GTCTCC------------------
                 *                      

[Download ClustalW]

#531

Mean pairwise ID: 45.07%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTAGTTC
LYC.ES_D        ------------------------------------------------------------
                                                                            

HUM.JA_B        GGCCCATTGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCATTCCAAGCCGAGAG
LYC.ES_D        ----------------------------TAGTT-CTGGCCTGCCCTGTCCAAGCACAGAG
                                            *  ** **** ******  *******  ****

HUM.JA_B        TTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCTAAAGCGGAGGGCAATG
LYC.ES_D        TAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGGACCG
                * *      * *  **  * ***  * ***  *  *    *********** * * *  *

HUM.JA_B        CGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGAAGGATAACG
LYC.ES_D        CATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATG
                * ********* ************ **  * **********  *************** *

HUM.JA_B        GGCCGGTG-CTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGGACCATTTC
LYC.ES_D        GGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTG--CTCCAACTAAACCACCAC
                ** ***** **  *      **  *  *   * ** * **      **    ****   *

HUM.JA_B        TTTT
LYC.ES_D        TTTT
                ****

[Download ClustalW]

#532

Mean pairwise ID: 45.07%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-G
                    ***       ** *    *******   * ***   **   * *    **  ** *

ARA.TH_F        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
TRY.BR_A        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGAC-TTGGTGTTCTGCTTGGTTGCG--TG
                  * **     ***   ******* ** *   *  **  **  ****   **      **

ARA.TH_F        TGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCAGGTTCTAGAGTCGGAGGGTA
TRY.BR_A        TCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTT-CTCGC-GCCGTTAAAGT--GGGGGGA
                *  **  * **        **     **** *  ** ** *    ** ***  * *** *

ARA.TH_F        ATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGATC
TRY.BR_A        ACGGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAAGC
                * * ** **** **  * ** *******  * ** *  ***      * **    * * *

ARA.TH_F        ACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCACCA
TRY.BR_A        ACACCGAGGAGCATCTCAGGACT-TTGCGCCCCAAGTGTC-GTCGCGAGGCGG-------
                **      * *   ***** **   *  * **     *** *     *   *        

ARA.TH_F        TTTT
TRY.BR_A        ----
                    

[Download ClustalW]

#533

Mean pairwise ID: 45.07%


LYC.ES_O        GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***       * * *   *******   * **** ** *   *    *       *

LYC.ES_O        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACAG
TRY.BR_A        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGACTT--GG--TGTTCTGCTTGGTTGC-G
                   **  * **  **  **   ** ** * * * **  **  **  **         * *

LYC.ES_O        AGTTGGATCATGTGGTC-CAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGA
TRY.BR_A        TGTCGG-TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGA
                 ** ** *  ** **** * * ** *   * * * *          ********** ***

LYC.ES_O        CCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
TRY.BR_A        ACGGGTCAGGCCGGTG--ACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTCGAGAAGC
                 ** ** **** ***   ** ***** *  *   *** ***    * * **   ** *  

LYC.ES_O        ACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCA
TRY.BR_A        ACACCGAGGAGCATCTCAGGAC---TTTGCGCCCCAAGTGTCGTCGCGAGGCGG------
                **     ** ** *  ** *     **   ***  * * *  *   * *           

LYC.ES_O        CTTT
TRY.BR_A        ----
                    

[Download ClustalW]

#534

Mean pairwise ID: 45.07%


HUM.JA_A        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACTTTGGGTC
TRI.AE_C        ------------------------------------------------------------
                                                                            

HUM.JA_A        AGCCCATTGGATCGGGTCCAGTGTTAGCTGCTTGCTGGTCTGCCCATTCCAAGCCGAGAG
TRI.AE_C        ---------------------------------GGTGGTCTGCCCGTTCCAAGTTGAGTA
                                                 * ********** *******  ***  

HUM.JA_A        TTGGGCTG--TGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCCTAAAGAGGAGGGCAA
TRI.AE_C        GTGGACCGCTTGGGGCCTATGCGAAAGTTGGG-CCTCACGGTCCATAATGTGGCAGGCAC
                 *** * *  ** *  **  ***** * ****  * *** *  * *** * **  **** 

HUM.JA_A        TGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGGATAA
TRI.AE_C        CGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAA
                 ************ **************** **  ******  *  * ************

HUM.JA_A        CGGGTCGGTGC-TACTTGGGCCACCATGGTCACTGCATGCACTCTTAATCAGACCATCTC
TRI.AE_C        CGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGACCACCATC--
                **** ** ***   * * **** *   ** * *       ****        ******  

HUM.JA_A        TTTT
TRI.AE_C        ----
                    

[Download ClustalW]

#535

Mean pairwise ID: 45.08%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGA-GACAATAAGGGGATGGGACGTT
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTG--GAT
                  *** *   **  ** * ********  **  *    ***  **      ** *  * *

ARA.TH_C        GGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCC---CGCCCATTCCA
CAE.EL_B        GGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCA
                **   **    *  * * *  **    ** *   *  *    * **   ** ** * ***

ARA.TH_C        AGTTGGGAGTTG---AGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGT-CTTCTAGA
CAE.EL_B        AGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTC--AGTCCCGGGTGCATAAGGA
                **    * **      ** ***    ***   ** **     *** *  ** * *   **

ARA.TH_C        GTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGG
CAE.EL_B        GTGGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCACCGCGCGGT----GCAG
                **** ***     *  **        *  **** **    ***** * ** *     * *

ARA.TH_C        TGGAAGGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATT
CAE.EL_B        TGGCCGGACTGCGC-TTGTGAGTTGACACGTATAC-ACAGCCTTCTCAATACCT----TC
                ***  *** * **     *    *  *  *   ** *   **   * *    **    * 

ARA.TH_C        GGACCATCACTTT--
CAE.EL_B        AGACCACTTGTTTTT
                 *****    ***  

[Download ClustalW]

#536

Mean pairwise ID: 45.10%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-G
                    ***       ** *    *******   * ***   **   * *    **  ** *

ARA.TH_A        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
TRY.BR_A        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGAC-TTGGTGTTCTGCTTGGTT--GCGTG
                  * **     ***   ******* ** *   *  **  **  ****   **      **

ARA.TH_A        TGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGGAGGG
TRY.BR_A        TCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTT-CTCGCGCCG---TTAAAGT--GGGGG
                *  **  * **        **     **** *  ***  ** *    ** ***  * ***

ARA.TH_A        TAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGA
TRY.BR_A        GAACGGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAA
                 ** * ** **** **  * ** *******  * ** *  ***      * **    * *

ARA.TH_A        TCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCAC
TRY.BR_A        GCACACCGAGGAGCATCTCAGGACT-TTGCGCCCCAAGTGTC-GTCGCGAGGCGG-----
                 ***      * *   ***** **   *  * **     *** *     *   *      

ARA.TH_A        CATTTT
TRY.BR_A        ------
                      

[Download ClustalW]

#537

Mean pairwise ID: 45.10%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAA----AGTGGTTGAAC
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGA
                          * * * **  *** ****    * * *   * **     ** **      

CIN.HYB.        TTTGAGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAG
LEI.MAJ.        CGTGGACC-AGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGT---GTG
                  **  *   **   * *  ** * *  ** ***   *  *   ***** * **     *

CIN.HYB.        TCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCGGG
LEI.MAJ.        TCG-GTGTGGCTTG----CCCCCCTGCAGAGGGTGGCGCGG-GTCCGCCGTTGAAGCGAG
                *** * **** **       **   **  *** * * * *  **  **  * *** ** *

CIN.HYB.        GGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGAA
LEI.MAJ.        GGA-ACCGGGTCAGGCCGGAA--ACGGAGCAGCCCAC-CCCACGCACGTCCGCCGTTGCA
                **  *  * ** **** **    ** **** **  *  **    *   **  * ** * *

CIN.HYB.        GGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGCCCAACAGGACAC
LEI.MAJ.        GAATCACACCGCGGAGCATGTCCG---CACTTGAGCCCCACGCTTCGTC--GCGAAGCCT
                * ** ***   *****  * *  *   **  * * *  *  *  * * *   *    *  

CIN.HYB.        CCATTT
LEI.MAJ.        T-----
                      

[Download ClustalW]

#538

Mean pairwise ID: 45.10%


LYC.ES_E        GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***       * * *   *******   * **** ** *   *    *       *

LYC.ES_E        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGTACAG
TRY.BR_A        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGACT--TGG--TGTTCTGCTTGGTTGC-G
                   **  * **  **  **   ** ** * * * *  ***  **  **       * * *

LYC.ES_E        AGTTGGATCATGTGGTC-CAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGA
TRY.BR_A        TGTCGG-TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAA
                 ** ** *  ** **** * * ** *   * * * *          ********** * *

LYC.ES_E        CCCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATAA
TRY.BR_A        CGGGTCAGGCCGGTG--ACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTCGAGAAGCA
                *  ** **** ***   ** ***** *  *   *** ***    * * **   ** *  *

LYC.ES_E        CGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGTT-CTAGTTAAACTACCA
TRY.BR_A        CACCGAGGAGCATCTCAGGAC---TTTGCGCCCCAAGTGTCGTCGCGAGGCGG-------
                *     ** ** *  ** *     **   ***  * * *  **  * **           

LYC.ES_E        CATTTT
TRY.BR_A        ------
                      

[Download ClustalW]

#539

Mean pairwise ID: 45.10%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
TRY.BR_A        -------------------AGCCGGAGCGC--ATTGCTCTGTAACCTTCGGGGGCTGATC
                                     * * **  *    * *** * *  **  ** **  *   

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGG----GCTGTAGTGC-GCTATGCCGATGGGGTGTCCGCA
TRY.BR_A        CCGCTTAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTC-TG
                *   * ***   *  **  ***    ** *  ** * * *  *  **   ***** *   

HOM.SA_B        CTAAGTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAG
TRY.BR_A        CTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAA
                **  ***  *  **  * * * *  * ** * * ** * **      *  *  *  *** 

HOM.SA_B        GAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
TRY.BR_A        GTGGGGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTT
                * **** **** **  **** ***  *********  **   **  **  *    * ** 

HOM.SA_B        GTGGGATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGAGCAACATAGCGAGACCCC
TRY.BR_A        CGAGAAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG-
                   * * * * **   **  * * **   *  * *  **  **   * * ***** *   

HOM.SA_B        GTCTCT
TRY.BR_A        ------
                      

[Download ClustalW]

#540

Mean pairwise ID: 45.11%


HUM.JA_B        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTA
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG---ACGGTAGATAAG--TGTG
                     ** * *   ** * ** *** *  **  *    *     ** * **  *  * * 

HUM.JA_B        GTTCGGCCCATTGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCAT---TCCAAG
CAE.EL_D        GATGGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTG
                * * *    *  ***  *  *** ****  *  *    **  *  * **     ***  *

HUM.JA_B        CCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCTAAAGCGGAG
CAE.EL_D        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGC--GGTTAGTCCCGGGTGCATAA
                ** ** * *  *      * *    **    *   ***  *** **  **    **  * 

HUM.JA_B        GGCAATGCGTGAGGCT--GGTTTCACAG--AGCAGCGACAACCTCCCGCTCTCGGCAGTG
CAE.EL_D        GGAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                **    * *   ** *  **    * **  *****  * ** *  ****     ******

HUM.JA_B        GAAGGATAACGGGCCGGTGCTGCTTGGACCCAC-CATGGTTCACTGAGCTGACTCTTAAT
CAE.EL_D        GCCGGAC--CGCGCTTGTAA-GTTGACACACATACACAGCCTTCT----CGATACCT--T
                *  ***   ** **  **   * *   ** **  **  *    **     **  * *  *

HUM.JA_B        AGGACCATTTCTTTT--
CAE.EL_D        CAGACCACTTATCATTT
                  ***** ** *  *  

[Download ClustalW]

#541

Mean pairwise ID: 45.13%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGT-GGATG
LYC.ES_M        ------------------------CAAGTGGGGATGTTAA-GGTGGTGGAATATTGGGCT
                                          ***  *  * ** * *** *  ** * * **   

CAE.EL_C        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
LYC.ES_M        GTCCCAGATGGCTGGGCTTG-GTGGGCTAATTTCTGGCCTGCCC---TGTCCAAGCACAG
                *    *** *    * * ** **  *    * **      * **    ****  **  **

CAE.EL_C        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
LYC.ES_M        AGTTGGATCACGAGGCCCAAA---TGAAAATATGGGC--TTCTTGATTCCTAAAGTGGGG
                 * **  **** ***     *   *   ** **** *  * *  * * * *** * * **

CAE.EL_C        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCG
LYC.ES_M        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 ***  *     * * *     *   *****  ** ***  **** * *********  *

CAE.EL_C        GACAGCGCTT--GTGAGTTGACACGTATA-CACAGCCTTCTCAATACCTTCAG--ACCAC
LYC.ES_M        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAA
                ** *  *  *  ***  **  ** **  *  *  ****  *   *  ** **   * ** 

CAE.EL_C        TTGTCACT
LYC.ES_M        CCACCTTT
                    *  *

[Download ClustalW]

#542

Mean pairwise ID: 45.13%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

ARA.TH_G        GATCGGCCCACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAGCTGT
LYC.ES_D        --------------------------------TAGTTCTGGCCTGCCCTGTCCAAGCACA
                                                *** ***** ******  *******   

ARA.TH_G        GAGT-GAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAGGGT
LYC.ES_D        GAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAG-CGGGGCGG
                **** * * *    *  ****  ***  * **  *     * ** ******   * * * 

ARA.TH_G        ATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACGGAC
LYC.ES_D        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
                *  ** * ******************** **  * **********  ******** *** 

ARA.TH_G        AACGGTTCGACGCCACA-CAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAACCA
LYC.ES_D        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGC--TCCAACTAAACCA
                ** ** ***  * *  * *** * ** **  * *   *** * *    **   * *****

ARA.TH_G        CCATTTT-
LYC.ES_D        CCACTTTT
                *** *** 

[Download ClustalW]

#543

Mean pairwise ID: 45.13%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGT-GGATG
LYC.ES_M        ------------------------CAAGTGGGGATGTTAA-GGTGGTGGAATATTGGGCT
                                          ***  *  * ** * *** *   * * * **   

CAE.EL_B        GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
LYC.ES_M        GTCCCAGATGGCTGGGCTTG-GTGGGCTAATTTCTGGCCTGCCC---TGTCCAAGCACAG
                *    *** *    * * ** **  *    * **      * **    ****  **  **

CAE.EL_B        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
LYC.ES_M        AGTTGGATCACGAGGCCCAAA---TGAAAATATGGGC--TTCTTGATTCCTAAAGTGGGG
                 * **  **** ***     *   *   ** **** *  * *  * * * *** * * **

CAE.EL_B        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCG
LYC.ES_M        CGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAG
                 ***  *     * * *     *   *****  ** ***  **** * *********  *

CAE.EL_B        GAC--TGCGCTTGTGAGTTGACACGTATA-CACAGCCTTCTCAATACCTTCAG--ACCAC
LYC.ES_M        GATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAA
                **   ** *   ***  **  ** **  *  *  ****  *   *  ** **   * ** 

CAE.EL_B        TTGTTTTT
LYC.ES_M        CCACCTTT
                     ***

[Download ClustalW]

#544

Mean pairwise ID: 45.13%


LYC.ES_I        -GCCG--AGCTTAGTAATGTGGGCTTGTAACCCAAATG-GGGGCATTAATGTGGTGGAAT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTG-TAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGC
                  * *  ** ** * *   *  * *  * ** *   ** * **  * * *****      

LYC.ES_I        GTTGGGCTGTACCAGATGGTTGGGCTTGGTGGGCTA-ATTTCTGACTTGCCCTATCCAAG
DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAG
                 *  *****      *  *    **      *   *  **   *    * **   * ***

LYC.ES_I        CTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGG
DRO.MEL.        CTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGA
                ***    *        *** *      **     ***  * *  * *   *** * *** 

LYC.ES_I        CGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTC-GCTCTAAGCGGTGGAAG
DRO.MEL.        TGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGG
                 * *  * *  ***  ***   *   **** * *  **** * *   ** ** ** *  *

LYC.ES_I        GATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCA
DRO.MEL.        GATAGCGTACCGGAGTGGACTG---CCGTTATCAGCCCA---ACCGATATGGTTGGACCA
                **** **   *** **   ***   **  ** *  *  *      * *    **  ****

LYC.ES_I        CCATTTTT
DRO.MEL.        CAATCTTT
                * ** ***

[Download ClustalW]

#545

Mean pairwise ID: 45.13%


LYC.ES_G        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTT--CGGGGGC--TGATCCCGCTTAGCG--G
                    ***         * *   *******     ******  * **   *   *  *  *

LYC.ES_G        GGCTGTACCAGATGGTTGGG---CTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCA
TRY.BR_B        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACT--TGG--TGTTCTGCTTGGTTG
                **  **    **     ***     ** ** * * * *  ***  **  **         

LYC.ES_G        CAGAGTTGGATCATGTGGTC-CAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGT
TRY.BR_B        C-GTGTCGG-TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-
                * * ** ** *  ** **** * * ** *   * * * *          ********** 

LYC.ES_G        GGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGG
TRY.BR_B        GGAACGGGTCAGGCCGGT--GACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGA
                *** ** ** **** ***   ** ***** *  *   *** ***    * * ** * ** 

LYC.ES_G        ATAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCA
TRY.BR_B        AGCACACCGAGGAGCATCTCAGGAC---TTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT
                *  **     ** ** *  ** *     **   ***  * * *  *   * *        

LYC.ES_G        CCACTTTT
TRY.BR_B        --------
                        

[Download ClustalW]

#546

Mean pairwise ID: 45.14%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***      **      ********   * ****    *   * *    * *** *

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
TRY.BR_A        TCT----TGGA---CAAGCGGGGGTTCTGTTGCGTTGA---CTTGGTGTTCTGCTTG---
                * *    ****     * *  ***  *  *   ****    **** **   ***  *   

ORY.SA_A        CAAGTTGCGTAGTGG-GCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCC
TRY.BR_A        ---GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGC-------GTTCTCGCGCCG
                   *******   ** *  *  *  **    *   **           * *    ** * 

ORY.SA_A        CTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCC
TRY.BR_A        TTAAAGTGGGGGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTC
                 ********  ** ** * ** **** **  * ** *******   *  *** * * * *

ORY.SA_A        ATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCT
TRY.BR_A        --CCGTTCGAGAAGCACACCGAGGAGCATCTCAGG---ACTTTGCGCCCCAAGTGTCGTC
                  * **   ** *  ***    *  *** **  **    ***   ****  ***  *   

ORY.SA_A        ACAACAGACCACCATCTTT
TRY.BR_A        GCGAGGCGG----------
                 * *               

[Download ClustalW]

#547

Mean pairwise ID: 45.14%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGA--GGGCATCAGTGTGGTGGAATGT
DRO.MEL.        ----------GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTG
                          *    *  ** * * * **   ** *    ** ** *** ***   **  

LYC.ES_C        TGAACATGCCCAGAAGGTAGGGCTTGTGTGACAATTCTCTGGCCTGCCCTGTCCAA----
DRO.MEL.        TGGG-ATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGT
                **   *** ** ** * * **   *       *     *  **      ** *  *    

LYC.ES_C        --GCAAAGAGTTGGGTCT-----TGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC--C
DRO.MEL.        CCGCACTAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGC
                  ***   ** * *   *     ** * **** *     *   * *    *  * *   *

LYC.ES_C        TAAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGT
DRO.MEL.        TAAGGAGGGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAG
                *** * *** ** ** * *  ***  ***   *   **** * ** ** *****   *  

LYC.ES_C        GCAGTGGAAGGATAACGAGCCAGTGTCATATAAGTTCAACGAATGTCTGATGGGCTGTTC
DRO.MEL.        GCAGTAGTGGGATAGCGTACCGGAGT-------GGACTGCCGTTATCAGCCCAACCGATA
                ***** *  ***** **  ** * **       *  *  *   * ** *     * * * 

LYC.ES_C        TAGTTAAACTACCACATTT
DRO.MEL.        TGGTTGGACCACAATCTTT
                * ***  ** ** *  ***

[Download ClustalW]

#548

Mean pairwise ID: 45.14%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATA-GTCAG
YAR.LI_A        --CTTAGCTGTAATGGCATTTTGTCGGAGTGG--TAAATCGTCTTCTTGTTGTGCGTTCG
                  *   *  * **** *  *      * ****  ****   * *  **    *  **  *

TET.ROS.        AGTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTG-AGTTG
YAR.LI_A        AGTCTTGGGCTCTG------CACTTGGCCATTTGGTTGTCCTTTCCGAATTCTGCGGTTG
                *** *  *  * **      ** ** ** *   *  ** ** **** **   **  ****

TET.ROS.        CTATG-GTGGAAACCT-AGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAG-GAACCG
YAR.LI_A        ATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAA
                 *  * **      ** ****** **  ** *      * **  *    * *  *     

TET.ROS.        CCTCAGGCTGGCAACAGAACAGGGAAA-ACTTGCCGCTTATTGTGGTGGAAGGATAACAT
YAR.LI_A        CTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCG-TGGGTATGGCGGTGGGATCGCAA
                * ****    ****   * *** **   * ****** *   * *** **  ****  ** 

TET.ROS.        ACTCATTAACTGTCAAGCTAATCGGTTCTGCTATTCTGATCAGACACT
YAR.LI_A        CCAAGTGGTATATGTTATGGAAGATATTTACGATCACGATT-------
                 *   *    * *       *     * * * **   ***        

[Download ClustalW]

#549

Mean pairwise ID: 45.16%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGAACTT
HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
                   ** *   *   *  *  ******  ** **      ** * *  *    ****   *

HUM.LU_C        TGGGTCAACCCAGTGGTNCGGGNCCAGTGCTAGCTGC-TTACCCGGCTGCCCATTCCAAG
HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                 *  * *  ****  ** * ** *    *   ***        *** ** **   * ***

HUM.LU_C        CCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACT-CCTAGACTGGAG
HOM.SA_A        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
                   **        **  *  *    * **  *         *    * ****    ** *

HUM.LU_C        GGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAG
HOM.SA_A        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
                 * *  *    ***  **    ** ******     * ******  **   **** *  *

HUM.LU_C        GATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGAC
HOM.SA_A        GAT--CGCGCCTGTGAAT----AGCCACTGCACTCCAGCCTG--TGCAACATAGCGAGAC
                ***  ** *** ***       *****   *  * ** *  *  **   * **    ***

HUM.LU_C        CATTTCTTTT
HOM.SA_A        CCCGTCTCTT
                *   *** **

[Download ClustalW]

#550

Mean pairwise ID: 45.16%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTG------GGGATGTTAATGTGG-TGG
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                   * *  * **  ** * ** *** *  **  *       ** *    * ***** ***

LYC.ES_N        AATGTTGGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCA
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAA--CGGCGACCGAGC-GTCCGTGCCA
                * **  ***  *   *   *** **   * **           * **   * **   ***

LYC.ES_N        AGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGG
CAE.BRI.        AGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGT
                ***   * ** *      **  **     ****    *   * *  *   * *** * * 

LYC.ES_N        GGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGTGGA
CAE.BRI.        GGTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGC
                ** * *  **    *** *     *   ****   * ***    *** *   ** **** 

LYC.ES_N        AGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAAC
CAE.BRI.        CGGATAGCGCTTGTGAGTTGTC--GCTCGCCCACAGCCTCTCTGATACCTTCAGACCACT
                 ***** **  *  * *** **    **    *  ****    * *  ** **    *  

LYC.ES_N        CACCATTTTT
CAE.BRI.        TGTCATT---
                   ****   

[Download ClustalW]

#551

Mean pairwise ID: 45.16%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCA----TGTGGGGACATTAAGATGGTGGGAC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                  ** *    **  *    ** *** *  **      **  *  *   *  **  *    

ARA.TH_F        ACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAA
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACG-GCGACCGAGC-GTCCGTGCCAA
                * **    *     **   * ***  **  *    *  *   * **** * **   ****

ARA.TH_F        GCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTG-GCTTGCAGGTTCTAGAGTCGGA
CAE.BRI.        GCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
                **  ** **    ** * *     *   ******* * * *  * **  *   **  *  

ARA.TH_F        GGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGAC
CAE.BRI.        GTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCC
                * * *  **    *** *     *   *****  *  *    ****     ******* *

ARA.TH_F        GGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTG-CTGGTCCGATCTCATATGAA
CAE.BRI.        GGATAGCGCTTGTGAGTTGTC--GCTCGCCCACAGCCTCTCTGATAC--CTTCAGACCAC
                ****  ** **  * ** *    *  *  * *  ****  *** * *    *** *  * 

ARA.TH_F        CCACCATTTT
CAE.BRI.        TTGTCATT--
                    ****  

[Download ClustalW]

#552

Mean pairwise ID: 45.18%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAG-
                             **  * **   * *  *      **  ** ******  ***      

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRY.BR_A        CGGGGACGTCTTGGACAAGCGGGGGTTC---TGTTGCGTTGACTTGGTGTTC-TGCTTGG
                **     ***  ***     ***   **    * *  *  **   ***** *   **  *

ORI.CUN.        TTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
TRY.BR_A        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGGG
                **  *  **  * * * *  * ** * * ** * **      *  *  *  *** * ***

ORI.CUN.        GTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGG
TRY.BR_A        GGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTCGAGA
                * **** **  **** ***  *********  **   **  **  *    * **    * 

ORI.CUN.        ATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGTCTC
TRY.BR_A        AGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG------
                * * * **   **  * * **   *  * *  **   *   * * ***** *        

ORI.CUN.        C
TRY.BR_A        -
                 

[Download ClustalW]

#553

Mean pairwise ID: 45.18%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
TRY.BR_A        --------AGCCGGAGCGCAT-TGCTCTGTAACCTTC--GGGGGCTGATCCCGCTTAGCG
                         *  ** ***    **   *  ** ** *  ** ******  * *       

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
TRY.BR_A        GGGACGTCTTGGACAAGCGGGGGTTCTG----TTGCGTTGACTTGGTGTTC-TGCTTGGT
                *      **  *     * *** *** *     *  ** **   ***** * * **  **

FUG.RUB.        TCGGTATCGATATGGTGCTC-CTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGG
TRY.BR_A        TGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGG
                *  ** *** * * * * ** *    * **   **  *   *  * **   ***  ****

FUG.RUB.        TGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGGA
TRY.BR_A        GAAC--GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTCGAGAA
                   *  **  **** ***  *** *****  **   *   **  *    * **    * *

FUG.RUB.        TCGCGCCCGTGAATAGACGCTGTAGTT--CAACCTGAGTAACACAGCGGGACTCAGTCTT
TRY.BR_A        GCACACCGAGGAGCAT-CTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG------
                 * * **   **  *  * * * * **  *  **  ***  *   *** * *        

FUG.RUB.        T
TRY.BR_A        -
                 

[Download ClustalW]

#554

Mean pairwise ID: 45.18%


CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
TET.ROS.        ----GCCAGGGTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTT--AGAAT
                    * *  *** **    ******   * *   *       *   **  *    ** **

CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGTTCCAAA
                 *   ***     *****    *   ****  ****     *  * *** ***  * ** 

CAN.SPE.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                    *  *   *******    **  * *   **    *******      ***    * 

CAN.SPE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ****** * ****  ** *** ** ****  ***  * ***         ** *  ***

CAN.SPE.        T--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTC
TET.ROS.        TAACATACTCATTAACTGTCAAGCTAATCGGTTCTGC-TATTCTGATCAGACACT-----
                *  *   *   * **  * **    * **    ***   *   *    **** *      

CAN.SPE.        T
TET.ROS.        -
                 

[Download ClustalW]

#555

Mean pairwise ID: 45.19%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG----TGGGGACAATAAGGTGGTGGAAC
RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGG--ACAGAGG
                * ** **   **  **   ** ***   ** **    * ****   * ***     **  

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGC-TGACATATATCTGAGCTGCCCAGTCCA
RAT.RAT.        ATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                *  * ** * * *    * ** *  ***  *   *  **     *  * ** **   * *

ARA.TH_D        AGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-CTAAAGTCG
RAT.RAT.        AGTTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
                ** *  *  * *  * **  *  *   **   **  *   *   * * ** *  ***  *

ARA.TH_D        GAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGG
RAT.RAT.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
                * * * *  *    ***  **    ** ******     *  ****      * **** *

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGG
RAT.RAT.        TGGGATCGCGCCTGTGAATAGCC--ACTGCACTCCAGCCTG--GGC---AACATAGCGAG
                  *****     *   * *  *     * ****   *** *  **    * *    *  *

ARA.TH_D        ACCACCACTTT-
RAT.RAT.        ACCCCGTCTCTT
                *** *  ** * 

[Download ClustalW]

#556

Mean pairwise ID: 45.19%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGG-GGCATTAAGGTGGTGTGGATG-
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                 ******   ** *** * ****** *   *       * *  **     ********* 

ZEA.MA_F        --TTTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCC
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTC---GACCGAGC-GTCCGTGCC
                  *     ** *  * *** *  **   ****    * *   * ***  * * **** **

ZEA.MA_F        AAGTTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGACCTGAAGCGG
CAE.EL_C        AAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAG
                ***      **  *  * **    * * ** * *   *    **    *  *  ***  *

ZEA.MA_F        CAG-GCATGGCGTGAGGCTGGCT--TCACAGAGCAGCGATCACTCGCCCGCTTCCAACGG
CAE.EL_C        TGGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCAC-CGCGCGGTGC-AGTGG
                  * * ****     * * *     *  **** **     *** *** ** * * *  **

ZEA.MA_F        TGGGAGGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAG
CAE.EL_C        CCGGACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTT
                  ***        *   * **    * *  * ** *    ** * * * ***    **  

ZEA.MA_F        ACCACCATCTTT
CAE.EL_C        GTCACT------
                  ***       

[Download ClustalW]

#557

Mean pairwise ID: 45.19%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATGC
LEI.MAJ.        -----GCCGG--AGCTCTGCTCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGGGGAGG
                     *** *  ***  **   *** ***   * ****  **  ***    *  **  * 

ORY.SA_B        CTGGTCGTTTGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTCCA
LEI.MAJ.        ACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTG------GTGCTCTGCTTG-----
                  *       ***   * * * ***  *  **   **      * *  * **  *     

ORY.SA_B        AGTTGCGTAGCG-TGTGTGGGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCACCTAGAGT
LEI.MAJ.        -GCTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGC
                 * ** **  ** ****    ** **   **  *** * * ***   * **   *  ** 

ORY.SA_B        GGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCCAACGGTG
LEI.MAJ.        GA-GGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACGTCCGCCGTTG
                *  *** *  * ** **** **    ** *******     ** * * * ***  ** **

ORY.SA_B        GAAGGATAACGGGCCGCTGCAGCCCTGGCCCGCTTCCGGCCCAAGTGCCTTCCATGGCAG
LEI.MAJ.        CAGAATCA------CACCGCGGAGCATGTCCGCACTTGAGCCCCACGCTT--CGTCGCGA
                 *     *      * * ** *  *  * ****    *  **    ** *  * * **  

ORY.SA_B        ACCACCACCTTT
LEI.MAJ.        AGCCTT------
                * *         

[Download ClustalW]

#558

Mean pairwise ID: 45.19%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG----TGGAGACATCAAAGTGGTTGAAT
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                *  * **   **  **   ** **** *** **    * * **     *    *  * **

LYC.ES_H        A--TTGGGCTGTACCAGATGGTTGGGCT-TGGTGGGCTAATTTCTG-ACTTGCCCTATCC
GAL.GAL.        CGCTTGAGCC---CAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCT
                   *** **    *  **    ******   *** ****      *     * **   * 

LYC.ES_H        AAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTG
GAL.GAL.        AAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAG
                ***    *  *           ****    **    * * **  *  * * * *** * *

LYC.ES_H        GGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
GAL.GAL.        GGGTGAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAA
                *** * *  *    ***  **    ** ******   * * ******  * *  ****  

LYC.ES_H        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
GAL.GAL.        CGGGAT--CGCGCCTGTGAAT-AGCCACTGCAGCGTAGCCTGG-GCAACATAGCGAGACC
                  ****   * * * ***  * * * * * ***    ****   *        * * *  

LYC.ES_H        CAACCACCTTTT
GAL.GAL.        CTGTCTCC----
                *   * **    

[Download ClustalW]

#559

Mean pairwise ID: 45.19%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGCGCGGATGC
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     * * ***** 

ZEA.MA_B        TTTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCT---TGCCCATCCCA
CAE.EL_A        AGTGAGAGGAGG---AGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCA
                  ** ** *       * **** *   ** **       * ** *     * ** * ***

ZEA.MA_B        AGTTGGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGG
CAE.EL_A        AGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGT
                **      **  *    **    **  ** ***          * *    * **  * * 

ZEA.MA_B        CAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGTGG
CAE.EL_A        CGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAA-AAGCGACCGCGTGGTGCAGTGG
                *  * ****   * * * *     *   *****  *  *  ** ** * *    * ****

ZEA.MA_B        GAGGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAAAC
CAE.EL_A        CCGGACC----GCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTT-CAGAC
                  ***      **   **    ****  *  * **  * **   **    * *  ** **

ZEA.MA_B        CACC-ATCTTT-
CAE.EL_A        CACTTATCATTT
                ***  *** ** 

[Download ClustalW]

#560

Mean pairwise ID: 45.21%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
TRY.BR_A        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTT-AG
                             **  * **   * *  *      **  ** ******  * *    * 

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCACTAA
TRY.BR_A        CGGGGACGTCTTGGA----CAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTC-TGCTTG
                **     ***  ***       ** *  ** * * *  *  **   ***** *   **  

HOM.SA_A        GTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGG
                ***  *  **  * * * *  * ** * * ** * **      *  *  *  *** * **

HOM.SA_A        GGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
TRY.BR_A        GGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTCGAG
                ** **** **  **** ***  *********  **   **  **  *    * **    *

HOM.SA_A        GATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCT
TRY.BR_A        AAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG-----
                 * * * **   **  * * **   *  * *  **   *   * * ***** *       

HOM.SA_A        CTT
TRY.BR_A        ---
                   

[Download ClustalW]

#561

Mean pairwise ID: 45.21%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***       * * *   *******   * **** ** *   *    *    *  *

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTC-TGACTTGCCCTATCCAAGCTTA
TRY.BR_B        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCG
                   ** ** **  **  **   ** ** * * * **  **   ***    *      *  

LYC.ES_N        GAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
TRY.BR_B        GTGTTGAG----GTCGCC--ACTGTAGAGA-GGCGTTCTCGCGCCGTTAAAGTGGGGGGA
                * ****      ** ***  * ** *** * **  * ** *   *** **   *** ***

LYC.ES_N        ATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAAGGATAA
TRY.BR_B        ACGGGTCAGGCCGGTG--ACGGAGCAGCC-CACCTTGCGCACGTTCCCGTTGCAGAAGCA
                * * ** **** ***   ** ***** *   *  ** *** *    * ** * ** *  *

LYC.ES_N        CGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCACCATT
TRY.BR_B        CACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT-----
                *     ** *        * *   *  ****  * * ** *   * *             

LYC.ES_N        TTT
TRY.BR_B        ---
                   

[Download ClustalW]

#562

Mean pairwise ID: 45.25%


LYC.ES_H        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-G
                    ***       * * *   ***** *   * **    ***    *    *   *  *

LYC.ES_H        GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTC-TGACTTGCCCTATCCAAGCTTA
TRY.BR_A        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCG
                   ** ** **  **  **   ** ** * * * **  **   ***    *      *  

LYC.ES_H        GAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGGCGGA
TRY.BR_A        GTGTTGAG----GTCGCC--ACTGTAGAGA-GGCGTTCTCGCGCCGTTAAAGTGGGGGGA
                * ****      ** ***  * ** *** * **  * ** *   *** **   *** ***

LYC.ES_H        ATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATA
TRY.BR_A        ACGGGTCAGGCCGGT--GACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAAGC
                * * ** **** ***   ** ******    ** **  *** *  * * **   ** *  

LYC.ES_H        ATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACAACCAC
TRY.BR_A        ACACCGAGGAG-CATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG------
                *      ** * * * *** *     *  ****  * * ** *   * *           

LYC.ES_H        CTTTT
TRY.BR_A        -----
                     

[Download ClustalW]

#563

Mean pairwise ID: 45.28%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTG-TGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATG
LEP.COL.        ------------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGC-TGAACA
                            * ***   * ** *  ** * ****  *    *  ** **  ** *  

CAE.BRI.        GAGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAG
LEP.COL.        GGGAGCTGTCTGGA--CCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTC-TGCTTGG
                * * *  *   ***  ** *     * **   **  **  ***   * *  * ***   *

CAE.BRI.        CGCTGCGTCG-------CCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAA
LEP.COL.        CTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCG-CCCCCTCCGTTAAA
                *  ** ****       ** ** * * **   * *****   ***  ***   **   **

CAE.BRI.        GGAGTGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTG
LEP.COL.        GTAGAGGAAC-TGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTC-TGCCGTT
                * ** **  *  ** ***** * * ** * ***** * *   *   * **   *** ** 

CAE.BRI.        GCCGGATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACT
LEP.COL.        GCAGAACCACACCGCGGAGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT-
                ** * *   * *    ***       ** **  *  **     *** *  * *  *    

CAE.BRI.        TGTCATT
LEP.COL.        -------
                       

[Download ClustalW]

#564

Mean pairwise ID: 45.28%


ORI.CUN.        ------GCCGGGCGCGGTGGCGCGCGCCTGTAGTC-CCAGCTACTCGGGAGGCTGAGGCC
LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTG--TCT
                      ***  ** * **  *   **   *   ** ******   * **  ****   * 

ORI.CUN.        GGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCG
LEP.COL.        GGACCAGCATA-------GGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTG
                ***  * *           ** * *   ***  *   * * *   * * * ** ***  *

ORI.CUN.        CACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAA
LEP.COL.        --------TCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAA
                        ****   *     **** ** *  *     ****  *  **     *   **

ORI.CUN.        GGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
LEP.COL.        GTAGAG--GAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCC-GT
                * ** *  **** **  **** *** **********  **   * * *  *     * **

ORI.CUN.        AGTGGGATCGCGCCTGTGAATA-GCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCC
LEP.COL.        TGCAGAACCACACCGCGGAGCCTGTCATCAC-CTGCGCCCCAGGCGATCCTGTGAAGCTT
                 *  * * * * **   **    * **   * ** *  **  *** *    * **  *  

ORI.CUN.        TGTCTCC
LEP.COL.        T------
                *      

[Download ClustalW]

#565

Mean pairwise ID: 45.28%


LYC.ES_C        GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCA-GTGTGGTGGAATGTT
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGG------
                    ***      ** * *   ******    * * *   ***  *  * * **      

LYC.ES_C        GAACATGCCCAGAAGGTAGGGCTTGTGTGACAATTCTCTGGCCTGCCCTGTCCAAGCAAA
TRY.BR_B        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGG--TGTTCTG-CTTGGTTGC
                * ** *       * *  *** ** ***  *  *    ***  **  *** *   *    

LYC.ES_C        GAGTTGGGTCTTGTGGGC-CAAGCGAAGGCTTGGGCTGCTGGGCTCCTAAAGTGGGGTGG
TRY.BR_B        GTGTCGG-TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGA
                * ** ** * *** ** * * *  * **    * * *   * **   ********** * 

LYC.ES_C        ACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGTGCAGTGGAAGGAT
TRY.BR_B        ACGG-GTCAGGCCGGTGACGGAGCAGCCCACCTTGCGCACGTTCC-CGTTGCAGAAGCAC
                ** * ** **** ***  *  **     *   * ** * ** **   *  *  **** * 

LYC.ES_C        AACGAGCCAGTGTCATATAAGTTCAACGAATGTCTGATGGGCTGTT-CTAGTTAAACTAC
TRY.BR_B        ACCGAGG-AGCATCTCAGGACTTTG-----CGCCCCAAGTGTCGTCGCGAGGCGGTTT--
                * ****  **  **  *  * **        * *  * * *  **  * **      *  

LYC.ES_C        CACATTT
TRY.BR_B        -------
                       

[Download ClustalW]

#566

Mean pairwise ID: 45.31%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

HUM.LU_D        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
LYC.ES_D        --------------------------------TAGTT-CTGGCCTGCCCTGTCCAAGCAC
                                                *  ** **** ******  *******  

HUM.LU_D        GGAGTTGGGCTGAGTGACCTGGGCGAAGGC-TGGGTTGCGCAGCTCCTAGAGTGGAGGGC
LYC.ES_D        AGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCGG
                 **** **     * * **     ***    **** * *     ***** ** ** * * 

HUM.LU_D        AATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGAT
LYC.ES_D        ACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGAT
                *  ** ********************** **  * **********  *************

HUM.LU_D        AACGGGCCGGTGC--TACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGGACC
LYC.ES_D        AATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCT-AATGGGTTGCTCC--AACTAAACC
                ** *** *****   ** *  * **    * ** * * **** **   *  **    ***

HUM.LU_D        ATTTCTTTT
LYC.ES_D        ACCACTTTT
                *   *****

[Download ClustalW]

#567

Mean pairwise ID: 45.34%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
LYC.ES_M        ---------------------------------CAAGTGGGGATGTTAAGGT-GGTGGAA
                                                 * * * **** * * ***  ** *** 

ORI.CUN.        CGCTTGA--GTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTA
LYC.ES_M        TATTGGGCTGTCCCAGATGGCTGGGCT-TGGTGGGCTA-ATTTCTGGCCTGCCCTGTCCA
                   * *   ****  **   ******* * *** ****      * *  ** **   * *

ORI.CUN.        AGTTCGGCATCA-ATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
LYC.ES_M        AGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT-CCTAAAGTG
                **  * *  *   **   * * **     * *     ** *  *  * ** ***** * *

ORI.CUN.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
LYC.ES_M        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
                *** * ****    ***  **    ** ******   * * ******  ***  **** *

ORI.CUN.        TGGGAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCTGG-GCAACATAGCGAGACC
LYC.ES_M        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
                  ****   * * * ***  *   **  * ** *   ****   *        * * *  

ORI.CUN.        CTGTCTCC---
LYC.ES_M        CAACCACCTTT
                *   * **   

[Download ClustalW]

#568

Mean pairwise ID: 45.34%


LYC.ES_F        -GCCG--AGCTTTGTAACGTGGGCTTGTA-ACCCGAGTGGGGGC-AACAATGTGGTGGAA
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                  * *  ** ** * * * *  *     *  *    *** ** *  *   ** * ***  

LYC.ES_F        TGTTGGGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTC-TGGCCTGCCCTGTCCA
DRO.MEL.        TGA-GGCTGGGATCTACTGCGTAG--CGGACCAGCTCATGTTGACGGAACGTCCGCACTA
                **  ** *      *  **  * *    **   *** *****   **   * **   * *

LYC.ES_F        AGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAGCCACTTGGCCT-TTAGAGTGG
DRO.MEL.        AGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGG
                ***      *        ***   *  * **     * **     **     **  * **

LYC.ES_F        GATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGA
DRO.MEL.        GATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGT
                **** ** * *  ***  ***   *   **** * *  *** ****   *  ***** * 

LYC.ES_F        AGGATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAA
DRO.MEL.        GGGATAGCGTACCGGAG----TGGACTGCCGTTATCAGCCCAACCGATA---TGGTTGGA
                 ****  **  *  * *    * ** * *    *  * **  *  * *    *  **  *

LYC.ES_F        CCATCACTTTT
DRO.MEL.        CCACAATCTTT
                ***  *  ***

[Download ClustalW]

#569

Mean pairwise ID: 45.34%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAA--GGTGGTGCGGATT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTT--CGGGGGCTTTCACCAGCTGAACAGGGA
                        * * ***       *******    ******* ** *   *  *  * *   

ZEA.MA_D        CTTTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC-
LEP.COL.        GCTGTCTGGACCAGCATAGG---GTGCTTGCGGCGTTGACGTGGT-GCTCTGCTTGGCTG
                  *  *     *    * **   * *** **   **     ***  *  ****  * *  

ZEA.MA_D        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
LEP.COL.        TGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCG--TTAAAGT
                   ** **  *   * **  *   * **   * * *     * * *  * *   * ****

ZEA.MA_D        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGT
LEP.COL.        AG-AGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCAC-CTCGCGCACGTCTGCCGTT
                 * *****  * ** **** ***   ** *******   * ***** * * **   ** *

ZEA.MA_D        GGGAGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAG
LEP.COL.        GC-AGAACCACA--CCGCGGAGCCT--GTCATCACCTGCGCCCCAGGCGATCCTGTGAAG
                *  ** *  ***  **** *  * *    *   **    ****   **    **  * **

ZEA.MA_D        ACCACCATCTT
LEP.COL.        CTTT-------
                           

[Download ClustalW]

#570

Mean pairwise ID: 45.36%


HUM.JA_A        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACTTTGGGTC
SCH.POM.        ------------------------CGCTGTAATGGCTTGGTCGAAGTG-----TTTAGTA
                                        *   **   *** **   **  **     **  ** 

HUM.JA_A        AGCCCATTGGATCGGGTCCAGTGTTAGCTGCTTGCTGGTCTGCCCATTCCAAGCCGAGAG
SCH.POM.        CTCCCAATAGTGCATGTTCGGTGGTCTCGGGTT-CGAGTCT-CGCTTTCGATCCCTCGAT
                  **** * *  *  ** * *** *  * * ** *  **** * * *** *  **  ** 

HUM.JA_A        TTGGGCTGTGTGATCTGGGCGAAGGCTGGG-GTCGCACAGCTCCTAAAGAGGAGGGCAAT
SCH.POM.        CTGCCACGTCTGTTCGAAGAGTAGTCTTCGTGGCAACTGGCAGTTAAACCGTGTAGTACC
                 **    ** ** **   * * ** **  * * *     **   ****  *    * *  

HUM.JA_A        GCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTCGGCAGTGGAAGGATAAC
SCH.POM.        GATGGAGGTTGGAA--ACAATGCA--CATCACTACCGGGTCTTGG--GCAGTGCGATAGC
                *   **** ***    ***  ***   * ***  ** * *** **  *  *   **** *

HUM.JA_A        GGGTCGGTGCTACTTGGGCCACCATGGTCACTGCATGCACTCTTAATCAGACCATCTCTT
SCH.POM.        GATGGGATTCACCTTCG--CAGGATG-----TGCATGGAAGTATAAACACAACGGTCGTT
                *    * * *  *** *  **  ***     ****** *    *** ** * *     **

HUM.JA_A        TT
SCH.POM.        --
                  

[Download ClustalW]

#571

Mean pairwise ID: 45.36%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
TET.ROS.        ----GCCAGGGTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGA--AT
                    * *  *** **  * ******   * *   *       *   **  *  ***  **

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGTTCCAAA
                 *   ****    *****    *    ***  ****     *  * *** ***  * ** 

RAT.RAT.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                    *  *   *******    **  * *   **    *******      ***    * 

RAT.RAT.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ****** * ****  ** *** ** ****  ***  * ***         ** *  ***

RAT.RAT.        T--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC
TET.ROS.        TAACATACTCATTAACTGTCAA-GCTAATCGGTTCTGCTATTCTGATCAGACACT-----
                *  *   *   * **  * **  **    * *    *  *   *    **** *      

RAT.RAT.        TT
TET.ROS.        --
                  

[Download ClustalW]

#572

Mean pairwise ID: 45.36%


DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
LEI.MAJ.        -------------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGG
                             ** *   ** *  **      **  * ** ** *    *    *   

DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAGC
LEI.MAJ.        GGAGGACGTGGACCA--GCGAGGGTGATTTGCT-GCGTTGACGTGGTGCTC-TGCTTGGC
                 ****  * *  * *  ***  *  **   ***   *******    *  *   **  **

DRO.MEL.        TTGCCATCAATATGGGT-GCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGG--
LEI.MAJ.        TGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCG--CGGGTCCGCCGTTGAAGCG
                *     **  * *** * ***     * **   *****   * ***  **    ** *  

DRO.MEL.        GATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGG
LEI.MAJ.        AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCACCCCACGCACG-TCCGCCGTTGCAG
                   ******** ****   ****   ******* *     * *  * *  ** ** *  *

DRO.MEL.        GATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCACAATCT
LEI.MAJ.        AATCACACCGCGGAGCATGTCCGCACT-TGAGCCCCAC--GCTTCGTCG---CGAAGCCT
                 **  *    *****        *  * * ***** **     * ** *   *  *  **

DRO.MEL.        TT
LEI.MAJ.        T-
                * 

[Download ClustalW]

#573

Mean pairwise ID: 45.36%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
TET.THE.        ----GCCAGGGTAGCA-ATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTG-AT
                    * *  *** **   * *****      *  *       *   **  * * * * **

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.THE.        AGATAGGATATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGCTCCAAA
                 * * *  *    *****    *    ***  ****     *  * *** **** * ** 

HOM.SA_A        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                    *  *   *******    **  * *   **   ********      ***      

HOM.SA_A        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 *** ** * ****  ** *** ** ****  ***  * ***         ** *  ***

HOM.SA_A        T--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTC
TET.THE.        TAACATACTCATTAACTGTCAAACTAATCGGTTCTAC-TATCAAAGCCAGACATT-----
                *  *   *   * **  * **    * **    **    * ** *** ****        

HOM.SA_A        TT
TET.THE.        --
                  

[Download ClustalW]

#574

Mean pairwise ID: 45.37%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                   *  * * *   *  *  * *** *  **  *    *   ** *  **  *    * *

HUM.LU_C        GGTCAACCCAGTGGTNCGGGNCCAGT-GCTAGCTGC-TTACCCGGCTGCCCATTCCAAGC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 ** *    **  ** * *     ** *    ** * *   ***   * ** * ******

HUM.LU_C        CGGGAGGTGGGCTGAGGG-ACCTGGGCGAAGGCTNNNGGNGCGCACTCCTAGACTGGAGG
CAE.EL_D        -GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGT----GCATAAGGA
                 *  * **   * * **  * ***   ******     *  *    *    *  *   * 

HUM.LU_C        GCAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACCTCCCGCTCTCGGCAGTGGAA
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCC
                *   **  **   * **    * **  *****  *  * *  ****     *******  

HUM.LU_C        GGATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGA
CAE.EL_D        GGAC--CGCGCTTGTAAG--TTGACACA-CA-TACACAGCCTTCTCGATACCT--TCAGA
                ***   ** **  **  *  ****  ** ** *   ** *      **  * *  *  **

HUM.LU_C        CCATTTCTTTT--
CAE.EL_D        CCACTTATCATTT
                *** ** *  *  

[Download ClustalW]

#575

Mean pairwise ID: 45.37%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCA------TGTGGGGACATTAAGATGGTGGG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                  *****   **  *    ****** *  **      **  ** * ** *   ***  **

ARA.TH_F        ACACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCC
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGT--CGTTGTCAACGT-CGACCGAGC-GTCCGTGCC
                *    *    **   *  *  *  **   * ***   * *    * **** * **   **

ARA.TH_F        AAGCTGTGAGTAATTAGTGT-TGA--GTTGAGCGAAGGCTTGGCTTGCAGGTTCTAGAGT
CAE.EL_C        AAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAG
                ****  ** ** *  ** *  ***  ** *   ** **   * *  *   *    **   

ARA.TH_F        CGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGT
CAE.EL_C        TGGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCACCGCGCGGT----GCAGT
                 ** ** *  * *  **        *  **** **    * **  * ** *    *****

ARA.TH_F        GGACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATAT
CAE.EL_C        GGCCGGACAGCGCTTGTGAGTTGACACGTATA--CACAGCCTTCTCAAT-ACCTTCAGAC
                ** ****   ** **  * ** *    * *     *  **** **         *** * 

ARA.TH_F        GAACCACCATTTT
CAE.EL_C        CACTTGTCACT--
                 *     ** *  

[Download ClustalW]

#576

Mean pairwise ID: 45.39%


LYC.ES_O        GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***       * * *   *******   * **** ** *   *    *       *

LYC.ES_O        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGCACAG
TRY.BR_B        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGACTT--GG--TGTTCTGCTTGGTTGC-G
                   **  * **  **  **   ** ** * * * **  **  **  **         * *

LYC.ES_O        AGTTGGATCATGTGGTC-CAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGA
TRY.BR_B        TGTCGG-TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG-GGA
                 ** ** *  ** **** * * ** *   * * * *          ********** ***

LYC.ES_O        CCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
TRY.BR_B        ACGGGTCAGGCCGGTG--ACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTGCAGAAGC
                 ** ** **** ***   ** ***** *  *   *** ***    * * ** * ** *  

LYC.ES_O        ACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCACCA
TRY.BR_B        ACACCGAGGAGCATCTCAGGAC---TTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT---
                **     ** ** *  ** *     **   ***  * * *  *   * *           

LYC.ES_O        CTTT
TRY.BR_B        ----
                    

[Download ClustalW]

#577

Mean pairwise ID: 45.39%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TET.ROS.        ----GCCAGGGTAGCAA-TGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAAT--
                      *   ** **    ** *****    *  *         *    ***  * **  

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTT----GCTAAGAGTGTGCCCGTTCCAAAC
                *** **** * ***   *   *  * *  * *    *   *  * * * **** **** *

CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
TET.ROS.        AGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCAT-TAAAGAGCTGA
                  *  **  * * **   **   * * **   *  *   ** ***    *** ***  * 

CAE.EL_A        GGA--TGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                ***   *  *****   * **   * ***  ****    **** *  **  ****  ***

CAE.EL_A        C--CGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTATC
TET.ROS.        TAACATACTCATTAACTGTCAAGC-TAATCGGTTCTGCTATTCTGATCAGAC-ACT----
                   *   **  * *  ** **  * **  * *   *     *    ****** ***    

CAE.EL_A        ATTT
TET.ROS.        ----
                    

[Download ClustalW]

#578

Mean pairwise ID: 45.39%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-G
                    ***       ** *    *******   * ***   **   * *    **  ** *

ARA.TH_F        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
TRY.BR_B        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGAC-TTGGTGTTCTGCTTGGTTGCG--TG
                  * **     ***   ******* ** *   *  **  **  ****   **      **

ARA.TH_F        TGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCAGGTTCTAGAGTCGGAGGGTA
TRY.BR_B        TCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTT-CTCGC-GCCGTTAAAGT--GGGGGGA
                *  **  * **        **     **** *  ** ** *    ** ***  * *** *

ARA.TH_F        ATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGATC
TRY.BR_B        ACGGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGAAGC
                * * ** **** **  * ** *******  * ** *  ***      * ** *  * * *

ARA.TH_F        ACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCACCA
TRY.BR_B        ACACCGAGGAGCATCTCAGGACT-TTGCGCCCCAAGTGTC-GTCGCGAGGCGGTTT----
                **      * *   ***** **   *  * **     *** *     *   *        

ARA.TH_F        TTTT
TRY.BR_B        ----
                    

[Download ClustalW]

#579

Mean pairwise ID: 45.42%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-G
                    ***       ** *    *******   * ***   **   * *    **  ** *

ARA.TH_A        GTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAAGCTG
TRY.BR_B        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGAC-TTGGTGTTCTGCTTGGTT--GCGTG
                  * **     ***   ******* ** *   *  **  **  ****   **      **

ARA.TH_A        TGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGGAGGG
TRY.BR_B        TCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTT-CTCGCGCCG---TTAAAGT--GGGGG
                *  **  * **        **     **** *  ***  ** *    ** ***  * ***

ARA.TH_A        TAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGGA
TRY.BR_B        GAACGGGTCAGGCCGG--TGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGAA
                 ** * ** **** **  * ** *******  * ** *  ***      * ** *  * *

ARA.TH_A        TCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCAC
TRY.BR_B        GCACACCGAGGAGCATCTCAGGACT-TTGCGCCCCAAGTGTC-GTCGCGAGGCGGTTT--
                 ***      * *   ***** **   *  * **     *** *     *   *      

ARA.TH_A        CATTTT
TRY.BR_B        ------
                      

[Download ClustalW]

#580

Mean pairwise ID: 45.42%


DRO.MEL.        GACTGGAAGGTTGGCAGCTT--CTGTAATCACGCTTCTGTGAGGT--CTGATTGTGGGAT
YAR.LI_A        -----------------CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCT
                                 ***  *******  *  **    *  **     ** **    *

DRO.MEL.        GGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACT
YAR.LI_A        TGTTGTGCGTTCGAGTCT--TGGGCTCTGCACTTGGCCATTTGGTTGTCCTTTCCGAATT
                 *      * * *  ***  ** *    * **  *  *** * *  *     **** * *

DRO.MEL.        AAGC--TTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGG
YAR.LI_A        CTGCGGTTGATGGGCGTCTCGGT-CTGAGTAATCGGCTTTGAGATTTCCGTT--CTAAGA
                  **  ***       * * *** *   * *   * *  **  ***   ***  ***** 

DRO.MEL.        AGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAG-AGTTCCCGTGGTAGGCAGTA
YAR.LI_A        TTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGG-GTATGGCG
                     **        *** ** * ** *******  *   **** ******      *  

DRO.MEL.        GTGGGATAGCGTACCGGAGTGGACTGCCGTTATCAGCCCAACCGATATGGTTGGACCACA
YAR.LI_A        GTGGGAT--CGCAACCAAGTGGTATAT-GTTATGGAA------GATATT-TACGATCACG
                *******  ** * *  *****  *   *****          *****  *  ** *** 

DRO.MEL.        ATCTTT
YAR.LI_A        ATT---
                **    

[Download ClustalW]

#581

Mean pairwise ID: 45.42%


LYC.ES_E        GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
YAR.LI_A        ------CTTAGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGTCTTCTTGTTG
                      *****       *** * *   *  *****      ***   *      * ***

LYC.ES_E        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGTACAG
YAR.LI_A        TGC-GTTCGAGTC--TTGGGCTCTGCAC-TTGGCCATTTGGTTGTCCTTTCCGAATTCTG
                 ** ** * **     ******  *     *      * *  ** *** *** * * * *

LYC.ES_E        AGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGAC
YAR.LI_A        CGGTTGATGG-GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAAC
                 * * ***   * *   *  *   *  *** ****   ***** *     *  * *  **

LYC.ES_E        CCGTGAGGCTGGTTTCACAGAGCAA--CGAAAAACTTCCGCTTTGTGCAGTGGAAGGATA
YAR.LI_A        T-GGGAAACT---TCAGTGGAGCAATCCAGCAGAGATCCAGT---TGCCGTGG--GTATG
                  * **  **   *     ******  *   * *  ***  *   *** ****  * ** 

LYC.ES_E        ACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGTTCTAGTTAAACTACCA
YAR.LI_A        GCGGTGGGATCGCAACCAAGTGGTAT--ATGTTATGGAAGATATTT-------ACGATCA
                 ***   * *  *  ******   **  ***        * * **        ** * **

LYC.ES_E        CATTTT
YAR.LI_A        CGATT-
                *  ** 

[Download ClustalW]

#582

Mean pairwise ID: 45.45%


LYC.ES_N        -GTTG--AGCTTAGTAACGTGGGCTTGTAACCCAAGTG-GGGATGTTAATGTGGTGGAAT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTG-TAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGC
                   **  ** ** * * * *  * *  * ** *   ** * * * * * *****      

LYC.ES_N        GTTGGGCTGTACCAGATGGTTGGGCTTGGTGGGCTA-ATTTCTGACTTGCCCTATCCAAG
DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAG
                 *  *****      *  *    **      *   *  **   *    * **   * ***

LYC.ES_N        CTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGGGG
DRO.MEL.        CTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGA
                ***    *        *** *      **     ***  * *  * *   *** * *** 

LYC.ES_N        CGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTC-GCTCTAAGCGGTGGAAG
DRO.MEL.        TGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGG
                 * *  * *  ***  ***   *   **** * *  **** * *   ** ** ** *  *

LYC.ES_N        GATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACCA
DRO.MEL.        GATAGCGTACCGGAGTGGACTG---CCGTTATCAGCCCA---ACCGATATGGTTGGACCA
                **** **   *** **   ***   **  ** *  *  *      * *    **  ****

LYC.ES_N        CCATTTTT
DRO.MEL.        CAATCTTT
                * ** ***

[Download ClustalW]

#583

Mean pairwise ID: 45.45%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGT-GGCGCGGATGC
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                    ***      **       *******   * ***   **   * *  *** *** * 

ZEA.MA_B        TTTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCCCAAGT
TRY.BR_A        CTTGGACAAGCG--GGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTG---GTTGCGTGT
                 ***     *     ***    *   *****      *   * *****    *  *  **

ZEA.MA_B        TGGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGGCAG
TRY.BR_A        CGGTGTTGAG-GTCGCCACTGTAGAGAG------GCGTTCTCGCGCCGTTAAAGTGGGGG
                 ***  **   * **   ** *** **       * **    **     ** ** **  *

ZEA.MA_B        GAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGTGGGAG
TRY.BR_A        GAACGG-GTCAGGCCGG--TGACGGAGCAGCCCAC-CTTGCGCACGTTC--CCGTTCGAG
                *** ** ** **** **  * ** *******   * ** ** *** * *  * **  ***

ZEA.MA_B        GATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAG-ATCCTCTCTTAGCAAACCA
TRY.BR_A        AAGCACACCGAGGAGCATCTCAGGACTT-TGCGCCCCAAGTGTCGTCGCGAGGCGG----
                 *  ***    *  ***  *   * *     *   ** **  ** ** *   **      

ZEA.MA_B        CCATCTTT
TRY.BR_A        --------
                        

[Download ClustalW]

#584

Mean pairwise ID: 45.45%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
LEP.COL.        ----GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCTTTCACCAGCTGAACAGGGAGC
                       * * * * *  ********    * ****  * *    *   *****  * * 

HUM.LU_B        CAGCCCAGT--GGATCGGGT-CCAGTGTTAGCTGCTTACTGGTCTGCCCA-TTCCAAGCC
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGTC
                   *       * ** **** *  * *       * *  ** *****     *    * *

HUM.LU_B        GGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGGG
LEP.COL.        GGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGC--CCCCTCCGTTAAAGTAGAGGA
                **  *       * *   *** *  *****   * *   * *  *   ** *** **** 

HUM.LU_B        CAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTC-CCGGCAGTGGAAGG
LEP.COL.        -ACTGGGTCAGGCCGGC--AACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCAGA
                 * ** ** **** **    ** *******  * ***** *** *  * ** ** * ** 

HUM.LU_B        ATAACGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACCA
LEP.COL.        ACCACACCGCGG--------AGCCTGTCATCACCTGCGCCCCAGGCGATCCTGTGAAGCT
                *  **    ***         * *   ***   *   *  ** * *  *     * * * 

HUM.LU_B        TTTCCTTT
LEP.COL.        TT------
                **      

[Download ClustalW]

#585

Mean pairwise ID: 45.45%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***      **      ********   * ****    *   * *    * *** *

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
TRY.BR_B        TCT----TGGA---CAAGCGGGGGTTCTGTTGCGTTGA---CTTGGTGTTCTGCTTG---
                * *    ****     * *  ***  *  *   ****    **** **   ***  *   

ORY.SA_A        CAAGTTGCGTAGTGG-GCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCC
TRY.BR_B        ---GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGC-------GTTCTCGCGCCG
                   *******   ** *  *  *  **    *   **           * *    ** * 

ORY.SA_A        CTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCC
TRY.BR_B        TTAAAGTGGGGGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTC
                 ********  ** ** * ** **** **  * ** *******   *  *** * * * *

ORY.SA_A        ATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCT
TRY.BR_B        --CCGTTGCAGAAGCACACCGAGGAGCATCTCAGG---ACTTTGCGCCCCAAGTGTCGTC
                  * ** * ** *  ***    *  *** **  **    ***   ****  ***  *   

ORY.SA_A        ACAACAGACCACCATCTTT
TRY.BR_B        GCGAGGCGGTTT-------
                 * *               

[Download ClustalW]

#586

Mean pairwise ID: 45.45%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     *** ****  

ZEA.MA_E        TTTGCGATG--GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATG---TCGTCGTCTACGTC-GACCGAGC-GTCCGTGC
                  ** ** *  *  * *** *   *   ***   * * * *  * ***  * * **** *

ZEA.MA_E        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.EL_D        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                ****      **  *  * ***    *    * * **  *     *      * * * * 

ZEA.MA_E        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTTCCAACGGT
CAE.EL_D        GTCGTGGATGGTTCAGGACCGA------AAGGTAGCAGACAAAAGC-GACCGC-----GT
                * *  * ****     * * *       *  * ***   **   ** * *  *     **

ZEA.MA_E        GGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAG---
CAE.EL_D        GGTGCAGTGGCCGG--ACCGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACC
                **     *  * **   * ** ***  *     ** **    ** *****     *    

ZEA.MA_E        --CAGACCACC-ATCTTT-
CAE.EL_D        TTCAGACCACTTATCATTT
                  ********  *** ** 

[Download ClustalW]

#587

Mean pairwise ID: 45.45%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGG--AAATGGGACTTTAGT
LEP.COL.        -GCC--GGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTC
                 ***  * * * * *  ********   * ***         *   **  **    *   

HUM.JA_B        TCGGCCCAT-TGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCATTCCAAGCCGA
LEP.COL.        TGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCT--TGGCTGTGTGTCGG
                * * **    * *   *  * * * ***  *    ****  ***      *    * ** 

HUM.JA_B        GAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTC-CTAAAGCGGAGGGC
LEP.COL.        AGGCCTCCGGGTGCCCCCTTGCAGAAGG---GGCGCGCCCCCTCCGTTAAAGTAGAGGA-
                  *       ***    *  *  *****   ***  *  *    *  *****  ****  

HUM.JA_B        AATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTC-TCGGCAGTGGAAGGA
LEP.COL.        ACTGGGTCAGGCCGGCA--ACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCAGAA
                * ** ** **** **    ** *******  * ***** *** * ** ** ** * ** *

HUM.JA_B        TAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGGACCA
LEP.COL.        CCACA---CCGCGGAGCCTG---TCATCACCTGCGCCCCAGGCGATCCT--GTGAAGCTT
                  **    * * *  ** **    ** **       *  **  **  **   *    *  

HUM.JA_B        TTTCTTTT
LEP.COL.        T-------
                *       

[Download ClustalW]

#588

Mean pairwise ID: 45.48%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
LYC.ES_M        ---------------------------------CAAGTGGGGATGTTAAGGTGGTGGAAT
                                                 * * * **** * * ******  * **

HOM.SA_B        CGCTTGA-GCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAA
LYC.ES_M        ATTGGGCTGTCCCAGATGGCTGGGCT-TGGTGGGCTA-ATTTCTGGCCTGCCCTGTCCAA
                     *  * **  **   ******* * *** ****      ***  ** **   * **

HOM.SA_B        GTTCGGCATCA-ATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
LYC.ES_M        GCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT-CCTAAAGTGG
                *  * *  *   **   * * **     * *     ** *  *  * ** ***** * **

HOM.SA_B        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
LYC.ES_M        GGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGA
                ** * ****    ***  **    ** ******   * * ******  ***  **** * 

HOM.SA_B        GGGAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCTGAGCAACA----TAGCGAGA
LYC.ES_M        AGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAAC
                 ****   * * * ***  *   **  * ** *   **** *           *   *  

HOM.SA_B        CCCCGTCTCT
LYC.ES_M        AACCACCTTT
                  **  ** *

[Download ClustalW]

#589

Mean pairwise ID: 45.48%


CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGT--GGAT
LYC.ES_M        ------------------------CAAGTGGGGATGTTAA-GGTGGTGGAATATTGGGCT
                                          ***  *  * ** * *** *   * * *  ** *

CAE.BRI.        GGAGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAA
LYC.ES_M        GTCCCAGATGGCTGGGCTTGGTGGGC-TAATTTCTGGC--CTGCCC--TGTCCAAGCACA
                *      * **  * *    *****  *  *      *  *  **    ****  **  *

CAE.BRI.        GCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
LYC.ES_M        GAGTTGGATCACGAGG----CCCAAATGAAAATATGG-GCTTCTTGATTCCTAAAGTGGG
                * * **  ** * ***     **    * **   *** * * *  *   * *** * * *

CAE.BRI.        GTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCC
LYC.ES_M        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAA
                * * ** **    *** *     *   *****  ** ***  **** * *********  

CAE.BRI.        GGATAGCGCTT--GTGAGTTGTC--GCTCGCCCACAGCCTCTCTGATACCTTCAG--ACC
LYC.ES_M        GGATAATGGGTCGGTGTCTTATCAAGTTCAGTAAC-GCCTAATGGGTTGCTCCAATAAAC
                *****  *  *  ***  ** **  * **    ** ****    * *  ** **   * *

CAE.BRI.        ACTTGTCATT
LYC.ES_M        AACCACCTTT
                *     * **

[Download ClustalW]

#590

Mean pairwise ID: 45.48%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATG------GGGGCATTAATGTGG-TGG
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                 *** *  * **   * * ** *** *  **  *       **   *  * ***** ***

LYC.ES_I        AATGTTGGGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCA
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAA--CGGCGACCGAGC-GTCCGTGCCA
                * **  ***  *   *   *** **   * **           * **   * **   ***

LYC.ES_I        AGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGTAAAGTGG
CAE.BRI.        AGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGT
                ***   * ** *      **  **     ****    *   * *  *   * *** * * 

LYC.ES_I        GGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGTGGA
CAE.BRI.        GGTGCACGGCTCAGGGCCGAA---AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGC
                ** * *  **    *** *     *   ****   * ***    *** *   ** **** 

LYC.ES_I        AGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAAC
CAE.BRI.        CGGATAGCGCTTGTGAGTTGTC--GCTCGCCCACAGCCTCTCTGATACCTTCAGACCACT
                 ***** **  *  * *** **    **    *  ****    * *  ** **    *  

LYC.ES_I        CACCATTTTT
CAE.BRI.        TGTCATT---
                   ****   

[Download ClustalW]

#591

Mean pairwise ID: 45.48%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTA---CTCGGGAGGCTGAGGCCGGAG
                **** ** * ** *** * *******  ** ***     * *   ***  *  ** *  *

ORY.SA_A        TTTGGTGTGGATTCTGA--TCCTGGGCCCCATGTTGT-TGTAATCTTGCTGGCTTGCCCG
ORI.CUN.        GATCGCTTGAGTCCAGGAGTTCTGGGC----TGTCGTGCGCTATGCCGATCGGGTGTCCG
                  * *  **  * * *   * ******    *** **  *  **   * * *  ** ***

ORY.SA_A        TTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGG
ORI.CUN.        CACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG-----
                  * *****  * *       ** *       **    **          * **      

ORY.SA_A        CCCTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTT
ORI.CUN.        -CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC
                 ***** * **   * ** *    ***  **    ** ******     *   ****   

ORY.SA_A        CCATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCT
ORI.CUN.        TGATCAGTAGTGGGAT--CGCGCCTGTGAATAGCCACTGCACT-CCAGCCTGGG----CA
                  *** ** *  ****  *  **   ** *         * ** *  ***  *     * 

ORY.SA_A        CTACAACAGACCACCATCTTT
ORI.CUN.        ACATAGCGAGACCCTGTCTCC
                  * * *    * *  ***  

[Download ClustalW]

#592

Mean pairwise ID: 45.48%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACT-ATAAGATGG-TGGAACAC
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                          * * *       *******   * ***   * *  ** **    *    *

ARA.TH_G        TGGATCGGCC--CACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAG
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCT---CTGCTTGGCTGTGT
                **  * * **  **  **  *  *  *  **** * * *  **   ****          

ARA.TH_G        CTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAG
LEP.COL.        GTCGGAGGCCTCCGGGTGC-CCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG
                 *  ***    ***  **  **    * **    *   **  *  *   * ** ** ***

ARA.TH_G        GGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTC-TCAGCAGTGGAC
LEP.COL.        GA-ACTGGGTCAGGCCGGCA--ACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCA
                *  * ** ** **** ***   ** *******  * ***** *** * ** ** ** *  

ARA.TH_G        GGACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAA
LEP.COL.        GAACCACACCGCGGAGCCTGTCA--TCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT--
                * ** **    **  ***   **  **  **  *  **    * ** *     ****   

ARA.TH_G        CCACCATTTT
LEP.COL.        ----------
                          

[Download ClustalW]

#593

Mean pairwise ID: 45.48%


HUM.LU_B        ---GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                   *  * * *   ** * ** *** *  **  *    *   ** *  **  *   ** *

HUM.LU_B        GGTCAGCCCAGTGGATCGG-GTCCAGTGTTAGCTGC-TTACTGGTCTGCCCATTCCAAGC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 ** **   **  *  * * **     ***  ** * *     *   * ** * ******

HUM.LU_B        CGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGG
CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
                     **      * *  * ***   ******      * *   *  * **  * *  * 

HUM.LU_B        GCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAGG
CAE.EL_A        GGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGG
                * *  *     * * *     *   *****  *  * *  ****     *******  **

HUM.LU_B        ATAACGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACCA
CAE.EL_A        AC--CGCGCTTGTG--AGTTGACACAC-ATACGCAGCCTTCTCGATACCT--TCAGACCA
                *   ** **  ***  * ***   *** **   **    **  **  * *  ** *****

HUM.LU_B        TTTCCTTT--
CAE.EL_A        CTTATCATTT
                 **    *  

[Download ClustalW]

#594

Mean pairwise ID: 45.51%


HUM.JA_B        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGGACTT
RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
                    ***   *   **   *******  ** **      ** * *  *  *  **    *

HUM.JA_B        TAGTTCGGCCCATTGGATCGGATCCAGTGTTAGCTGC-TTGCTGGGCTGCCCATTCCAAG
RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                   **  * ***   * ** *  *    **  ***     * * ** ** **   * ***

HUM.JA_B        CCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCT--CCTAAAGCGG
RAT.NOR.        TTCGGCATCAA--TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
                    *  *  *  * **    **   **   *   **      *** *  ***** * **

HUM.JA_B        AGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGA
RAT.NOR.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
                 * * *  *    ***  **    ** ******    ** ******  **   **** * 

HUM.JA_B        AGGATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGG
RAT.NOR.        GGGAT--CGCGCCTGTGA-----ATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGA
                 ****  ** *** ***        * ****     * **    *   *   *    ** 

HUM.JA_B        ACCATTTCTTTT
RAT.NOR.        CCCGTCTCT---
                 ** * ***   

[Download ClustalW]

#595

Mean pairwise ID: 45.51%


CAE.BRI.        -ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATG
TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGG---CATAAACAAT--GTAGGTTGTGATA
                  * ****  *    *  * * ** *  **       *  **  *    * **   *** 

CAE.BRI.        GAGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAG
TET.THE.        GATAGGATATGAGAGTTTGATGAG-ACAGTTTGCTAAGA-----GTGTGCCCGCTCCAAA
                **  * *     ****    ** *    **  ** * *      * * * ***  **** 

CAE.BRI.        CGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                *  ** ** ** * **   *    * * **          ** ****    ***   *  

CAE.BRI.        TGCA-CGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGCCGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 * * ** ******   * **   * **** ****    ****  * **  ****  ***

CAE.BRI.        TAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTTCAGACCACTTGTCAT
TET.THE.        TAACAT-----ACTCATTAACTGTCAAACTAATCGGTTCTACTATCAAA--GCCAGACAT
                ** *       * *  *     * * *     **  *  ***  *** *   *  * ***

CAE.BRI.        T
TET.THE.        T
                *

[Download ClustalW]

#596

Mean pairwise ID: 45.51%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACT-
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                * *  *     *  **    **   * * *   *  *     *  *** ******     

ARA.TH_F        ---GGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAA
DRO.MEL.        TGAGGCTGGGATCTACTG--CGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAA
                   ** * ** **  * *  **   * **   *  ******   *    * **   * **

ARA.TH_F        GCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCAGGTTCTAGAGTCGGAG
DRO.MEL.        GCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTT----GGCTAAGG
                ***     * * **  * **   **   **   * **** * ******     *     *

ARA.TH_F        GGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTAC---TTCCCGCTTACAGCAGTGG
DRO.MEL.        AGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
                 *  ***     ***  *      * * ****  * *    ******      ***** *

ARA.TH_F        ACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGA
DRO.MEL.        TGGGATAGCGTACCGGAGT------GGACTGCCGTTATCAGCCCAACCGATATGGT-TGG
                  ****  **     * **      * **  *  *   * **    ***** *  * ** 

ARA.TH_F        ACCACCATTTT-
DRO.MEL.        ACCACAATCTTT
                ***** ** ** 

[Download ClustalW]

#597

Mean pairwise ID: 45.51%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGT-GGTGTGGATGC
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                    ***      **       *******   * ***   **   * *  * * *** * 

ZEA.MA_C        TTGGTACCGTGTCTTTGCCTGGGTTC-ATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAG
TRY.BR_A        CTTGGACAA-------GCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTG------G
                 * * **         **  ******  * * **    *** **  ****  *      *

ZEA.MA_C        TTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACC--TATAGTG
TRY.BR_A        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAG---AGGCGTTCTCGCGCCGTTAAAGTG
                ***   ** *  ****    *      ****      *** * ** *  **  ** ****

ZEA.MA_C        GCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGG
TRY.BR_A        GGGGGAACGG-GTCAGGCCG--GTGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTC
                *  ******* ** **** *   * ** *******   ***     **   *  * **  

ZEA.MA_C        AAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAG
TRY.BR_A        GAGAAGCACACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG
                 ** *  ***       *** *   **     **  * ** *    ** *    * ** *

ZEA.MA_C        ACCACCATTTTT
TRY.BR_A        ------------
                            

[Download ClustalW]

#598

Mean pairwise ID: 45.51%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
TET.ROS.        ----GCCAGGGTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTT--AGAAT
                    * *  *** **   *******   * *   *       *   **  **   ** **

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTAAG
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGTTCCAAA
                 *   ***     *****    *    ***  ****     *  * *** ***  * ** 

HOM.SA_B        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                    *  *   *******    **  * *   **    *******      ***    * 

HOM.SA_B        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ****** * ****  ** *** ** ****  ***  * ***         ** *  ***

HOM.SA_B        T--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGAGCAACATAGCGAGACCCCGTCTC
TET.ROS.        TAACATACTCATTAACTGTCAAGCTAATCGGTTCTGC-TATTCTGATCAGACACT-----
                *  *   *   * **  * **    * **    ***   *   *    **** *      

HOM.SA_B        T
TET.ROS.        -
                 

[Download ClustalW]

#599

Mean pairwise ID: 45.51%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATG----TGGGGACATTAAGATGGTGGGAC
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGA-
                * ** **   **  *    ** ****  **  *    * ****   * **   *  *** 

ARA.TH_A        ACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCA
GAL.GAL.        -TCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTA
                   * **  *  *    * ** *  ***  *** ** ***       *  * **   * *

ARA.TH_A        AGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCG
GAL.GAL.        AGGCCGGCATCAATA-TGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAG
                **    *  * * ** ** ****    * * ** *  *** **    * * *   **  *

ARA.TH_A        GAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGG
GAL.GAL.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAA
                * * * *  *    ***  **    ** ******     *  *****       ****  

ARA.TH_A        ACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCT-GCTGGTCCGATCTCATATG
GAL.GAL.        CGGGATCGCGCCT-------GTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGAG
                  ***** **  *       *   * * *****   ** * **  *  * *  *     *

ARA.TH_A        AACCACCATTTT
GAL.GAL.        ACCCTGTCTCC-
                * **    *   

[Download ClustalW]

#600

Mean pairwise ID: 45.54%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCG----GGGGCATTAAGGTGGTGTGAA
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                 *** ** * ** ***   ** ****  ** ***     ***    * **   *   ** 

ZEA.MA_A        TGCTTT-GCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATC
GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAG-TGCGCTATGCCG--AGCGGGC--GTCCGCG
                 ****  **   **  ********    *   ** * ** *    ** ***  * **   

ZEA.MA_A        CCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGA
GAL.GAL.        CTAAGGCCGGCATCAATATGGTGAGCCCCGG-GGAGCCGAGGCACACCAGGTTGCCTAAG
                * ***   *   *   *   * * ** *  * * *  *   *     * *    ***   

ZEA.MA_A        GCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGG
GAL.GAL.        GAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAG
                * **   ***  *    ***  **    ** ******     *   **    **   * *

ZEA.MA_A        TGGGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGC
GAL.GAL.        TAACGGGATCGC---GCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCA----ACATAGC
                *    ****  *   ***  ** *     *    * *  ** **  * *    **  ***

ZEA.MA_A        AAACCACCATCTTT
GAL.GAL.        GAGACCCTGTCTCC
                 *  * *  ***  

[Download ClustalW]

#601

Mean pairwise ID: 45.54%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACACT-
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                * *  *     *  **    **   * * *   *  *     *  *** ******     

ARA.TH_A        ---GGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCCAA
DRO.MEL.        TGAGGCTGGGATCTACTG--CGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAA
                   ** * ** **  * *  **   * **   *  ******   *    * **   * **

ARA.TH_A        GCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGG
DRO.MEL.        GCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGC--ATTCAGGTT----GGCTAA
                ***     * * **  * **   **   **   * ****  ** ******     *    

ARA.TH_A        AGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTAC---TTCCCGCTTACAGCAGT
DRO.MEL.        GGAGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGT
                 * *  ***     ***  *      * * ****  * *    ******      *****

ARA.TH_A        GGACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATAT
DRO.MEL.        AGTGGGATAGCGTACCGGAGT------GGACTGCCGTTATCAGCCCAACCGATATGGT-T
                 *  ****  **     * **      * **  *  *   * **    ***** *  * *

ARA.TH_A        GAACCACCATTTT-
DRO.MEL.        GGACCACAATCTTT
                * ***** ** ** 

[Download ClustalW]

#602

Mean pairwise ID: 45.54%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCA------TGTGGGGACATTAAGATGGTGGG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                  *****   **  *    ****** *  **      **  ** * ** *   ***  **

ARA.TH_A        ACACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCC
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGT--CGTTGTCAACGT-CGACCGAGC-GTCCGTGCC
                *    *    **   *  *  *  **   * ***   * *    * **** * **   **

ARA.TH_A        AAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTC
CAE.EL_C        AAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGA--TGGTCAGTCCCGGGTGCATAA--
                ****  ** ** *  ** *      **   ****   ***    * * ** *  * *   

ARA.TH_A        GGAGGGTAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACTTCCCGCTTACAGCAG
CAE.EL_C        --GGAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAG
                   * **  **  **   * **    * **  *****  *  *    ****     ****

ARA.TH_A        TGGACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATA
CAE.EL_C        TGGCCGGACAGCGCTTGTGAGTTGACACGTATA--CACAGCCTTCTCAAT-ACCTTCAGA
                *** ****   ** **  * ** *    * *     *  **** **         *** *

ARA.TH_A        TGAACCACCATTTT
CAE.EL_C        CCACTTGTCACT--
                  *     ** *  

[Download ClustalW]

#603

Mean pairwise ID: 45.54%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCC-GCTTAG
                             **    **   * *  *      **  ** ******   * *   * 

RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCACTAA
TRY.BR_B        CGGGGACGTCTTGGA----CAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTC-TGCTTG
                **     ***  ***       ** *  ** * * *  *  **   ***** *   **  

RAT.RAT.        GTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGG
                ***  *  **  * * * *  * ** * * ** * **      *  *  *  *** * **

RAT.RAT.        GGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
TRY.BR_B        GGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTGCAG
                ** **** **  **** ***  *********  **   **  **  *    * ** *  *

RAT.RAT.        GATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCT
TRY.BR_B        AAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT--
                 * * * **   **  * * **   *  * *  **   *   * * ***** *    *  

RAT.RAT.        CTT
TRY.BR_B        ---
                   

[Download ClustalW]

#604

Mean pairwise ID: 45.57%


HUM.JA_B        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTA
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG---ACGGTAGATAAG--TGTG
                     ** * *   ** * ** *** *  **  *    *     ** * **  *  * * 

HUM.JA_B        GTTCGGCCCATTGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCAT---TCCAAG
CAE.EL_A        GATGGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTG
                * * *    *  ***  *  *** ****  *  * *  **  *  * **     ***  *

HUM.JA_B        CCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCTAAAGCGGAG
CAE.EL_A        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGC--GGTTAGTCCCGGGTGCATAA
                ** ** * *  *      * *    **    *   ***  *** **  **    **  * 

HUM.JA_B        GGCAATGCGTGAGGCT--GGTTTCACAG--AGCAGCGACAACCTCCCGCTCTCGGCAGTG
CAE.EL_A        GGAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                **    * *   ** *  **    * **  *****  * ** *  ****     ******

HUM.JA_B        GAAGGATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATA
CAE.EL_A        GCCGGAC--CGCGCTTGTGAG---TTGACACAC-ATACGCAGCCTTCTCGATACCT--TC
                *  ***   ** **  ***     * *** *** **      *      **  * *  * 

HUM.JA_B        GGACCATTTCTTTT--
CAE.EL_A        AGACCACTTATCATTT
                 ***** ** *  *  

[Download ClustalW]

#605

Mean pairwise ID: 45.57%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTT--GTGACC-CGAGTGGGGACAATAAGGTGGTGGAACA
DRO.MEL.        ---GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATG
                   **    *     *  *****  ** * * **  *  *     *  * * **** *  

ARA.TH_D        GT----GGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTC
DRO.MEL.        GCCTGAGGCTGGGATCTACTG--CGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCAC
                *     ** *    **  * *  ** * * **      *** *    *    * **   *

ARA.TH_D        CAAGCT-GTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGAC--TCAGGCGGATTCTAAA
DRO.MEL.        TAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCT---AA
                 ***** *  *  *** ** ***     *  **   * ** *  *****  *  *   **

ARA.TH_D        GTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCA
DRO.MEL.        GGAGGGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCA
                *  **   * *  * *  ***  ***   *   ****** *  * *****       ***

ARA.TH_D        GTGGATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTC
DRO.MEL.        GTAGTGGGATAGCGTACCGGAGT------GGACTGCCGTTATCAGCCCAACCGATATGGT
                ** *  ****       ** ***      *  *  *  *   * **     **** *   

ARA.TH_D        CTGGACCACCACTTT-
DRO.MEL.        -TGGACCACAATCTTT
                 ******** *  ** 

[Download ClustalW]

#606

Mean pairwise ID: 45.60%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-G
                    ***       ***     *******   * ***   **   * *    *   ** *

ARA.TH_E        GTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGT--CCAAGC
TRY.BR_A        TCTTGGACAAGCGGG--GGTTCTGTTGC-GTTGACTTGGTGTTCTGCTTGGTTGCGTGTC
                  * **     ****  **********  *     **  **  ****   **  *    *

ARA.TH_E        TGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAGG
TRY.BR_A        GGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGC-------GCCGTTAAAGT--GGGG
                 ***   * * **    ***  ** *  *   * **       **   ******  * **

ARA.TH_E        GTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGG
TRY.BR_A        GGAACGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGA
                * ** * ** **** ***   ** *******  * ** *  ***      * **    * 

ARA.TH_E        ATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCA
TRY.BR_A        AGCACACCGAGGAGCATCTCAGGACT-TTGCGCCCCAAGTGTC-GTCGCGAGGCGG----
                * ****     * *   ***** **   *  * **     *** *     *   *     

ARA.TH_E        CCATTTT
TRY.BR_A        -------
                       

[Download ClustalW]

#607

Mean pairwise ID: 45.60%


GAL.GAL.        ------GCCGGGCGCGGTGGCGCACGCCTGTAGTC-CCAGCTACTCGGGAGGCTGAGCCC
LEP.COL.        GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGT----
                      ***  ** * **  *   **   *   ** ******   * **  ****     

GAL.GAL.        GCCGGATCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCG
LEP.COL.        -CTGGACCAGCATAG----GGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGTG
                 * *** *     **    ** * *   ***      * * *   * *   **  **  *

GAL.GAL.        CGCTAAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAA
LEP.COL.        T-CGGAGGCC--------TCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAA
                  *  *****        *  **    ****  * **  * *** * **   *    ***

GAL.GAL.        GGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGT
LEP.COL.        AGTAGAG-GAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTCGCGCACGTCTGCC-GT
                 *  * * **** **  **** *** **********  **   * * *  * * * * **

GAL.GAL.        AACGGGATCGCGCCTGTGAATA-GCCACTGCAGCGTAGCCTGGGCAACATAGCGAGACCC
LEP.COL.        TGCAGAACCACACCGCGGAGCCTGTCATCACC-TGCGCCCCAGGCGATCCTGTGAAGCTT
                  * * * * * **   **    * **   *   *   **  *** *    * **  *  

GAL.GAL.        TGTCTCC
LEP.COL.        T------
                *      

[Download ClustalW]

#608

Mean pairwise ID: 45.63%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACAT-TTAGATGGTGGAACACT
LEP.COL.        -----GCCGG--AGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                     **     * * *     *******   * ***        ** **       *  

ARA.TH_E        GGTTCGGGTC--CACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGTCCAAG
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCT---CTGCTTGGCTGTGT
                 **  **  *  **  **  * **  *  **** * ** * **   ****   *      

ARA.TH_E        CTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAG
LEP.COL.        GTCGGAGGCCTCCGGGTGC-CCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGAG
                 *  ***     ** ***   *    * **    *** *   *      * **  * ***

ARA.TH_E        GGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA-CAGCAGTGGAC
LEP.COL.        GA-ACTGGGTCAGGCCGGCA--ACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGCA
                *  * ** ** **** **    ** *******  * ** ** ***    * ** ** *  

ARA.TH_E        GGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAAC
LEP.COL.        GAACCACACCGCGGAGCCTGTCATCACC----TGCGCCCCAGG--CGATCC--TGTGAAG
                * * ****     * * *  ***  ***    **  *  * **  *****   * **** 

ARA.TH_E        CACCATTTT
LEP.COL.        CTTT-----
                *        

[Download ClustalW]

#609

Mean pairwise ID: 45.63%


LYC.ES_O        -GCCG--AGCTTAGTAACGTGGGCTTGTAACCCAAGTG-GGGATGTTAAGGTGGTGGAAT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTG-TAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGC
                  * *  ** ** * * * *  * *  * ** *   ** * * * * *  ****      

LYC.ES_O        ATTGGGCTGTCCCAGATGGCTGGGCTTGGTGGGCTA-ATTTCTGGCCTGCCCTATCCAAG
DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAG
                 *  *****      *  **   **      *   *  **   **   * **   * ***

LYC.ES_O        CACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGG
DRO.MEL.        CTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGA
                *      *        ***        **     ***  * *  * *  **** * *** 

LYC.ES_O        TGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAG
DRO.MEL.        TGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGG
                ** **** *  ***  ***   *   **** * ** *  * ***   *  ***** *  *

LYC.ES_O        GATAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACC
DRO.MEL.        GATAGCGTACCGGAGT----GGACTGCCGTTA---TCAGCCCAACCGATATGGTTGGACC
                **** ** ***** *       * * ** ***    * *     * * *    **  ***

LYC.ES_O        ACCACTTT-
DRO.MEL.        ACAATCTTT
                ** *  ** 

[Download ClustalW]

#610

Mean pairwise ID: 45.63%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                  *****   **  *  * ****** *  **  *         ******   *   *  *

ARA.TH_E        GTTCGGGTCCACGGGCCGGT-TCTGTTGTTGGCA-TGTTTCTGGGCTGCCCAGTCCAAGC
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
                  *  *       * ** ** * *** **** **  **     *   * **   ******

ARA.TH_E        TGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAGG
CAE.EL_C        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG-----GA
                  ** ** *   * *  ** *   ** * * * * *     *** * *  ***     * 

ARA.TH_E        GTAATGCGTGAGGCTGGTTTCACAG--AGCAGCGACTACTTCCCGCTTACAGCAGTGGAC
CAE.EL_C        GTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCC
                **  **  **   * **    * **  *****  *  *    ****     ******* *

ARA.TH_E        GGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAAC
CAE.EL_C        GGACAGCGCTTGTGAGTTGACACGTATA--CACAGCCTTCTCAAT-ACCTTCAGACCACT
                ***   *  **  * ** *    * *     *  **** **         *** *  *  

ARA.TH_E        CACCATTTT
CAE.EL_C        TGTCACT--
                   ** *  

[Download ClustalW]

#611

Mean pairwise ID: 45.63%


LYC.ES_G        -GCCG--AGCTTAGTAATGTGGGCTTGTAACCCAAATG-GGGGCATTAATGTGGTGGAAT
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTG-TAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGC
                  * *  ** ** * *   *  * *  * ** *   ** * **  * * *****      

LYC.ES_G        GTTGGGCTGTACCAGATGGTTGGGCTTGGTGGGCTA-ATTTCTGGCCTGCCCTATCCAAG
DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACTAAG
                 *  *****      *  *    **      *   *  **   **   * **   * ***

LYC.ES_G        CACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGG
DRO.MEL.        CTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGGA
                *      *        ***        **     ***  * *  * *  **** * *** 

LYC.ES_G        TGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAG
DRO.MEL.        TGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGTGG
                ** **** *  ***  ***   *   **** * ** *  * ***   *  ***** *  *

LYC.ES_G        GATAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACC
DRO.MEL.        GATAGCGTACCGGAGTG----GACTGCCGTTATCAGCCCA---ACCGATATGGTTGGACC
                **** ** ***** *       * * ** ***    *  *    * * *    **  ***

LYC.ES_G        ACCACTTTT
DRO.MEL.        ACAATCTTT
                ** *  ***

[Download ClustalW]

#612

Mean pairwise ID: 45.66%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGAACTT
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                   ** *   *   *     ******  ** **      ** * *  *     *     *

HUM.LU_C        TGGGTCAACCCAGTGGTNCGGGNC--CAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAA
GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGC-GTCCGCGCTAA
                 *  * * *****  ** * ** *  ******    ***  * * *** * **   * **

HUM.LU_C        GCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACT-CCTAGACTGGA
GAL.GAL.        GGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGG
                * * **        **  *  **  ** **            *    * ****    ** 

HUM.LU_C        GGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAA
GAL.GAL.        GTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACG
                * * *  *    ***  **    ** ******     * ******  *  * ****    

HUM.LU_C        GGATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGA
GAL.GAL.        GGAT--CGCGCCTGTGAAT----AGCCACTGCAGCGTAGCCTGGGCAACA--TAGCGAGA
                ****  ** *** ***       *****   * *   * *  **   **   **    **

HUM.LU_C        CCATTTCTTTT
GAL.GAL.        CCCTGTCTCC-
                ** * ***   

[Download ClustalW]

#613

Mean pairwise ID: 45.67%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
TET.ROS.        GCCAGG----GTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAG
                *** **    ** **   ******* * *  *        *  *   *    * * ** *

XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
TET.ROS.        TCAGAGTATGAGAGTTTGATGAGACAGTTTGCTAAG-----AGTGTGCCCGTTCCAAACA
                   ****    *****    *   ** *  **** *      * *** ***  * **   

XEN.LAE.        CGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGG-GG
TET.ROS.        GTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGG--GCATTAAAGAGCTGA
                  *  *   *******        * *        ********  **  *** ***  * 

XEN.LAE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ****** * ****  ** *** ** ****  ***    ***         ** *  ***

XEN.LAE.        T--CGCGCCTGTGAATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGTTCT
TET.ROS.        TAACATACTCATTAACTGTCAA-GCTAATCGGTTCTGCTATTCTGATCAGACACT-----
                *  *   *   * **  * *   **  * * *       *        ******      

[Download ClustalW]

#614

Mean pairwise ID: 45.69%


ZEA.MA_E        -NCCGAGCTCTGTAGCGAGAGCTTGTAACC-CGAGCGGGGGCATTAAGGTGGTGCGGATT
DRO.MEL.        GACTGGAA--GGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTG-GGATG
                  * *      ** *  **    ***** * **     * *   *  * * *** **** 

ZEA.MA_E        CTTTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCC
DRO.MEL.        GCCTGAGGCTGGGATCTACTGCGTAGCGGACCA-GCTCATGTTGACGGAACGTCCGCACT
                   ** *   *   ***    *   **   * * *  * * * * ***   * ***  * 

ZEA.MA_E        AAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTG
DRO.MEL.        AAGCTTGCCATCAATA-TGGGTGCCATGGAGGAGTCCGTGGCATT--CAGGT-TGGCTAA
                *** * *   *   *   **  **  * * ***  *  ***  *   ***   **     

ZEA.MA_E        GCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCG--CCGGCTTCCAACGG
DRO.MEL.        GGAGGGATGAACCGGGCCAGGGGTGA-AAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAG
                * *** ***    * * * **  * * * * ****   **   *  ** *       * *

ZEA.MA_E        TGGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCA
DRO.MEL.        TAGTGGGATAGCGTACCGGAGTGGACTGCCGTTA--TCAGCCC---AACCGATATGGTTG
                * *  ***** **  ***  *      *     *  **** **   * **    *     

ZEA.MA_E        GACCACCATCTTT
DRO.MEL.        GACCACAATCTTT
                ****** ******

[Download ClustalW]

#615

Mean pairwise ID: 45.69%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGT----GGGGACAATAAGGTGGTGGAAC
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                  *****   **  ** * ********  *   *    *  *  *     ***  *    

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAA
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGT-CGACCGAGC-GTCCGTGCCAA
                ****     *    **  **       * **   ** *    * **** * **   ****

ARA.TH_D        GCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGA
CAE.EL_C        GCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG-----
                **  ** ** * * * *   * * * ** * * * * *     *** * *  ***     

ARA.TH_D        GGGTAATGCGTGAGGCTGGTTTCACAG--AGCAGCGACTACTTCCCTCTTACAGCAGTGG
CAE.EL_C        GAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGG
                * **  **  **   * **    * **  *****  *  *    ** *     *******

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGG
CAE.EL_C        CCGGACAGCGCTTGTGAGTT-----GACACG-TATACACAGCCTTCTCAATACCTTC-AG
                  ***      **   ***      **  *  ***   * **    ** **  ** *  *

ARA.TH_D        ACCACCACTTT--
CAE.EL_C        ACCACTTGTCACT
                *****   *    

[Download ClustalW]

#616

Mean pairwise ID: 45.70%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
TET.ROS.        ----GCCAGGGTAGCA-ATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGA--AT
                    * *  *** **   *******   * *   *       *   **  * * **  **

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGTTCCAAA
                 *   ****    *****    *    ***  ****     *  * *** ***  * ** 

HOM.SA_A        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.ROS.        CAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGA
                    *  *   *******    **  * *   **    *******      ***    * 

HOM.SA_A        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                 ****** * ****  ** *** ** ****  ***  * ***         ** *  ***

HOM.SA_A        T--CGCGCCTGTGAATAGCCACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCTC
TET.ROS.        TAACATACTCATTAACTGTCAAGCTAATCGGTTCTGC-TATTCTGATCAGACACT-----
                *  *   *   * **  * **    * **    ***   *   *    **** *      

HOM.SA_A        TT
TET.ROS.        --
                  

[Download ClustalW]

#617

Mean pairwise ID: 45.71%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGGATGC
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     ********* 

ZEA.MA_C        TTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCC---TGCCCGTTCCA
CAE.EL_C        --AGTGAGAGGAGGAGTCCTGTGTATGTCGT-TGTCAACGTCGACCGAGCGTCCGTGCCA
                   **     *      **** **   * ** ** *   ** * **    * **** ***

ZEA.MA_C        AGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTG
CAE.EL_C        AGCGCTGCGTCACCAGGGGATGACTGTCGGAAGA---TGGTCAGTCCCGGGTGCATA---
                **      **  **   *** *  **   * **    *** *   *  **    ***   

ZEA.MA_C        GCAGGAACGGCGTGAGGCT-GTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTG
CAE.EL_C        --AGGAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGC--GCGGTG
                  ****  ** *   ** *      *  *  * ***   **    *  *      *****

ZEA.MA_C        GAAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAG-C
CAE.EL_C        CAGTGGCCGGACAGCGCTTGTGAGTTGACACGTATA---CACAGCCTTCTCAATACCTTC
                 *  *     *   * **   *  * * * **  **   *  ** ****  * **    *

ZEA.MA_C        AGACCACCATTTTT-
CAE.EL_C        AGACCACTTGTCACT
                *******   *    

[Download ClustalW]

#618

Mean pairwise ID: 45.72%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TET.ROS.        ----GCCAGGGTAGCAA-TGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAAT--
                      *   ** **    ** *****    *  *         *    ***  * **  

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
TET.ROS.        AGTCAGAGTATGAGAGTTTGATGAGACA--GTTT--GCTAAGAGTGTGCCCGTTCCAAAC
                *** **** * ***   *   *  * *   ** *  *   *  * * * **** **** *

CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTCGT
TET.ROS.        AGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCAT-TAAAGAGCTGA
                  *  **  * * **   **   * * **   *  *   ** ***    *** ***  * 

CAE.EL_D        GGA--TGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCGGA
TET.ROS.        GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
                ***   *  *****   * **   * ***  ****    **** *  **  ****  ***

CAE.EL_D        C--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTATC
TET.ROS.        TAACATACTCATTAACTGTCAAGC-TAATCGGTTCTGCTATTCTGATCAGAC-ACT----
                   *   **  * *  ** **  * **  * *   *     *    ****** ***    

CAE.EL_D        ATTT
TET.ROS.        ----
                    

[Download ClustalW]

#619

Mean pairwise ID: 45.75%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TET.THE.        -------GCCAGGGTAGCAATACCTGTGTCTATATGTGG--CATAAACAA-TGTAGGTTG
                       * *  **  *       ** ***    * * *    ** * ** *** * * *

CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTC-TACGTCGACCGAGCGTCCGTGCCAAG
TET.THE.        TGATAGAT-AGGATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAA
                 *  ***  ****     * ** **  *      *  *   *  * * * ***  **** 

CAE.EL_A        CGCTACGTCACCAGGG-GATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTC
TET.THE.        CAATGAGTTGCTATGGTGGTAACC-TAGTAATAGGACTCCACCAGGGCAT-TAAAGAGCT
                *  *  **  * * ** * ****  * * **   *  *   ** ***    *** ***  

CAE.EL_A        GTGGA--TGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCG
TET.THE.        AAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAG
                  ***   *  *****   * **   * ***  ****    **** ** **  ****  *

CAE.EL_A        GAC--CGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCGATACCTTCAGACCACTTA
TET.THE.        GATAACATACTCATTAACTGTCAAAC-TAATCGGTTCTACTATCAAAGCCAGAC-ATT--
                **   *   **  * *  ** ** ** **  * *   *      *    ***** * *  

CAE.EL_A        TCATTT
TET.THE.        ------
                      

[Download ClustalW]

#620

Mean pairwise ID: 45.75%


LYC.ES_E        GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATATTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGACG
                    ***       * * *   *******   * **** ** *   *    *       *

LYC.ES_E        GGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCAAGTACAG
TRY.BR_B        TCTTGGACAAGCGGG--GGTTCTGTTGCGTTGACT--TGG--TGTTCTGCTTGGTTGC-G
                   **  * **  **  **   ** ** * * * *  ***  **  **       * * *

LYC.ES_E        AGTTGGATCATGTGGTC-CAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTGGA
TRY.BR_B        TGTCGG-TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGGGAA
                 ** ** *  ** **** * * ** *   * * * *          ********** * *

LYC.ES_E        CCCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGATAA
TRY.BR_B        CGGGTCAGGCCGGTG--ACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTGCAGAAGCA
                *  ** **** ***   ** ***** *  *   *** ***    * * ** * ** *  *

LYC.ES_E        CGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGTT-CTAGTTAAACTACCA
TRY.BR_B        CACCGAGGAGCATCTCAGGAC---TTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT----
                *     ** ** *  ** *     **   ***  * * *  **  * **      *    

LYC.ES_E        CATTTT
TRY.BR_B        ------
                      

[Download ClustalW]

#621

Mean pairwise ID: 45.75%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TET.THE.        -------GCCAGGGTAGCAATACCTGTGTCTATATGTGG--CATAAACAA-TGTAGGTTG
                       * *  **  *       ** ***    * * *    ** * ** *** * * *

CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTC-TACGTCGACCGAGCGTCCGTGCCAAG
TET.THE.        TGATAGAT-AGGATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAA
                 *  ***  ****     * ** **  *      *  *   *  * * * ***  **** 

CAE.EL_D        CGCTACGTCACCAGGG-GATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTC
TET.THE.        CAATGAGTTGCTATGGTGGTAACC-TAGTAATAGGACTCCACCAGGGCAT-TAAAGAGCT
                *  *  **  * * ** * ****  * * **   *  *   ** ***    *** ***  

CAE.EL_D        GTGGA--TGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCCG
TET.THE.        AAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAG
                  ***   *  *****   * **   * ***  ****    **** ** **  ****  *

CAE.EL_D        GAC--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCACTTA
TET.THE.        GATAACATACTCATTAACTGTCAAAC-TAATCGGTTCTACTATCAAAGCCAGAC-ATT--
                **   *   **  * *  ** ** ** **  * *   *      *    ***** * *  

CAE.EL_D        TCATTT
TET.THE.        ------
                      

[Download ClustalW]

#622

Mean pairwise ID: 45.75%


HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
TRY.BR_B        -------------------AGCCGGAGCGC--ATTGCTCTGTAACCTTCGGGGGCTGATC
                                     * * **  *    * *** * *  **  ** **  *   

HOM.SA_B        CGCTTGAGCCCAGGAGTTCTGG----GCTGTAGTGC-GCTATGCCGATGGGGTGTCCGCA
TRY.BR_B        CCGCTTAGCGGGGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTC-TG
                *   * ***   *  **  ***    ** *  ** * * *  *  **   ***** *   

HOM.SA_B        CTAAGTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAG
TRY.BR_B        CTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAA
                **  ***  *  **  * * * *  * ** * * ** * **      *  *  *  *** 

HOM.SA_B        GAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
TRY.BR_B        GTGGGGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTT
                * **** **** **  **** ***  *********  **   **  **  *    * ** 

HOM.SA_B        GTGGGATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGAGCAACATAGCGAGACCCC
TRY.BR_B        GCAGAAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGT
                *  * * * * **   **  * * **   *  * *  **  **   * * ***** *   

HOM.SA_B        GTCTCT
TRY.BR_B        TT----
                 *    

[Download ClustalW]

#623

Mean pairwise ID: 45.78%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATGTTG
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
                **** **  ***  **** ** ***** **   *    * *    ** * **     * *

LYC.ES_F        GGTCCATCTTGATGGATGGGCTTGAA--GGGCTAATGTTCTGGCCTGCCCTGTCCAAGCA
XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
                  *   **  *  *    **  ** *  * ****      * *  ** **   * ***  

LYC.ES_F        CAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAGCCACTTGGC--CTTTAGAGTGGGAT
XEN.LAE.        CGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGGT
                * *  *             **    **   *     ***  **   ** **  * *** *

LYC.ES_F        GGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAAGG
XEN.LAE.        GAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGG
                * ** *    ***  **    ** *****      *  *****  * *  **** *  **

LYC.ES_F        ATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCA
XEN.LAE.        ATCGCG--CCTGTGAATAGCCGGTGC--AGAACAGCCTGA---ACAACACAGCGAGAC--
                *** **  *  ***        ** *  * ** * *****       *  *   * **  

LYC.ES_F        TCACTTTT
XEN.LAE.        ACAGTTCT
                 ** ** *

[Download ClustalW]

#624

Mean pairwise ID: 45.79%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGAATGC
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     ***** *** 

ZEA.MA_A        TTTGCGATGGCTTTCTGGGCCCTGGGC---TCGTTGT-GACACTGGCCGGCTTGCCCATC
CAE.EL_B        AGTGAGAGGAG-----GAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGC-GTCCGTG
                  ** ** *       * * **** *    *******  **   * ***    * ** * 

ZEA.MA_A        CCAAGT-TGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGG
CAE.EL_B        CCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGG
                *****    *      * ** *  * ** * *  * *   *  *  *   *   *   **

ZEA.MA_A        AGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACG
CAE.EL_B        AGTGGTGG--ATGGTTCAGGACCGA------AAGGTAGCAGACAAAAGCCACCGC--GCG
                ** **  *  ****   * * * *       *  * ***   **    * **  *   **

ZEA.MA_A        GTGGGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAG
CAE.EL_B        GTGCAGTGGC--CGGA----CTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAAT
                ***    *    ** *    **** ***      * ** *     ** * ***    ** 

ZEA.MA_A        -----CAAACCACCATCTTT-
CAE.EL_B        ACCTTCAGACCACTTGTTTTT
                     ** *****    *** 

[Download ClustalW]

#625

Mean pairwise ID: 45.80%


TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
LEI.MAJ.        GCCGGAGCTCTGCT--CTGTAACCTTCGGGGGC-TAACCAGGCTTAGCGGGGAGGACGTG
                *** * *      *  ****  *  *  * *** *** **   *  *  * **      *

TET.THE.        GATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGAGTTGC
LEI.MAJ.        GACCAGCGAG---GGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGCTGTGTGTCGG
                **   * ***   * ***     *  * * *    **** *   *    *  ** ** * 

TET.THE.        TATGG-TGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGA-GCTAAGGAAACGCC
LEI.MAJ.        TGTGGCTTGCCCCCCTGCAG-AGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGGAACCGGG
                * *** * *   **  * *  ***    * *  *  *      ** ** * **** **  

TET.THE.        TCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGATAACATACT
LEI.MAJ.        TCAGGCCGGAAACGGAGCAGCCCACCCCACGCACGT-CCGCCGTTGCAGAATCACACCGC
                ****** ** *** ** ***   *  *    * * *   *  ** * ** ** ***    

TET.THE.        CATTAACTGTCAAACTAATCGGTTCTAC-TATCAAAGCCAGACATT
LEI.MAJ.        GGAGCATGTCCGCACT--TGAGCCCCACGCTTCGTCGCGAAGCCTT
                     *    *  ***  *  *  * **   **   ** *  * **

[Download ClustalW]

#626

Mean pairwise ID: 45.81%


ZEA.MA_A        -NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGC
TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
                  * * *        *  * *  * **    *           ** * **   *  **  

ZEA.MA_A        TTTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCCAA
TET.THE.        GATATGAGAGTTTGATGAGAC---AGTTTGCTAAGAGTGTGCCCGCTCCAAACAAT--GA
                  *  **  * **  ** * *    * * * *  **   ** ***       **     *

ZEA.MA_A        GTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCGG
TET.THE.        GTTGCTA-----TGGTGGTAAC-CTAGTAATAGGACTCCACCAGGGCAT-TAAAGAGCTA
                **** **     ******   * ****  * **   *    *   ***      ****  

ZEA.MA_A        CAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGGTGGG
TET.THE.        -AGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGA
                 *****  ** * ********   ***** *** **  ***  *  **      ***** 

ZEA.MA_A        AGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGCAAAC
TET.THE.        AGGATAACATACTCATTA-ACTGTCAAACTAATC--GGTTCTA---CTATCAAAGCCAGA
                ********  *  *  *  *** * *  ****    ** **     **  * **** *  

ZEA.MA_A        CACCATCTTT
TET.THE.        CATT------
                **        

[Download ClustalW]

#627

Mean pairwise ID: 45.81%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGA--CAATAAGGGGATGGGACGT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                        * * * *   *   *** * *   * **     **  *   * *  **  * 

ARA.TH_C        TGGGTCGATCTCATTGGGCCGGGTTCGG-GTTGG-GCTATATTCTGGCCCGCCCATTCCA
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGC----TGTG
                **  * ** *    * **  *  * *** ****  *   *  ****    **    *   

ARA.TH_C        AGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGG
LEP.COL.        TGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCC--TCCGTTAAAGTAG
                 ** **  *     *  **  *       *****  ** * * *   **   ** *** *

ARA.TH_C        GGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTC-TTGACGGTGG
LEP.COL.        AGGA-ACTGGGTCAGGCCGGC--AACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTG
                 *** ** * ** **** **    ** *******  ******* *** * *   * ** *

ARA.TH_C        AAGGATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGA
LEP.COL.        CAGAACCACACCGCGGAGCCTGTC--ATCACCTGCGCCCCA----GGCGATCCTGTGAAG
                 ** *  **    *   ****  *    *  **  * ****    * ** ***  *    

ARA.TH_C        CCATCACTTT
LEP.COL.        CTTT------
                *  *      

[Download ClustalW]

#628

Mean pairwise ID: 45.82%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTG-ACGGTAGACAAGTGTGGATG
                 *** *    ** *** * ****** *  **       * **   **     ** *****

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
CAE.BRI.        G--AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCG--GCAACGGCGACCGAGCGTCCGTGC
                    ***  *       ***** *     *** *  * **    *   *   * **** *

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
CAE.BRI.        CAAG---CGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGC---GGTCCCGGGCGCA
                ****   **  * *   *   *** **  **         * **   * * *   *  * 

ORY.SA_A        TAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCA
CAE.BRI.        TAAGGAGTGGTGCACGGCTCAGGGCCGA------AAGGCAGCAGGCAAAAGCCACCGC--
                *** * *    **** **    *** *       *  *****   **    ** *  *  

ORY.SA_A        TCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCTA
CAE.BRI.        ---GCGGTGCAGTGGCCGGATA--GCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTG
                   * **     *  * ** *   ** * *  *    *   ** ***** ** * **** 

ORY.SA_A        CAAC----AGACCACC-ATCTTT
CAE.BRI.        ATACCTTCAGACCACTTGTCATT
                  **    *******   ** **

[Download ClustalW]

#629

Mean pairwise ID: 45.83%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGT-GGTGTGGATGC
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                    ***      **       *******   * ***   **   * *  * * *** * 

ZEA.MA_C        TTGGTACCGTGTCTTTGCCTGGGTTC-ATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAG
TRY.BR_B        CTTGGACAA-------GCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTG------G
                 * * **         **  ******  * * **    *** **  ****  *      *

ZEA.MA_C        TTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACC--TATAGTG
TRY.BR_B        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAG---AGGCGTTCTCGCGCCGTTAAAGTG
                ***   ** *  ****    *      ****      *** * ** *  **  ** ****

ZEA.MA_C        GCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGG
TRY.BR_B        GGGGGAACGG-GTCAGGCCG--GTGACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTG
                *  ******* ** **** *   * ** *******   ***     **   *  * ** *

ZEA.MA_C        AAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAG
TRY.BR_B        CAGAAGCACACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCGAGGCGG
                 ** *  ***       *** *   **     **  * ** *    ** *    * ** *

ZEA.MA_C        ACCACCATTTTT
TRY.BR_B        TTT---------
                            

[Download ClustalW]

#630

Mean pairwise ID: 45.83%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG----TGGGGACAATAAGGTGGTGGAAC
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAG--GAGG
                * ** **   **  ** * ** ***   ** **    * ****   * ***  *  **  

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGC-TGACATATATCTGAGCTGCCCAGTCCA
CAN.SPE.        ATCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                *  * ** *   *    * ** *  ***  *   *  **     *  * ** **   * *

ARA.TH_D        AGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-CTAAAGTCG
CAN.SPE.        AGTTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
                ** *  *  * *  * **  *  *   **   **  *   *   * * ** *  ***  *

ARA.TH_D        GAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGG
CAN.SPE.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
                * * * *  *    ***  **    ** ******     *  ****      * **** *

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCC-GCTGGTTCGATCTCTCCTG
CAN.SPE.        TGGGATCGCGCCTGTGAAT-------AGCCACTGCACTCCAGCCTGTGCAA-CATAGCGA
                  *****     *   * *       * *****     ** **  ** * * *    *  

ARA.TH_D        GACCACCACTTT
CAN.SPE.        GACCCCGTCTCT
                **** *  ** *

[Download ClustalW]

#631

Mean pairwise ID: 45.83%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGCGCGGATGC
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     * * ***** 

ZEA.MA_B        TTTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCT---TGCCCATCCCA
CAE.EL_D        AGTGAGAGGAGG---AGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCA
                  ** ** *       * **** *   ** **       * ** *     * ** * ***

ZEA.MA_B        AGTTGGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGG
CAE.EL_D        AGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGT
                **      **  *    **    **  ** ***          * *    * **  * * 

ZEA.MA_B        CAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGTGG
CAE.EL_D        CGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAA-AAGCGACCGCGTGGTGCAGTGG
                *  * ****   * * * *     *   *****  *  *  ** ** * *    * ****

ZEA.MA_B        GAGGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAAAC
CAE.EL_D        CCGGACC----GCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTT-CAGAC
                  ***      **   ** *  ****  *  * *** * **   **    * *  ** **

ZEA.MA_B        CACC-ATCTTT-
CAE.EL_D        CACTTATCATTT
                ***  *** ** 

[Download ClustalW]

#632

Mean pairwise ID: 45.83%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCG----GGGGCATTAAGGTGGCGCGGA
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                 *** ** * ** ***   ** ****  ** ***     ***    * **   **  *  

ZEA.MA_B        TGCTTTG--CGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCC
GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATG--CCGAGCGGGCGTCCGCG-CT
                 ****    * * *  ********    *  ** * **   * *** *** * * *  * 

ZEA.MA_B        CAAGTTGGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGC
GAL.GAL.        AAGGCCGGCATCAATATGGTGAGCCCCGG-GGAGCCGAGGCACACCAGGTTGCCTAAGGA
                 * *  ** *          * ** *  * * *  *   *     * *    ****  * 

ZEA.MA_B        GGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGT
GAL.GAL.        GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAG-GTCAAAACTCCCGTGCCGGTCAGT
                **   ***  *    ***  **    ** ****** *   *  * ***    *   * **

ZEA.MA_B        GGGAGGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAA
GAL.GAL.        AACGGGATCGC--GCCTGTGAATAGCCACTGCAGCGTAGCCTGGG----CAACATAGCGA
                    ****  *  ***  ** *     *   ** *  ** *   *       * **** *

ZEA.MA_B        ACCACCATCTTT
GAL.GAL.        GACCCTGTCTCC
                  * *  ***  

[Download ClustalW]

#633

Mean pairwise ID: 45.83%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT-G
                  ***** * **   * * ****** *  **  *     * * *  ** *   * *** *

LYC.ES_B        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_A        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *    * ***   * * ** *   ***  **

LYC.ES_B        TTAGAGTTGGATCAT-GTGGCCCAATTGAAGAAATG-GACTACTT---GATTCGTAAAGT
CAE.EL_A        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                  ** * *   ***    **   ** **  * ** * *  ** *    * * * *** * 

LYC.ES_B        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTG
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                *  * ***  *     * * *     *   ****   * ***   ****     ** ***

LYC.ES_B        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAA
CAE.EL_A        GCCGGACCGCGCTTGTGAGTTGACACACATACGCA--GCCTTCTCGATACCTTCAGACCA
                *  ***   **  *  * ***  *  *     * *  ****  * *    **  *    *

LYC.ES_B        ACCACCACTTTT
CAE.EL_A        CTTATCATTT--
                   * ** **  

[Download ClustalW]

#634

Mean pairwise ID: 45.83%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCT-----TCTTGACGGTAGATAAGTGTG
                   **** * **  ** * ****** *  **  *     * ** * *      **   **

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_A        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *    * ***   * * ** *   ***  **

LYC.ES_N        TTAGAGTTGGATCAT-GTGGCCCAATTGAAGAAATG-GACTACTT---GATTCGTAAAGT
CAE.EL_A        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                  ** * *   ***    **   ** **  * ** * *  ** *    * * * *** * 

LYC.ES_N        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGTG
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                *  * ***  *     * * *     *   ****   * ***    ***     ** ***

LYC.ES_N        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAA
CAE.EL_A        GCCGGACCGCGCTTGTGAGTTGACACACATACGCA--GCCTTCTCGATACCTTCAGACCA
                *  ***   **  *  * ***  *  *     * *  ****  * * *  ** **    *

LYC.ES_N        ACCACCATTTTT
CAE.EL_A        CTTATCATTT--
                   * *****  

[Download ClustalW]

#635

Mean pairwise ID: 45.83%


LYC.ES_E        GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGT----GGGGATGTTAAGGTG---GTGG
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                  ** *  * **  ** * ** *** *  **  *    *  * *    * ***    ***

LYC.ES_E        AATATTGGGCTGTCCCAGATGGCTGGGCTTGGTGGGCTAATTTCTGGCCTGCCCTATCCA
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAA--CGGCGACCGAGC-GTCCGTGCCA
                * *   ***  *   *   *** **   * **           * *  * * **   ***

LYC.ES_E        AGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGG-GCTACTAGATTCCTAAAGTG
CAE.BRI.        AGCGCTGCGTCGCCAGGGGTC-TCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAG
                **  * * ** *      **  ***  * * ***  *** * * *  *   * *** * *

LYC.ES_E        GGGTGGACCCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGA
CAE.BRI.        TGGTGCACGGCTCAGG--GCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGGC
                 **** **   * ***  *     *   ****   **** *  ****   ********* 

LYC.ES_E        AGGATAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGTTCTAGTTAAA
CAE.BRI.        CGGATAGCGCTTGTGAGTTGTC---GCTCGCCCACAGCCTCTCTGATACCTTCAGACCAC
                 ***** **     * *   **   * **    *  ****    *     *  **   * 

LYC.ES_E        CTACCACATTTT
CAE.BRI.        TTGTCATT----
                 *  **      

[Download ClustalW]

#636

Mean pairwise ID: 45.83%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT-G
                 ****** * **   * * ****** *  **  *     * * *  ** *   * *** *

LYC.ES_I        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_D        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *      ***   * * ** *   ***  **

LYC.ES_I        TTAGAGTTGGATCAT-GTGGCCCAATTGAAGAAATG-GACTACTT---GATTCGTAAAGT
CAE.EL_D        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                  ** * *   ***    **   ** **  * ** * *  ** *    * * * *** * 

LYC.ES_I        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGTG
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                *  * ***  *     * * *     *   ****   * ***    ***     ** ***

LYC.ES_I        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAA
CAE.EL_D        GCCGGAC--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCGATACCTTCAGACCA
                *  ***   ** *   **    *   *  *    *  ****  * * *  ** **    *

LYC.ES_I        ACCACCATTTTT
CAE.EL_D        CTTATCATTT--
                   * *****  

[Download ClustalW]

#637

Mean pairwise ID: 45.86%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGT----GGGGACAATAAGGTGGTGGAAC
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  ** * ********  *   *    *  *  *   * ***  *    

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAA
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGT-CGACCGAGC-GTCCGTGCCAA
                ****     *    **  **       * **   ** *    * **** * **   ****

ARA.TH_D        GCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGA
CAE.EL_A        GCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAG-----
                **  *  ** * * * *     * * ** * *   *       *** * *  ***     

ARA.TH_D        GGGTAATGCGTGAGGCTGGTTTCACAG--AGCAGCGACTACTTCCCTCTTACAGCAGTGG
CAE.EL_A        GAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGG
                * **  **  **   * **    * **  *****  *  *    ** * *   *******

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGG
CAE.EL_A        CCGGACCGCGCTTGTGAGTT-----GACACAC-ATACGCAGCCTTCTCGATACCTTC-AG
                  *** *    **   ***      **  *** **   * **    *****  ** *  *

ARA.TH_D        ACCACCACTTT---
CAE.EL_A        ACCACTTATCATTT
                *****   *     

[Download ClustalW]

#638

Mean pairwise ID: 45.86%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGT----GGGGACAATAAGGTGGTGGAAC
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  ** * ********  *   *    *  *  *   * ***  *    

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAA
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGT-CGACCGAGC-GTCCGTGCCAA
                ****     *    **  **       *  *   ** *    * **** * **   ****

ARA.TH_D        GCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGA
CAE.EL_D        GCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAG-----
                **  *  ** * * * *     * * ** * *   *       *** * *  ***     

ARA.TH_D        GGGTAATGCGTGAGGCTGGTTTCACAG--AGCAGCGACTACTTCCCTCTTACAGCAGTGG
CAE.EL_D        GAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGG
                * **  **  **   * **    * **  *****  *  *    ** * *   *******

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGG
CAE.EL_D        CCGGACCGCGCTTGTAAGTT-----GACACAC-ATACACAGCCTTCTCGATACCTTC-AG
                  *** *    **  ****      **  *** **   * **    *****  ** *  *

ARA.TH_D        ACCACCACTTT---
CAE.EL_D        ACCACTTATCATTT
                *****   *     

[Download ClustalW]

#639

Mean pairwise ID: 45.86%


CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGT-----GAGTCAGCTTCTTGACGGTAGATAAGTGTG
TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
                 ******   ** *** * ******     ****  *    ** * *  *  * *  *  

CAE.EL_D        GATGGAGTGA-GAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTG
TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTG-CTGGCCCGCCCG---TTCCAAG
                * ** ** *  * **    *  *** ** **     * **    ** ***    ***  *

CAE.EL_D        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGG
TRI.AE_A        TTGCGTAGTGGACCGCCTGGGGCTTATG--CGAAAGCTGGGT--CTCACGGTCCATAATG
                    *   *    * ** **** * *    ** ***  ** *    *  *** ***** *

CAE.EL_D        AGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
TRI.AE_A        TGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGT
                 * *  * *  *     * * *     *   *****  * **  * **** *    * **

CAE.EL_D        GGCCGGAC--CGCGCTTGTAAGTTGACACACATACACAGCCTTCTCG---ATACCTTCAG
TRI.AE_A        GGAAGGATAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCAG
                **  ***    * **   *    *   *  *  *    ****    *   *  **  ***

CAE.EL_D        ACCACTTATCATTT
TRI.AE_A        ACCACC--------
                *****         

[Download ClustalW]

#640

Mean pairwise ID: 45.87%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTT-AG
                             **  * **   * *  *      **  ** ******  * *    * 

HOM.SA_A        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCACTAA
TRY.BR_B        CGGGGACGTCTTGGA----CAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTC-TGCTTG
                **     ***  ***       ** *  ** * * *  *  **   ***** *   **  

HOM.SA_A        GTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGG
                ***  *  **  * * * *  * ** * * ** * **      *  *  *  *** * **

HOM.SA_A        GGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
TRY.BR_B        GGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTGCAG
                ** **** **  **** ***  *********  **   **  **  *    * ** *  *

HOM.SA_A        GATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGTGCAACATAGCGAGACCCCGTCT
TRY.BR_B        AAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT--
                 * * * **   **  * * **   *  * *  **   *   * * ***** *    *  

HOM.SA_A        CTT
TRY.BR_B        ---
                   

[Download ClustalW]

#641

Mean pairwise ID: 45.90%


HUM.JA_B        GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGA-AATGGGACTTTAGTT
TRY.BR_B        AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT--CT
                 ***      * * *  ********   * ***   **   *   *  ***    *   *

HUM.JA_B        CGGCCCATTGGATCGGATCCAGTGTTAGCTGCTTGCTGGGCTGCCCA-TTCCAAGCCGAG
TRY.BR_B        TGGACAAGCGG---GGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGT
                 ** * *  **   ** * * **        **** **  ****    ** *  * **  

HUM.JA_B        AGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCTAAAGCGGAGGGCAA
TRY.BR_B        GTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGC-------GCCGTTAAAGTGGGGGG-AA
                  *   *  *     *  *   *  * *** **       **   ***** ** *** **

HUM.JA_B        TGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGAAGGATAA
TRY.BR_B        CGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGAAGCA
                 * ** **** ***   ** *******  * ****  *** *    * ** * ** *  *

HUM.JA_B        CGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGGACCATTT
TRY.BR_B        CACCGAGGAGCATCTCAGGACT----TTGCGCCCCAAGTG---TCGTCGCGAGGCGGTTT
                *     ** **  **  *  *     * *  * *  **     ** *     * *  ***

HUM.JA_B        CTTTT
TRY.BR_B        -----
                     

[Download ClustalW]

#642

Mean pairwise ID: 45.90%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
TET.THE.        -GCCAGGGTAGCA-ATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGAT
                 ***   * * *     *****  *   *   **   *        * *      * * *

HUM.LU_B        CAGCCCAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCGGGA
TET.THE.        AGGATATGAGAGTTTGAT---GAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGA
                  *    * *  *  * *   * *  ** *   **   ** *****  ***** *   **

HUM.LU_B        GTTGGGCTGA--GTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGGGCA
TET.THE.        GTTGCTATGGTGGTAACCTAGTAATAGGACTCCAC--CAGGGCATTAAAGAGCTAAGGAA
                ****   **   ** **** *    *** **      *   **    *      * ** *

HUM.LU_B        ATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAGGATA
TET.THE.        ACGCCTCAGGCTGGC--AACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGATA
                * ** * *******    ***** *** **  ** * *****    *  ***********

HUM.LU_B        ACGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACCATTT
TET.THE.        AC------ATACTCATTAA-CTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT-
                **       * **  **   *   **   * *  *** **       ** *    **** 

HUM.LU_B        CCTTT
TET.THE.        -----
                     

[Download ClustalW]

#643

Mean pairwise ID: 45.91%


ZEA.MA_G        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                 *** *    ** *** * ** *** *  *        * *  **     *** ****  

ZEA.MA_G        TTTGC--GATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGC----GACCGAGC-GTCCGTGC
                  **   *  **  * *** *   *   ***  *   **    * ***  * * **** *

ZEA.MA_G        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.BRI.        CAAGCGCTGCGTCGCCA--GGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATA--
                ****      ** **    ** * **   *  * *    ***     ** * *    *  

ZEA.MA_G        GGCAGGAATGGCGTGAGGCT-GGCTTCACAGAGCAGCGATCACTGCCCGCTTCCAACGGT
CAE.BRI.        ---AGGAGTGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGC-----GC
                   **** *** *   ****  *   *  *  *****   **    ** *  *     * 

ZEA.MA_G        GGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAG---
CAE.BRI.        GGTGCAGTGGCCGGATA--GCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACC
                **     *  * **     ** ***         * *  ***** ****** ** *    

ZEA.MA_G        --CAGACCACC-ATCTTT
CAE.BRI.        TTCAGACCACTTGTCATT
                  ********   ** **

[Download ClustalW]

#644

Mean pairwise ID: 45.93%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-G
                    ***       ***     *******   * ***   **   * *    *   ** *

ARA.TH_E        GTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGT--CCAAGC
TRY.BR_B        TCTTGGACAAGCGGG--GGTTCTGTTGC-GTTGACTTGGTGTTCTGCTTGGTTGCGTGTC
                  * **     ****  **********  *     **  **  ****   **  *    *

ARA.TH_E        TGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAGG
TRY.BR_B        GGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGC-------GCCGTTAAAGT--GGGG
                 ***   * * **    ***  ** *  *   * **       **   ******  * **

ARA.TH_E        GTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGACGG
TRY.BR_B        GGAACGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGA
                * ** * ** **** ***   ** *******  * ** *  ***      * ** *  * 

ARA.TH_E        ATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAACCA
TRY.BR_B        AGCACACCGAGGAGCATCTCAGGACT-TTGCGCCCCAAGTGTC-GTCGCGAGGCGGTTT-
                * ****     * *   ***** **   *  * **     *** *     *   *     

ARA.TH_E        CCATTTT
TRY.BR_B        -------
                       

[Download ClustalW]

#645

Mean pairwise ID: 45.93%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACGTTG
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
                * **    * **  **** ** *** *******        *    * *   **  * * 

ARA.TH_C        GGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTC-TGGCCCGCCCATTCCAAGT
FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
                * * ** ****   *  * **        ** **** *   * *   * ** * * ****

ARA.TH_C        TGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTC-TCATGTCTTCTAGAGTGGGG
FUG.RUB.        TCGGTATCGATATG-GTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGG
                * **  * **     * *** *  * * ** *  ** **  ** ***  ***  * ****

ARA.TH_C        GAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAAG
FUG.RUB.        TGCCCCGGCCCAGGTCGGA--AACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGG
                    ***    ***  **    **  *****     * * ****  *    * ** *  *

ARA.TH_C        GATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACCA
FUG.RUB.        GATCGCGC-CCGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAGTCT
                ***  **  ** *       **       *    *  * ***  *     ** *    * 

ARA.TH_C        TCACTTT
FUG.RUB.        TT-----
                *      

[Download ClustalW]

#646

Mean pairwise ID: 45.95%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGA-ACACT
TET.THE.        -----GCCAGGGTAGCAATACCTGTG-TCTATATGTGGCATAAACAATGTAGGTTGTGAT
                     ** * *  *  *   * ***   * *  ** **  ** *  ***  **      *

ARA.TH_G        GGATCGGCC-CACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAGCT
TET.THE.        AGATAGGATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTG---TGCCCGCTCCAAACA
                 *** **      * **  ***  *    *    ** *  **   *****  ***** * 

ARA.TH_G        GTGAGTGA--ACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAG
TET.THE.        ATGAGTTGCTATGGTGGTAACCTAGTAATAG--GACTCCACCAGGGCATTAAAGAGCTAA
                 *****    *  **   **** **  *  *     ***    **    *****    * 

ARA.TH_G        GGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACG
TET.THE.        GGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAG
                ** *  ** * ********   ***** *** **  ** * *****    *  ***** *

ARA.TH_G        GACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAAC
TET.THE.        GATAACATACTCATTAACTGTCAAACTAATCGGTTCTACTA--TCAAAGCCAGACATT--
                ** ***      *         ** * * *  * **  **   **  * ** *       

ARA.TH_G        CACCATTTT
TET.THE.        ---------
                         

[Download ClustalW]

#647

Mean pairwise ID: 45.95%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA----TGGGGGCATTAATGTGGTGGAAT
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
                **** *    **   * * ** ***** ****     **** *  * *   *** ***  

LYC.ES_I        GTTGGGCTGTACCAGATGGTTGGGCTT-GGTGGGCTA-ATTTCTGACTTGCCCTATCCAA
FUG.RUB.        GCTTGA--GCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAA
                * * *   *  *  **    *******  * ** ***  *   *    ** **   * **

LYC.ES_I        GCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATT-CGTAAAGTGG
FUG.RUB.        GTTCGGTATCG-ATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGG
                * *  *  * * **   ***  **    * **    ***  **  * *  * *** * **

LYC.ES_I        GGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAA
FUG.RUB.        GGTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAA-AGCCCCCGTGCCGCTCAGTAGTG
                ** *    *    ***  **   *  **     * * *     **  *    * ** *  

LYC.ES_I        GGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACC
FUG.RUB.        GGAT--CGCGCCCGTGAA---TAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTC
                ****  ** * * ***     *     * ***   *    ** **  * *      *  *

LYC.ES_I        ACCATTTTT
FUG.RUB.        AGTCTTT--
                *   ***  

[Download ClustalW]

#648

Mean pairwise ID: 45.95%


HUM.LU_B        ---GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTG
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
                   ** *   *   **** ******** ***  *    * * *   *   **    ** *

HUM.LU_B        GGTCAGCCCAGTGGATCGGGTCCAGTGTTAGCTGC-TTACTGGTCTGCCCATTCCAAGCC
XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
                  * ** ****  * ** ** *     * ****   *   * *  ** **   * ***  

HUM.LU_B        GGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGGG
XEN.LAE.        CGGTATCAATATG-GTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGG
                 **  *     ** ***  *  ** * ** *  ** *  *   * * **  *  *  ***

HUM.LU_B        CAATGCG--TGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAG
XEN.LAE.        TGAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGG
                  *  **    ***  **    ** ******     * * ****  **   **** *  *

HUM.LU_B        GATAACGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACC
XEN.LAE.        GAT--CGCGCCTGTG------AATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGAC
                ***  ** *** ***        *   *  **   *   * *   **     * **   *

HUM.LU_B        ATTTCCTTT
XEN.LAE.        ACAGTTCT-
                *      * 

[Download ClustalW]

#649

Mean pairwise ID: 45.97%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
TET.THE.        ----GCCAGGGTAGCA-ATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTG-AT
                    * *  *** **  *  *****      *  *       *   **      * * **

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TET.THE.        AGATAGGATATGAGAGTTTGATGAGACAGTTTGCTA-----AGAGTGTGCCCGCTCCAAA
                 *** *  *    *****    *    ***  ****     *  * *** **** * ** 

RAT.NOR.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
TET.THE.        CAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAA
                    *  *   *******    **  * *   **   ********      ***      

RAT.NOR.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA
TET.THE.        GGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 *** ** * ****  ** *** ** ****  ***  * ***         ** *  ***

RAT.NOR.        TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGTCTCT
TET.THE.        TAACATAC-TCATTAACTGTCAAACT--AATCGGTTCTAC-TATCAAAGCCAGACATT
                *  *     * * ** *      ***  *  * *  * ** ** * *  ** * *  *

[Download ClustalW]

#650

Mean pairwise ID: 45.98%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG----TGGGGACTATAAGATGGTGGAAC
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
                * ** *    **  ** * ** ***** *****    ****      * * *** *** *

ARA.TH_G        ACTGGATCGGCCCACGGGTCGGATTTGTTGTTGGCATAGGTC--TGGACTGCCCAATCCA
FUG.RUB.        GCTTGA---GCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTA
                 ** **   ** ** * **        *    **  ** ***  * *  ** **   * *

ARA.TH_G        AGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTG
FUG.RUB.        AGTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGG
                ** *  *  *  *     **  **  * * **    *   *    *** **  ****  *

ARA.TH_G        AGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGA
FUG.RUB.        GGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGT
                 * *    *    ***  **    **  *****     * * ****  *    **** * 

ARA.TH_G        CGGACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGA
FUG.RUB.        GGGA-------TCGCGCCCGTGAATAGACGCTGTAGTTCAACC-TGAGTAACACAGCGGG
                 ***       ***   **    * *  * ** * ** *        ***** *    * 

ARA.TH_G        ACCACCATTTT
FUG.RUB.        ACTCAGTCTTT
                **      ***

[Download ClustalW]

#651

Mean pairwise ID: 45.98%


HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
LYC.ES_M        ---------------------------------CAAGTGGGGATGTTAAGG-TGGTGGAA
                                                 * * * **** * * *** *** *** 

HOM.SA_A        CGCTTGA--GTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
LYC.ES_M        TATTGGGCTGTCCCAGATGGCTGGGCT-TGGTGGGCTA-ATTTCTGGCCTGCCCTGTCCA
                   * *   ****  **   ******* * *** ****      * *  ** **   * *

HOM.SA_A        AGTTCGGCATCA-ATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
LYC.ES_M        AGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT-CCTAAAGTG
                **  * *  *   **   * * **     * *     ** *  *  * ** ***** * *

HOM.SA_A        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
LYC.ES_M        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
                *** * ****    ***  **    ** ******   * * ******  ***  **** *

HOM.SA_A        TGGGAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCTG-TGCAACATAGCGAGACC
LYC.ES_M        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
                  ****   * * * ***  *   **  * ** *   ****  **        * * *  

HOM.SA_A        CCGTCTCTT--
LYC.ES_M        CAACCACCTTT
                *   * * *  

[Download ClustalW]

#652

Mean pairwise ID: 45.98%


RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
LYC.ES_M        ---------------------------------CAAGTGGGGATGTTAAGG-TGGTGGAA
                                                 * * * **** * * ***   * *** 

RAT.RAT.        CGCTTGA--GTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
LYC.ES_M        TATTGGGCTGTCCCAGATGGCTGGGCT-TGGTGGGCTA-ATTTCTGGCCTGCCCTGTCCA
                   * *   ****  **   ******* * *** ****      * *  ** **   * *

RAT.RAT.        AGTTCGGCATCA-ATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
LYC.ES_M        AGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT-CCTAAAGTG
                **  * *  *   **   * * **     * *     ** *  *  * ** ***** * *

RAT.RAT.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
LYC.ES_M        GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGG
                *** * ****    ***  **    ** ******   * * ******  ***  **** *

RAT.RAT.        TGGGAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCT---GGGCAACATAGCGAGA
LYC.ES_M        AAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAA
                  ****   * * * ***  *   **  * ** *   ****   ***   *      * *

RAT.RAT.        CCCCGTCTCTT
LYC.ES_M        CAACCACCTTT
                *  *  *  **

[Download ClustalW]

#653

Mean pairwise ID: 46.00%


TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGA-TGTGAACGC
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                    ***      **       *******   * ***   **     * *  * * *** 

TRI.AE_A        TGTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGTTG
TRY.BR_A        CTTGGACAAGCGGGGGTTCTG--TTGCGTTGACT--TGGTGTTCTGCTTG------GTTG
                  * *    ** * **  ***   ** **   **  ** **  * **  *      ****

TRI.AE_A        CGTAGTGGACCGCCTGGGGCTTATGCGAAAGCTGGGTCTCACGGTCCATAATGTGGCAGG
TRY.BR_A        CGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCG-CCGTTAAAGTGGGGGG
                ***   **       *  **   **   *     * **** **  *  *** ****  **

TRI.AE_A        CACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGC-TTCCAACGGTGGAAGG
TRY.BR_A        AACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCGAGAAGC
                 ** * ** **** **  * ** *******      *** * * ****       **** 

TRI.AE_A        ATAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCAGACCACC
TRY.BR_A        ACACCGAGGAGCA----TCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG-----
                * *  * *  **     **  *** *  *  * **     * *  * * **  *      

[Download ClustalW]

#654

Mean pairwise ID: 46.01%


ORY.SA_B        GCCGAGCCAGG-TAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATG
TET.THE.        -----GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAG-GTTG--TG
                     ****** ****  *  **          * **    ** ** ** * ****  **

ORY.SA_B        CCTGGTCGTTTGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTCC
TET.THE.        ATAGATAGGATATG---AGAGTTTGATGAGACAGTTTGC--TAAG-AGTGTGCCCGCTCC
                   * * *  *  *    * ** **        ******  ** *  *   ***** ***

ORY.SA_B        AAGTTGCGTAGCG-TGTGTGGGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCACCTAGAG
TET.THE.        AAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTC--CACCAGGGCATTAAAGA
                **     *    * * **  **   *** *    ***      *  *   ***   *   

ORY.SA_B        TGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCCAACGGT
TET.THE.        GCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGT
                     ** *  ** * *******    ***** *** **  **   ******     ***

ORY.SA_B        GGAAGGATAACGGGCCGCTGCAGCCCTGGCCCGCTTCCGGCCCAAGTGCCTTCCATGGCA
TET.THE.        GGAAGGATAACATACTCATTAACTGTCAAACTAAT--CGGTTC---TACTATCAAAGCCA
                ***********   *   *  *        *   *  ***  *   * *  ** * * **

ORY.SA_B        GACCACCACCTTT
TET.THE.        GACATT-------
                ***          

[Download ClustalW]

#655

Mean pairwise ID: 46.01%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                   *  * * *   *  *  * *** *  **  *    *   ** *  **  *    * *

HUM.LU_C        GGTCAACCCAGTGGTNCGGGNCCAGT-GCTAGCTGC-TTACCCGGCTGCCCATTCCAAGC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 ** *    **  ** * *     ** * *  ** * *   ***   * ** * ******

HUM.LU_C        CGGGAGGTGGGCTGAGGG-ACCTGGGCGAAGGCTNNNGGNGCGCACTCCTAGACTGGAGG
CAE.EL_A        -GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGT----GCATAAGGA
                 *  * **   * * **  * ***   ******     *  *    *    *  *   * 

HUM.LU_C        GCAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACCTCCCGCTCTCGGCAGTGGAA
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCC
                *   **  **   * **    * **  *****  *  * *  ****     *******  

HUM.LU_C        GGATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGA
CAE.EL_A        GGAC--CGCGCTTGTGAG--TTGACACA-CA-TACGCAGCCTTCTCGATACCT--TCAGA
                ***   ** **  *** *  ****  ** ** *   ** *      **  * *  *  **

HUM.LU_C        CCATTTCTTTT--
CAE.EL_A        CCACTTATCATTT
                *** ** *  *  

[Download ClustalW]

#656

Mean pairwise ID: 46.01%


ZEA.MA_C        -NCCGAGCTCTGTAGCGAGAGCTTGTAACC-CGAGCGGGGGCATTAAGGTGGTGTGGATG
DRO.MEL.        GACTGGAA--GGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGG
                  * *      ** *  **    ***** * **     * *   *  * * *** *   *

ZEA.MA_C        CTTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCC---TGCCCGTTCC
DRO.MEL.        CCTGAGGCTGGGATCTA--CTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCACT
                * **   * * *   *   *** **    *    **   ***** *     * ***  * 

ZEA.MA_C        AAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGT
DRO.MEL.        AAGCTTGCCATCAATAT-GGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGA
                *** * *   *     * **  **   ** * ** ** ***  ***       ***  * 

ZEA.MA_C        GGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTG
DRO.MEL.        GGGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTA
                ** * **** * *  ***  *     *   ****** *  * * ** *   *   * ** 

ZEA.MA_C        GAAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCA
DRO.MEL.        GTGGGATAGCGTACCGGAGTGGACTG---CCGTTATCAGCCCAACCGATATGGT----TG
                *  ***** *   **   *  *  **    ** *    *** *  *   **  *      

ZEA.MA_C        GACCACCATTTTT
DRO.MEL.        GACCACAATCTTT
                ****** ** ***

[Download ClustalW]

#657

Mean pairwise ID: 46.03%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG---ACGGTAGATGAG--TGTG
                 ***  * * *   ** * ** *** *  **  *    *     ** * *** *  * **

HUM.LU_A        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
CAE.EL_C        GATGGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGC--GTCCG
                * *  *   ** ***  * **** ****  *  * *  *      * **   *    ***

HUM.LU_A        GGAGTTGGGCTGAGTGACCTGGGCG-AAGGGCTGGGTTGCGCACGTCCTAGAGTGGA---
CAE.EL_C        TGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAA
                 *    * **** ** *** ***    *  *  **     *  *   *  * *** *   

HUM.LU_A        -GGGCAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACCTCCCGCTCTCGGCAGTG
CAE.EL_C        GGAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
                 * *   **  **   * **    * **  *****  *  * *  **** *   ******

HUM.LU_A        GAAGGATAACGGGCCGGTGCTACCTGGGTCCACCATGCTTCACTAGGCTGACTCTTAATA
CAE.EL_C        GCCGGACAGCGCTTGTGAGTTGAC-ACGTATACACAGCCTTCTCAA---TACCTTCA---
                *  *** * **     * * *  *   **  **   ** *    *     **  * *   

HUM.LU_A        GGACCATTTCTTTT-
CAE.EL_C        -GACCACTTGTCACT
                 ***** ** *    

[Download ClustalW]

#658

Mean pairwise ID: 46.08%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
TET.THE.        GCCAGGGT-AGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATA
                ***  * * ** *      *  * **      **     ** *  **** *     *** 

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
TET.THE.        GGATATG-AGAGTTTGAT-----GAGACAGTTTGCTAAGA--------GTGTGCCCGCTC
                     **  ** * ****     *   **  *** *   *        *  ****** **

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
TET.THE.        CAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACT-------CCACCAGGGCAT
                ***     *   **    ** **     * *  *  *   *       *  *   ***  

ORY.SA_A        TAAAGTGGCAGGCACA-GCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCC
TET.THE.        TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT
                ***** *  * * * * ** * ********   ***** *** **  ***  ******  

ORY.SA_A        ATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCT
TET.THE.        TGTGGTGGAAGGATAACATACTCATTAACTGTCAAACTAATC---------GGTTCTACT
                   ***************  **  *  **  *    *   *           ** *  **

ORY.SA_A        ACAACAGACCACCATCTTT
TET.THE.        ATCAAAGCCAGACATT---
                *  * ** *   ***    

[Download ClustalW]

#659

Mean pairwise ID: 46.10%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGA-GTGGGGACAATAAGGTGGTGGAACAGT
TET.THE.        -----GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAG-GTTGTGAT
                     ** * *  *  *   * **** *   * ****    ** ** ** * *      *

ARA.TH_D        GGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAAGCT
TET.THE.        AGATAGGATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTG---TGCCCGCTCCAAACA
                 * *    *    * **  **   **   *    **    **   *****  ***** * 

ARA.TH_D        GTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGC-GGATTCTAAAGTCGGAGG
TET.THE.        ATGAGTTG-CTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAG
                 *****   ** **  *** *           *****   * **    *****    * *

ARA.TH_D        GTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGATGG
TET.THE.        GAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGG
                * ** ** * *******    ***** *** **  **** ** ***   *  ***** **

ARA.TH_D        ATCATA-GTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGACC
TET.THE.        ATAACATACTCATTAACTGTCAAA-CTAATCGGTTCTACTATCAAAGCCAGACATT----
                ** * *   **     ** *** * * * *  *  *  **        *   * *     

ARA.TH_D        ACCACTTT
TET.THE.        --------
                        

[Download ClustalW]

#660

Mean pairwise ID: 46.10%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATGTTG
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
                **** *    **  ** * ** ***** ** **     *  *   ** **  *   * * 

LYC.ES_F        GGTCCATCTTGATGGAT--GGGCTTGAAGGGCTAATGTTC-TGGCCTGCCCTGTCCAAGC
FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
                * *  * **     * *  ****** *  **   ****   * *  ** **   * *** 

LYC.ES_F        ACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAGCCACTTGGCC-TTTAGAGTGGGAT
FUG.RUB.        TCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGGT
                 * *  * *           **    **         ***  ** *   **  * *** *

LYC.ES_F        GGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAAGG
FUG.RUB.        GCCCCGGCCCAGGTCGGA--AACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGG
                *  * *    ***  **    **  ****      ** *****  * *  **** *  **

LYC.ES_F        ATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAACCA
FUG.RUB.        ATCGCG--CCCGTGA--ATAGACGCTGTAGTTCAACCTGA---GTAACACAGCGGGACTC
                *** **  *  ***    * **  *   *    *******   **  *  *     **  

LYC.ES_F        TCACTTTT
FUG.RUB.        AGTCTTT-
                   **** 

[Download ClustalW]

#661

Mean pairwise ID: 46.13%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-TGGGGGCAACAATGTGGTGGAATGTT
RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
                **** **   **  **   ** ****  ** ** *    *  *   ** *   * * * *

LYC.ES_F        GGGTCCATCTTGATGGAT--GGGCT-TGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAG
RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                 * *  *        * *  ***** *   * ****      * *  ** **   * ***

LYC.ES_F        CACAGAGTTGGGTCAAGTGGTCTATACGAAA-GTATAGCCACTTGGCC-TTTAGAGTGGG
RAT.NOR.        TTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
                  * *  *    *   ***  **    * *  *     ****  **     **  * ***

LYC.ES_F        ATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAA
RAT.NOR.        GTGAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTG
                 ** ** *    ***  **    ** *****      *   ****  ***  **** *  

LYC.ES_F        GGATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAAC
RAT.NOR.        GGATCGCG--CCTGTGAATAGCCACTGC--ACTCCAGCCTG---GGCAACATAGCGAGAC
                ***** **  *  ***       * * *  **   * ****   **   * **   * **

LYC.ES_F        CATCACTTTT
RAT.NOR.        C--CGTCTCT
                *  *   * *

[Download ClustalW]

#662

Mean pairwise ID: 46.13%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGG--GGACAATAAGGTGGTGGAACAG
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
                * ** **   **  ** * ** *** * **   *    ***   *  **  ** * *  *

ARA.TH_D        TGGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATC--TGAGCTGCCCAGTCCAA
XEN.LAE.        C--TTGAGTCCAGGAGTTCTGGGCTG-CACTGAGCTATGTCGATCGGGTGTCCGCACTAA
                   ** * * *    * ** *  ***   ****  *** **  *  * ** **   * **

ARA.TH_D        GCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTA-AAGTCGG
XEN.LAE.        GTTCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGG
                * *  *  * *     ***   * ** * ** ** *  ***   ** * **  ***  **

ARA.TH_D        AGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGGA
XEN.LAE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGT
                 * * *  *    ***  **    ** ******     *   ***      * **** * 

ARA.TH_D        TGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGGA
XEN.LAE.        GGGATCGCGCCTGTGAATAGCC--GGTGCAGAACAGCCTGAACAACACAGC------GAG
                 *****     *   * *  *   * * **  *  *** *        * *      *  

ARA.TH_D        CCACCACTTT
XEN.LAE.        ACACAGTTCT
                 ***   * *

[Download ClustalW]

#663

Mean pairwise ID: 46.13%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  ** * ****** *  **  *          ****    *   *  *

ARA.TH_G        GATCGGCCCACGGGTC--GGATTTGTTGTTGGCATAGGTCTG--GACTGCCCAATCCAAG
CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCA-ACGTCGACCGAGCGTCCGTGCCAAG
                  *  *   * * ***  *  * *** **** ** * ***    **  * **   *****

ARA.TH_G        CTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAG
CAE.EL_B        CGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTGG
                *  ** ** * * *       *   ** * * * *       *** ***  ****    *

ARA.TH_G        GGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACG
CAE.EL_B        TGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCCG
                 * ** *     * * *     *   *****  *  * *  **** *   ******* **

ARA.TH_G        GACAACGGTT-CGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGAA
CAE.EL_B        GACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAGACCACTTGTT
                ***  ** **  **    ****  ** ***     **      *    *  ** ****  

ARA.TH_G        CCACCATTTT
CAE.EL_B        TTT-------
                          

[Download ClustalW]

#664

Mean pairwise ID: 46.13%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *  * ****** *  **  *         *****    *   *  *

ARA.TH_E        GTTCGGGTCCACGGGCCGGT-TCTGTTGTTGGCA-TGTTTCTGGGCTGCCCAGTCCAAGC
CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAGC
                  *  *       * ** ** * *** **** **  **     *   * **   ******

ARA.TH_E        TGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTGGAGG
CAE.EL_B        GCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG-----GA
                  ** ** *   * *  ** *   ** * * * * *     *** * *  ***     * 

ARA.TH_E        GTAATGCGTGAGGCTGGTTTCACAG--AGCAGCGACTACTTCCCGCTTACAGCAGTGGAC
CAE.EL_B        GTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGGCC
                **  **  **   * **    * **  *****  *  *    ****     ******* *

ARA.TH_E        GGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAAC
CAE.EL_B        GGACTGCGCTTGTGAGTTG------ACACGTATACACAGCCTTCTCAATACCTTCAGACC
                ***   *  **  * ** *      **   ***   * **     * **  * *  ** *

ARA.TH_E        CACCATTTT-
CAE.EL_B        ACTTGTTTTT
                     **** 

[Download ClustalW]

#665

Mean pairwise ID: 46.13%


TRY.BR_B        ------AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGA
ZEA.MA_H        NCCGAGCTCTGTAGCG-AGTGCT-TGTAACCCGAGCGGGGGCAATAAGG--TAGTGTGGA
                        * * **** * **** *******   * ****   **   *  *** * ***

TRY.BR_B        CGTC-----TTGGACAAGCGGG-GGTTCTGTTGCGTTGACTTGGTGTTC-----TGCTTG
ZEA.MA_H        TGTCAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAA
                 ***     * *  ** * *   ** ***  ***    *  **  *  *     * *   

TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGG
ZEA.MA_H        GTTGCGTAGTGG-GTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACACTAAAGTGGC
                *******   ** ***  **  ***   *   *         ** *  *  ******** 

TRY.BR_B        GGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGA
ZEA.MA_H        GGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC-CACCAGCGGTGGA
                **  *  * ** **** **  * *  *******       ** * *   ** *  *  **

TRY.BR_B        AGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT
ZEA.MA_H        AGGATAATGAG-----TCGCTATGCTATAGGCCCAAT--------------------
                ** * *  ***     ** *    ** *  **** *                     

[Download ClustalW]

#666

Mean pairwise ID: 46.15%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGT----GAGGGTA--TCAAAGTGGTTGA
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                **** ** * **  **   *  * * * ***  *    ** ****  * *  **** ** 

CIN.HYB.        ACTTTGAGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCA
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCG-ACCGAGC--GTCCGTGCCA
                * *  ***   *  *    *   **     **  **  ** ***  **  * **** ***

CIN.HYB.        AGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCG
CAE.EL_D        AGCGCTACGTCACCAGGGGATAACTGTCGGAAGGC--GGTTAGTCCCGGGTGCATAAGGA
                **      **        * *  ***   ******  ** *  *    * *  * **   

CIN.HYB.        GGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGG
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAAAGGTAGCAG-ACAAAAGCGACCGCGTGGTG-CAGTGG
                *  *   ***  * ***   *      **     * *** *  *  * *   * * ****

CIN.HYB.        AAGGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGC-CCAACAGGA
CAE.EL_D        CCGGACCGC--GCTTGTAAGTT---GACACACATACACAGCCTTCTCGATACCTTCAGAC
                  ***   *  **  *   **    * * ** ***  ******        **  ***  

CIN.HYB.        CACCCATTT---
CAE.EL_D        CACTTATCATTT
                ***  **     

[Download ClustalW]

#667

Mean pairwise ID: 46.15%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATG----TGGGGACATTAAGATGGTGGGAC
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGA-
                * ** **   **  *    ** ****  **  *    * ****   * **   *  *** 

ARA.TH_F        ACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCA
GAL.GAL.        -TCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTA
                   * **  *  *    * ** *  ***  *** ** ***       *  * **   * *

ARA.TH_F        AGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGC-AGGTT-CTAGAGTCG
GAL.GAL.        AGGCCGGCATCAATA-TGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAG
                **    *  * * ** ** ****    * * ** *  ***   * ***** *   **  *

ARA.TH_F        GAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGG
GAL.GAL.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAA
                * * * *  *    ***  **    ** ******     *  *****       ****  

ARA.TH_F        ACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCT-GCTGGTCCGATCTCATATG
GAL.GAL.        CGGGATCGCGCCTGTGAAT-------AGCCACTGCAGCGTAGCCTGGGCAACATAGCGAG
                  ***** **  *  *  *       * *****   ** * **  *  * *  *     *

ARA.TH_F        AACCACCATTTT
GAL.GAL.        ACCCTGTCTCC-
                * **    *   

[Download ClustalW]

#668

Mean pairwise ID: 46.15%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGA--GCGGGGGCATTAAGGTGGTGTGGATG
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
                 *** ** **** *** * ** ***** **     *  **    *  **  **  *   *

ZEA.MA_C        CTTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAAG
XEN.LAE.        CTTGAGTCCAGGAGTT--CTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAG
                ****   **  *  **  *  ** * **  * *     * * * *  ** ***  * ***

ZEA.MA_C        TTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTG--GACCTATAGTG
XEN.LAE.        TTCG--GTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAG
                ** *  **  *  *  *  * *   * *   ***  **    **  *  *  ***  * *

ZEA.MA_C        GCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGG
XEN.LAE.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAG
                *   **** *    ***  *     ** ******     *   ** *     * * ** *

ZEA.MA_C        AAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAG
XEN.LAE.        TGGGATCGC--GCCTGTGAATAGCCGGTGCAGA-ACAGCCTGAACAACACAGCGAGACAC
                  ****  *  ***  ** *     **  *    *  ****  **  ** *   *  ** 

ZEA.MA_C        ACCACCATTTTT
XEN.LAE.        AGTTCT------
                *   *       

[Download ClustalW]

#669

Mean pairwise ID: 46.15%


XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
TRY.BR_B        ------AGCCGGAGCGCAT---TGCTCTGTAAC--CTTCGGGGGCTGATCCCGCTTAGCG
                       ** *  ***  *   **   *  * *  *** * **  **  *   *  * **

XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
TRY.BR_B        GGGACGTCTTGGACAAGCGG---GGGTTCTGTTGCGTTGACTTGGTGTTC-TGCTTGGTT
                     ***  ***     **   *   *  * *  ** **   ***** *   **  ***

XEN.LAE.        CGGTATCAATATGGTGTTC-CTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGG
TRY.BR_B        GCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTT--AAAGTGGGG
                  ** **  * * * * ** *    * **    *  *   *  *  * *  ** * ****

XEN.LAE.        TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGGA
TRY.BR_B        GGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTGCAGAA
                 **** **  **** ***  *********  **   *   **  *    * ** *  * *

XEN.LAE.        TCGCGCCTGTGAATAGC-CGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGTTCT
TRY.BR_B        GCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCG--GTTT-
                 * * **   **  * * * *  *    *  **  *    *   ***** *   ***  

[Download ClustalW]

#670

Mean pairwise ID: 46.18%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT--
                   **** * **  ** * ****** *  **  *     * * *  ** * * * * *  

LYC.ES_K        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT--CTGGCCTGCCC---TGTCCAAG
CAE.EL_A        GGATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTG
                ** *  *     ***  * *    ***    * ***  **     * **    ****  *

LYC.ES_K        CACAGAGTAGGATCACGAGGCCCAAAT-----GAAAATATGGGCTTCTTGATTCCTAAAG
CAE.EL_A        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGG
                *  ** *     **** ***    **      ***         * *  * * * *** *

LYC.ES_K        CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT
CAE.EL_A        AGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
                 *  * ***  *     * * *     *   *****  ** ***  ****   *******

LYC.ES_K        GGAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATA
CAE.EL_A        GGCCGGAC--CGCGCTTGTGAGTTGACACACATA-CGCAGCCTTCTCGATACCTTCAG--
                **  ***    * *   ***  **  **     *     ****  * * *  ** **   

LYC.ES_K        AACAACCACCTTT-
CAE.EL_A        ACCACTTATCATTT
                * **   * * ** 

[Download ClustalW]

#671

Mean pairwise ID: 46.18%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAG-
                             **    **   * *  *      **  ** ******  * *      

RAT.NOR.        CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGC-GCTATGCCGATCGGGTGTCCGCACTAA
TRY.BR_B        CGGGGACGTCTTGGA----CAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTC-TGCTTG
                **     ***  ***       ** *  ** * * *  *  **   ***** *   **  

RAT.NOR.        GTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
TRY.BR_B        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGG
                ***  *  **  * * * *  * ** * * ** * **      *  *  *  *** * **

RAT.NOR.        GGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
TRY.BR_B        GGGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCA--CCTTGCGCACGTTCCCGTTGCAG
                ** **** **  **** ***  *********  **   **  **  *    * ** *  *

RAT.NOR.        GATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGGGCAACATAGCGAGACCCGTCTC
TRY.BR_B        AAGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCG-GTTT-
                 * * * **   **  * * **   *  * *  **   *   * * ***** *  ** * 

RAT.NOR.        T
TRY.BR_B        -
                 

[Download ClustalW]

#672

Mean pairwise ID: 46.18%


ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
TRY.BR_B        ------------AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAG-
                             **  * **   * *  *      **  ** ******  ***      

ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
TRY.BR_B        CGGGGACGTCTTGGACAAGCGGGGGTTC---TGTTGCGTTGACTTGGTGTTC-TGCTTGG
                **     ***  ***     ***   **    * *  *  **   ***** *   **  *

ORI.CUN.        TTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
TRY.BR_B        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAAAGTGGG
                **  *  **  * * * *  * ** * * ** * **      *  *  *  *** * ***

ORI.CUN.        GTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGG
TRY.BR_B        GGGAAC-GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGA
                * **** **  **** ***  *********  **   **  **  *    * ** *  * 

ORI.CUN.        ATCGCGCCTGTGAATAGC-CACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGTCTC
TRY.BR_B        AGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT---
                * * * **   **  * * **   *  * *  **   *   * * ***** *  * *   

ORI.CUN.        C
TRY.BR_B        -
                 

[Download ClustalW]

#673

Mean pairwise ID: 46.18%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCA------TGTGGGGACATTAAGATGGTGGG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *    ****** *  **      **  ** * ** *   ***  **

ARA.TH_F        ACACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCC
CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGT--CGTTGTCAACGT-CGACCGAGC-GTCCGTGCC
                *    *    **   *  *  *  **   * ***   * *    * **** * **   **

ARA.TH_F        AAGCTGTGAGTAATTAGTGT-TGA--GTTGAGCGAAGGCTTGGCTTGCAGGTTCTAGAGT
CAE.EL_B        AAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAG
                ****  ** ** *  ** *  ***  ** *   ** **   * *  *   *    **   

ARA.TH_F        CGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGT
CAE.EL_B        TGGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCACCGCGCGGT----GCAGT
                 ** ** *  * *  **        *  **** **    * **  * ** *    *****

ARA.TH_F        GGACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATAT
CAE.EL_B        GGCCGGACTGCGCTTGTGAGTTG------ACACGTATACACAGCCTTCTCAATACCTTCA
                ** ****   ** **  * ** *      **   ***   * **     * **  * *  

ARA.TH_F        GAACCACCATTTT-
CAE.EL_B        GACCACTTGTTTTT
                ** *     **** 

[Download ClustalW]

#674

Mean pairwise ID: 46.18%


LYC.ES_K        GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT--
                   **** * **  ** * ****** *  **  *     * * *  ** * * * * *  

LYC.ES_K        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGT--TCTGGCCTGCCC---TGTCCAAG
CAE.EL_D        GGATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTG
                ** *  *     ***  * *    ***    * **  ***     * **    ****  *

LYC.ES_K        CACAGAGTAGGATCACGAGGCCCAAAT-----GAAAATATGGGCTTCTTGATTCCTAAAG
CAE.EL_D        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGG
                *  ** *     **** ***    **      ***         * *  * * * *** *

LYC.ES_K        CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT
CAE.EL_D        AGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
                 *  * ***  *     * * *     *   *****  ** ***  ****   *******

LYC.ES_K        GGAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATA
CAE.EL_D        GGCCGGAC--CGCGCTTGTAAGTTGACACACATA-CACAGCCTTCTCGATACCTTCAG--
                **  ***    * *   **   **  **     *  *  ****  * * *  ** **   

LYC.ES_K        AACAACCACCTTT-
CAE.EL_D        ACCACTTATCATTT
                * **   * * ** 

[Download ClustalW]

#675

Mean pairwise ID: 46.20%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGG--GGGCATGTGGGAAATGGAACATTGG
DRO.MEL.        -------GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGG
                       *    *  **   * * *    **      ** * ** **  *   *   ***

HUM.LU_B        GTCAGCCCAGTGGATCGGGTCCAGTGT-TAGCTGC----------TTACTGGTCTGCCCA
DRO.MEL.        GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCG
                *   ***  * ** * ** ** * **  **** *           **   **   * ** 

HUM.LU_B        TTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAG
DRO.MEL.        CACTAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAA
                  * ****  *   *     ** *** * ***  **   * ***  * *       *** 

HUM.LU_B        AGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCA
DRO.MEL.        GGAGGGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCA
                 * **   * *  * *  ***  ***   *   ****** *  *  *****     ****

HUM.LU_B        GTGGAAGGATAACGGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAA
DRO.MEL.        GTAGTGGGATAGCGTACCGGAG-----TGGACTGCCGTTATCAGCCCAACCGATA--TGG
                ** *  ***** **  **** *     *** *  ** *  ***      * **    *  

HUM.LU_B        TCGGACCATTTCCTTT
DRO.MEL.        TTGGACCACAATCTTT
                * ******    ****

[Download ClustalW]

#676

Mean pairwise ID: 46.20%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGA----GGGTATCAAAGTGGTTGAAC
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                 ******  ***  ***  * ** **   * **  *    **      *    *  * * 

CIN.HYB.        TTTGAGCTTG-GCTTAGCTAGTTGGGTCTGTAG-ACACCGCACCTGGCTTGCCCGTTCCA
GAL.GAL.        C----GCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCG---TCCG
                     ***** **  **    *  ** *** **  * *    **  **  **    *** 

CIN.HYB.        AGTCGAGAGTGGGTTCATGTTTCCTGAGC---GAAGGCTCGGGTGATGTGAGCTTTAGAA
GAL.GAL.        CGCTAAGGCCGGCATCA-ATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTA
                 *   **   **  ***  * *  *****   *  *   ** *  *    ** **    *

CIN.HYB.        TCGGGGGGCAATGCG--TTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGAC
GAL.GAL.        AGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTC
                  * ****  *  **    ***  **    ** **** *   *** ***     *  * *

CIN.HYB.        TGTGGAAGGATTACAAGCCGGAGTGTCTTAGGCTCATATAAC-CAGCCTGGCTAGCCCAA
GAL.GAL.        AGTAACGGGATCGC--GCCTGTGAAT----AGCCACTGCAGCGTAGCCTGGGCAACATAG
                 **    ****  *  *** * *  *     **   *  * *  *******  * *  * 

CIN.HYB.        CAGGACACCCATTT--
GAL.GAL.        CGAGAC-CCTGTCTCC
                *  *** **  * *  

[Download ClustalW]

#677

Mean pairwise ID: 46.21%


TET.ROS.        GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATA-GTCAG
YAR.LI_B        -----AGCTGTAATGGCATTTTGTCGGAGTGG--TAAATCGCCTTCTTGTTGTGCGTTCG
                      *  * **** *  *      * ****  ****     *  **    *  **  *

TET.ROS.        AGTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTG-AGTTG
YAR.LI_B        AGTTCTGGACTCTG------CACTGGGCTACTTTGTTGTCCTTTCCGAATTCTGCGGTTG
                ***    ** * **      ** *  ****      ** ** **** **   **  ****

TET.ROS.        CTATG-GTGGAAACCT-AGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAG-GAACCG
YAR.LI_B        ATGGGCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATA
                 *  * **      ** ****** **  ** *      * **  *    * *  *     

TET.ROS.        CCTCAGGCTGGCAACAGAACAGGGAAA-ACTTGCCGCT--TATTGTGGTGGAAGGATAAC
YAR.LI_B        CTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGCCGTGGGTATGGCGGTGGGATAGCAAC
                * ****    ****   * *** **   * ******    *** * ***** *    ***

TET.ROS.        ATACTCATTAACTGTCAAGCTAATCGGTTCTGCTATTCTGATCAGACACT
YAR.LI_B        AAAGTGGT-ATATGTTATGGAAG--GTATTTGCAATCACGACTCTC----
                * * *  * *  *** * *  *   *  * *** **   **         

[Download ClustalW]

#678

Mean pairwise ID: 46.25%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACGTTG
LYC.ES_D        ------------------------------------------------------------
                                                                            

ARA.TH_C        GGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTCTGGCCCGCCCATTCCAAGTT
LYC.ES_D        ---------------------------------TA-GTTCTGGCCTGCCCTGTCCAAGCA
                                                 **  ******** ****  ******  

ARA.TH_C        GGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGGGGA
LYC.ES_D        CAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCG
                  **** *   ** * *   * *  ***     ***  ** **  * *** ** ****  

ARA.TH_C        GACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAAGGA
LYC.ES_D        GACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA
                ****** ********* ************ *  ** **********   * *********

ARA.TH_C        TTACGGGCCATTGCCTT-CCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACCAT
LYC.ES_D        TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCAC
                * * *** *  ** ***  * **  ** **   ** ***  *  ***** * *  **** 

ARA.TH_C        CACTTT-
LYC.ES_D        CACTTTT
                ****** 

[Download ClustalW]

#679

Mean pairwise ID: 46.25%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG-TGGAGACAATAAGGGGATGGGACGTT
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
                * **  * * **  **** ** ***  *** ** *       *    * *   *** * *

ARA.TH_C        GGGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTC-TGGCCCGCCCATTCCAAG
ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                 * * **   **   *  * **   *   ** *****     * *   * **   * ***

ARA.TH_C        TTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGGG
ORI.CUN.        TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG
                ** **  *  *      * * **  * **  *   *     ** **   ***  * ****

ARA.TH_C        GAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAAG
ORI.CUN.        TGAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGG
                   ****    ***  **    ** ******     * ******  **   * ** *  *

ARA.TH_C        GATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACCA
ORI.CUN.        GATCGCG--CCTGTGAATAGCCACTGCACTCCAGCCTG----GGCAACATAGCGAGACCC
                ***  **  **  **  *  * *   ****    **      * *          **** 

ARA.TH_C        TCACTTT
ORI.CUN.        TGTCTCC
                *  **  

[Download ClustalW]

#680

Mean pairwise ID: 46.25%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
DRO.MEL.        GACTGGAAGGTTGGC-AGCTTCTGTAATC---ACGCTTCTGTGAGGTCTGATTGTGG--G
                * *  *     * ** **   ****** *    **        *    **  ** **  *

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTG-TAATCTTGCTGGCTTGCCCGTT
DRO.MEL.        ATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACGTCCGCA
                 * *     *  *  ****    **     *     * * ** ***  **   * ***  

ORY.SA_A        CCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCC
DRO.MEL.        CTAAGCTTGCCATCAATATG--GGTGCCATGGAGGAGTCCGTGGCATTCAGGTT--GGC-
                * *** *    *       *  ** **  *** * ** ** * ** **     *  *** 

ORY.SA_A        CTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCC
DRO.MEL.        -TAAGGAGGGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTA
                 *** * ** * * ** * *  ***  **    *   ****** *  * * ****     

ORY.SA_A        ATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCT
DRO.MEL.        GGCAGTAGTGGGATAGCGTACCGGAGTGGACTG---CCGTTATCAGCCCAA----CCGAT
                  * ** *  ***** *   * *  *     **   *** *    *****     **  *

ORY.SA_A        ACAAC-AGACCACCATCTTT
DRO.MEL.        ATGGTTGGACCACAATCTTT
                *      ****** ******

[Download ClustalW]

#681

Mean pairwise ID: 46.25%


LYC.ES_G        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
YAR.LI_B        ---------AGCTGTAATGGCATTTTGTCGGAGTGG------TAAATCGCCTTCTTGTTG
                         **   *   *** * *   *  * ***      ***   *      *****

LYC.ES_G        GGCTGTACCAGATGGTTGGGCTTGG---TGGGCTAATTTCTGGCCTGCCCTATCCAAGCA
YAR.LI_B        TGC-GTTCGAGTT--CTGGACTCTGCACTGGGCTACTTTGT----TGTCCTTTCCGAATT
                 ** ** * ** *   *** **  *   ******* *** *    ** *** *** *   

LYC.ES_G        CAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCTAAAGTGGGGTG
YAR.LI_B        CTGCGGTTGATGG-GCGTCTCGGTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATT
                * * * * ***   * *   *  *   *  *** ****   ***** *     *  * * 

LYC.ES_G        GACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGTGCAGTGGAAGGA
YAR.LI_B        AACTGGGATACTTCAGTGGAGCAATCCAGCAGAGA---TCCAGTT---GCCGTGG--GTA
                 ** * *  *     **    **   ** *  * *   ***  **   ** ****  * *

LYC.ES_G        TAACGGACCGGTGCCTTCCAAGTTCCATTAATGCCTGATGGGCTGCTCCAATTAAACCAC
YAR.LI_B        TGGCGGTGGGATAGCAACAAAGTGGTATATGT-TATGGAAGGTATTTGCAAT-----CAC
                *  ***   * *  *  * ****   **   *   **   **    * ****     ***

LYC.ES_G        CACTTTT
YAR.LI_B        GACTCTC
                 *** * 

[Download ClustalW]

#682

Mean pairwise ID: 46.26%


TRY.BR_A        ------AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCCCGCTTAGCGGGGA
ZEA.MA_H        NCCGAGCTCTGTAGCG-AGTGCT-TGTAACCCGAGCGGGGGCAATAAGG--TAGTGTGGA
                        * * **** * **** *******   * ****   **   *  *** * ***

TRY.BR_A        CGTC-----TTGGACAAGCGGG-GGTTCTGTTGCGTTGACTTGGTGTTC-----TGCTTG
ZEA.MA_H        TGTCAATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAA
                 ***     * *  ** * *   ** ***  ***    *  **  *  *     * *   

TRY.BR_A        GTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGG
ZEA.MA_H        GTTGCGTAGTGG-GTTTCGGATGCCTTGGCGAAAGCTTTGCATCCCAACACTAAAGTGGC
                *******   ** ***  **  ***   *   *         ** *  *  ******** 

TRY.BR_A        GGGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTCGAGA
ZEA.MA_H        GGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC-CACCAGCGGTGGA
                **  *  * ** **** **  * *  *******       ** * *   ** *     **

TRY.BR_A        AGCACACCGAGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG
ZEA.MA_H        AGGATAATGAG-----TCGCTATGCTATAGGCCCAAT-----------------
                ** * *  ***     ** *    ** *  **** *                  

[Download ClustalW]

#683

Mean pairwise ID: 46.28%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTG---GGGATGTTAATG-TGGTGGAAT
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
                *  * *    **  ** * ** ***** *****     **** * * * * *** ***  

LYC.ES_N        GTTGGGCTGTACCAGATGGTTGGGCTT-GGTGGGCTA-ATTTCTGACTTGCCCTATCCAA
FUG.RUB.        GCTTGA--GCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAA
                * * *   *  *  **    *******  * ** ***  *   *    ** **   * **

LYC.ES_N        GCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATT-CGTAAAGTGG
FUG.RUB.        GTTCGGTATCG-ATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGG
                * *  *  * * **   ***  **    * **    ***  **  * *  * *** * **

LYC.ES_N        GGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCGCTCTAAGCGGTGGAA
FUG.RUB.        GGTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAA-AGCCCCCGTGCCGCTCAGTAGTG
                ** *    *    ***  **   *  **     * * *     **  *    * ** *  

LYC.ES_N        GGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAAACC
FUG.RUB.        GGAT--CGCGCCCGTGAA---TAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTC
                ****  ** * * ***     *     * ***   *    ** **  * *      *  *

LYC.ES_N        ACCATTTTT
FUG.RUB.        AGTCTTT--
                *   ***  

[Download ClustalW]

#684

Mean pairwise ID: 46.28%


ZEA.MA_B        -NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGC
TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
                  * * *        *  * *  * **    *           ** * **     ***  

ZEA.MA_B        TTTGCGATGGTTTC-TGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCCCAAG
TET.THE.        GATATGAGAGTTTGATGAGAC--AGTTTGCTAAGAGTGTGCCCG--CTCCAAACAATGAG
                  *  **  ****  ** * *   * * * *  ** * *  ***   * *  *     **

ZEA.MA_B        TTGGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGGCA
TET.THE.        TTGCTA-----TGGTGGTAACCTAGTAATAGGACT---CCACCAGGGCATTAAAGAGCTA
                *** **     **  **    ****  * **   *    * *    *   ** ** *  *

ZEA.MA_B        -GGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGTGGG
TET.THE.        AGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCC-GCTTGTTGTGGTGGA
                 ****  ** * ********   ***** *** **  *** ***  ***     ***** 

ZEA.MA_B        AGGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAAACC
TET.THE.        AGGATAACATACTCATTAACTGTCAAACTAAT-CGGTTCTA----CTATCAAAGCCAGAC
                *********  *   *  *** * *  * **  * *  * *    ** **  *** *  *

ZEA.MA_B        ACCATCTTT
TET.THE.        ATT------
                *        

[Download ClustalW]

#685

Mean pairwise ID: 46.28%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCA-TGTGGGGACATTAAGATGGTGGGACACT
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *    ****** *  **   *   ***  **     *** *     

ARA.TH_F        GGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCAAGC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 **  *       *    *  * **  ** * * * **         * **   ******

ARA.TH_F        TGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCT-TGGCTTGCAGGTTCTAGAGTCGGAGG
CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAG-----GA
                  *  ** *  ** *   *  **   ******  *   *  * *** *   **     * 

ARA.TH_F        GTAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACTTCCCGCTTACAGCAGTGGAC
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCC
                **  **  **   * **    * **  *****  *  *    **** *   ******* *

ARA.TH_F        GGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAAC
CAE.EL_A        GGACCGCGCTTGTGAGTTGA-CACACATACGCAGCCTTCTCGATAC--CTTCAGACCACT
                *** * ** **  * ** *  ** *   **   * * *   * * *    *** *  *  

ARA.TH_F        CACCATTTT
CAE.EL_A        TATCATTT-
                 * ***** 

[Download ClustalW]

#686

Mean pairwise ID: 46.30%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATGC
LEP.COL.        -----GCCGG--AGCCTTGCTCTGTAACCTT--CGGGGGCTTTCACCAG---CTGAACAG
                     *** *  *** ***   *** ***    *******  * *   *    ** *   

ORY.SA_B        CTGGTCGTTTGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTATGCGGCCCGCCCGTTCCA
LEP.COL.        GGAGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGT
                   *  ** **  *  *      * ** ** **  *  **   * *  * **  *     

ORY.SA_B        AGTTGCGTAGCGTGTGTGGGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCACCTAGAGTG
LEP.COL.        GTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCG--CGCCCCCTCCGTTAAAGTA
                   *  *  ** *  * * * * *** *  *****  **  ** ***  *   ** *** 

ORY.SA_B        GCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCCAACGGTGG
LEP.COL.        G-AGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGC
                *  ** * ** ** **** **    ** *******      *** * * **   ** ** 

ORY.SA_B        AAGGATAACGGGCCGCTGCAGCCCTGGCCCGCTTCCGGCCCAAGTGCCTTCCATGGCAGA
LEP.COL.        AGA---ACCACACCGC-GGAGCCTGTCATCACCTGCGCCCCAGGCGA-TCCTGTGAAGCT
                *     * *   **** * ****      * * * ** **** * *  * *  **     

ORY.SA_B        CCACCACCTTT
LEP.COL.        TT---------
                           

[Download ClustalW]

#687

Mean pairwise ID: 46.30%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGGACTT
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                ***** *   *   **   *******  ** **      ** * *  *     *     *

HUM.LU_A        TGGGTCAACCTAGTGGATCGGGTC--CAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAA
GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGC-GTCCGCGCTAA
                 *  * * ** **  * ** ** *  *****     ***  *  ** * * **   * **

HUM.LU_A        GCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCCTAGAGTGGA
GAL.GAL.        GGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAGGG
                * * **  *     **     **  ** **   *  *     *      ****  * ** 

HUM.LU_A        GGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAA
GAL.GAL.        GTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTAACG
                * * *  *    ***  **    ** ******     * ******  *  * ****    

HUM.LU_A        GGATAACGGGCCGGTGCTACCTGGGTCCACCATGCTTCACTAGGCTGACTCTTAATAGGA
GAL.GAL.        GGAT--CGCGCCTGTGAATAGCCACTGCAGCGTAGC---CTGGGCAA---CATAGCGAGA
                ****  ** *** ***         * ** * *      ** ***     * **    **

HUM.LU_A        CCATTTCTTTT
GAL.GAL.        CCCTGTCTCC-
                ** * ***   

[Download ClustalW]

#688

Mean pairwise ID: 46.30%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG----TGGGGACAATAAGGTGGTGGAAC
HOM.SA_B        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGG--GAGG
                * ** **   **  ** * ** ***   ** **    * ****   * ******  **  

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGC-TGACATATATCTGAGCTGCCCAGTCCA
HOM.SA_B        ATCGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTA
                *  * ** *   *    * ** *  ***  *   *  **     ** * ** **   * *

ARA.TH_D        AGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-CTAAAGTCG
HOM.SA_B        AGTTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
                ** *  *  * *  * **  *  *   **   **  *   *   * * ** *  ***  *

ARA.TH_D        GAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGG
HOM.SA_B        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
                * * * *  *    ***  **    ** ******     *  ****      * **** *

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGG
HOM.SA_B        TGGGATCGCGCCTGTGAATAGCC--ACTGCACTCCAGCCTG--AGC---AACATAGCGAG
                  *****     *   * *  *     * ****   *** *   *    * *    *  *

ARA.TH_D        ACCACCACTTT
HOM.SA_B        ACCCCGTCTCT
                *** *  ** *

[Download ClustalW]

#689

Mean pairwise ID: 46.33%


ZEA.MA_A        -NCCGAGCTCTGTAGCGAGAGCTTGTAACC-CGAGCGGGGGCATTAAGGTGGTGTGAATG
DRO.MEL.        GACTGGAA--GGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGG
                  * *      ** *  **    ***** * **     * *   *  * * *** **  *

ZEA.MA_A        CTTTGCGATGG--CTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCC
DRO.MEL.        CCTGAGGCTGGGATCTACTGCGTAGCGGACCAGCT--CATGTTGAC-GGAACGTCCGCAC
                * *   * ***    * *** *    ** *  * *   *   ** * **   * **   *

ZEA.MA_A        CAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAG
DRO.MEL.        TAAGCTTGCCATCAATA-TGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGG
                 *** * *   *   *  **** **  * * * *  *  ***   ** *     **   *

ZEA.MA_A        CGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGGT
DRO.MEL.        AGGGATGAACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGT
                 ** * ***  * *  ***  **    *   ****** *  * * **         * **

ZEA.MA_A        GGGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGCA
DRO.MEL.        AGTGGGATAGCGTA-CCGGAGTGGACTGCCGTTA--TCAGCCC---AACCGATATGGTTG
                 *  ***** ** * ***  *     **    **  **** *    ****    *     

ZEA.MA_A        AACCACCATCTTT
DRO.MEL.        GACCACAATCTTT
                 ***** ******

[Download ClustalW]

#690

Mean pairwise ID: 46.33%


TRI.AE_B        NCCGAGC-TAGTTGCGGGAGCTTGTCACCCATG----TGGGGGCATTGAGGCGGTGTGGA
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                 *** **   ** ***   ** ***   **  *    * ***    **** * *   *  

TRI.AE_B        TGCTTGGTGC--GGTTTGTTGGCCTGGGCTTGTGATGTAACCTTGCTGGCCTGCCCGTTC
GAL.GAL.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGT-GCGCTATG-CCGAGCGGGCGTCCGCGCTA
                 *****   *  **  *  *** ***   * * * * *  **  ** *** * * ** * 

TRI.AE_B        CAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGG---CCTTAAG
GAL.GAL.        -AGGCCGGCATCAATATGGTGAGCCCCG--GGGAGCCGAGGCACACCAGGTTGCCTAAGG
                 * *  ** *      ***   **   *  *  ***   * *    ****   *** * *

TRI.AE_B        TGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAG-CGACAACTGCCGCTTCCAACGGT
GAL.GAL.        AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGT
                 **   * ***     ***  **    ** ******   * **** ***   *   * **

TRI.AE_B        GGAAGGATAACAGGCCGCTGCAGCATGGGCCCGCTCTGGGCCTCCTACCCCGCCATAGCA
GAL.GAL.        AACGGGAT-------CGCGCCTGTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCG
                    ****       ***  * *       ** **   *     *     *  ****** 

TRI.AE_B        GACCACCATCTTT
GAL.GAL.        AGACCCTGTCTCC
                   * *  ***  

[Download ClustalW]

#691

Mean pairwise ID: 46.33%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG----TGGGGACAATAAGGTGGTGGAAC
HOM.SA_A        GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGC--TGGAGG
                * ** **   **  ** * ** ***   ** **    * ****   * ***   ****  

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGC-TGACATATATCTGAGCTGCCCAGTCCA
HOM.SA_A        ATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                *  * ** * * *    * ** *  ***  *   *  **     *  * ** **   * *

ARA.TH_D        AGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-CTAAAGTCG
HOM.SA_A        AGTTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
                ** *  *  * *  * **  *  *   **   **  *   *   * * ** *  ***  *

ARA.TH_D        GAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACAGCAGTGG
HOM.SA_A        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
                * * * *  *    ***  **    ** ******     *  ****      * **** *

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCC-GCTGGTTCGATCTCTCCTG
HOM.SA_A        TGGGATCGCGCCTGTGAAT-------AGCCACTGCACTCCAGCCTGTGCAA-CATAGCGA
                  *****     *   * *       * *****     ** **  ** * * *    *  

ARA.TH_D        GACCACCACTTT-
HOM.SA_A        GACCCCGTCTCTT
                **** *  ** * 

[Download ClustalW]

#692

Mean pairwise ID: 46.33%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGG-GGCATTAAGGTGGTGTGGATG-
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *   *       * *  **     ********* 

ZEA.MA_F        --TTTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCC
CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTC---GACCGAGC-GTCCGTGCC
                  *     ** *  * *** *  **   ****    * *   * ***  * * **** **

ZEA.MA_F        AAGTTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGACCTGAAGCGG
CAE.EL_B        AAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAG
                ***      **  *  * **    * * ** * *   *    **    *  *  ***  *

ZEA.MA_F        CAG-GCATGGCGTGAGGCTGGCT--TCACAGAGCAGCGATCACTCGCCCGCTTCCAACGG
CAE.EL_B        TGGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCAC-CGCGCGGTGC-AGTGG
                  * * ****     * * *     *  **** **     *** *** ** * * *  **

ZEA.MA_F        TGGGAGGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAG
CAE.EL_B        CCGGACTGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCA-------G
                  ***        *   * **    * *  * ** *    ** * * * ***       *

ZEA.MA_F        ACCACCATCTTT-
CAE.EL_B        ACCACTTGTTTTT
                *****    *** 

[Download ClustalW]

#693

Mean pairwise ID: 46.33%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGCT
LYC.ES_L        -----------------------------------------------------------G
                                                                            

ZEA.MA_A        TTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCC-GGCTTGCCCATCCCAA
LYC.ES_L        TTGGGTTGAC--CCAGATGGTTGGGTTCGGTAGGCTTATAGTCTGGCCTGCCCTCTCCAA
                *** * ** *   * *     **** *** *  *    * * * *** *****   ****

ZEA.MA_A        GTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCGG
LYC.ES_L        GCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAAGTGG
                *   * ***        * ****    ******   *****  **  *  ***  ** **

ZEA.MA_A        CAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGGTGGG
LYC.ES_L        GGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGA
                   * *  **** ******* *********** *** **    *  ***    * **** 

ZEA.MA_A        AGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGA---ACCTCACTAAGCA
LYC.ES_L        AGGATAACGG-GTCAGTGCTCAGCGAGTCCAGTTAACGCCCTGATGGGCTGCTCCAACTA
                *********  * *  *** *   *** * *  * * ** * **    *  * * **  *

ZEA.MA_A        AACCACCATCTTT
LYC.ES_L        AACCACCACTTT-
                ********  ** 

[Download ClustalW]

#694

Mean pairwise ID: 46.33%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCG----GGGGCATTAAGGTGGTGTGGA
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
                 *** ** * ** *** * ** ****  ** ***     ***    * ***  *   *  

ZEA.MA_C        TGCTTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCA
CAN.SPE.        CGCTTGAGCCCAGGAGTT--CTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                 *****   **  *  **  *  ** * **  * *       * * *  ** ***  * *

ZEA.MA_C        AGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGG-ACCTATAGT
CAN.SPE.        AGTTCGGCATCAATATGGTGACCTCC--CGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
                **** *   *     * *  * **    **   **   ** *  **  *   ****  * 

ZEA.MA_C        GGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTG
CAN.SPE.        GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
                **   **** *    ***  *     ** ******     *   ** *   * * * ** 

ZEA.MA_C        GAAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCA
CAN.SPE.        GTGGGATCGC--GCCTGTGAATAGCCACTGCACT------CCAGCCTGTGCAACATAGCG
                *  ****  *  ***  ** *         * **      * ** **    *  * *** 

ZEA.MA_C        GACCACCATTTTT
CAN.SPE.        AGACCCCGTCTCT
                   * ** * * *

[Download ClustalW]

#695

Mean pairwise ID: 46.33%


TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGA-TGTGAACGC
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                    ***      **       *******   * ***   **     * *  * * *** 

TRI.AE_A        TGTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGTTG
TRY.BR_B        CTTGGACAAGCGGGGGTTCTG--TTGCGTTGACT--TGGTGTTCTGCTTG------GTTG
                  * *    ** * **  ***   ** **   **  ** **  * **  *      ****

TRI.AE_A        CGTAGTGGACCGCCTGGGGCTTATGCGAAAGCTGGGTCTCACGGTCCATAATGTGGCAGG
TRY.BR_B        CGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCG-CCGTTAAAGTGGGGGG
                ***   **       *  **   **   *     * **** **  *  *** ****  **

TRI.AE_A        CACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGC-TTCCAACGGTGGAAGG
TRY.BR_B        AACGG-GTCAGGCCGG--TGACGGAGCAGCCCACCTTGCGCACGTTCCCGTTGCAGAAGC
                 ** * ** **** **  * ** *******      *** * * ****    *  **** 

TRI.AE_A        ATAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCAGACCACC
TRY.BR_B        ACACCGAGGAGCA----TCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT--
                * *  * *  **     **  *** *  *  * **     * *  * * **  *      

[Download ClustalW]

#696

Mean pairwise ID: 46.35%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG---ACGGTAGATAAG--TGTG
                 ***  * * *   ** * ** *** *  **  *    *     ** * **  *  * **

HUM.LU_A        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
CAE.EL_B        GATGGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGC--GTCCG
                * *  *   ** ***  * **** ****  *  * *  *      * **   *    ***

HUM.LU_A        GGAGTTGGGCTGAGTGACCTGGGCG-AAGGGCTGGGTTGCGCACGTCCTAGAGTGGA---
CAE.EL_B        TGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAA
                 *    * **** ** *** ***    *  *  **     *  *   *  * *** *   

HUM.LU_A        -GGGCAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACCTCCCGCTCTCGGCAGTG
CAE.EL_B        GGAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
                 * *   **  **   * **    * **  *****  *  * *  **** *   ******

HUM.LU_A        GAAGGATAACGGGCCGGTGCTACCTGGGTCCACCATGCTTCACTAGGCTGACTCTTAATA
CAE.EL_B        GCCGGACTGCGCTTGTGAGTTGAC-ACGTATACACAGCCTTCTCAA---TACCTTCA---
                *  ***   **     * * *  *   **  **   ** *    *     **  * *   

HUM.LU_A        GGACCATTTCTTTT-
CAE.EL_B        -GACCACTTGTTTTT
                 ***** ** **** 

[Download ClustalW]

#697

Mean pairwise ID: 46.35%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGAATGC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                 *** *    ** *** * ** *** *  *        * *  **     ***** *** 

ZEA.MA_A        TTTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGT-GACACTGGC--CGGCTTGCCCATCC
CAE.BRI.        AGTGAAGGGAG-----GAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGC
                  **    *       * * **** *   ***** * **  ***  * *   * ** * *

ZEA.MA_A        CAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAG
CAE.BRI.        CAAGC--GCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTC------CCGGGCG
                ****   *  * ***    **** ***  *    *    ***   **      ** ** *

ZEA.MA_A        CGGCAGGAATGGCGTAAGGCT-GGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGG
CAE.BRI.        CATAAGGAGTGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGC--GCGG
                *   **** *** * * ****  *   *  *  *****   **    * **  *   ***

ZEA.MA_A        TGGGAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGC
CAE.BRI.        TGCAGTGGCCGGATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCTT-C
                **    *       ***   **    ***   **  * **    *        **    *

ZEA.MA_A        AAACCACC-ATCTTT
CAE.BRI.        AGACCACTTGTCATT
                * *****   ** **

[Download ClustalW]

#698

Mean pairwise ID: 46.35%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCA------TGTGGGGACATTAAGATGGTGGG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *    ****** *  **      **  ** * ** *   ***  **

ARA.TH_A        ACACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGCATGTTTCTGAGCTGCCCAGTCC
CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGT--CGTTGTCAACGT-CGACCGAGC-GTCCGTGCC
                *    *    **   *  *  *  **   * ***   * *    * **** * **   **

ARA.TH_A        AAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTC
CAE.EL_B        AAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGA--TGGTCAGTCCCGGGTGCATAA--
                ****  ** ** *  ** *      **   ****   ***    * * ** *  * *   

ARA.TH_A        GGAGGGTAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACTTCCCGCTTACAGCAG
CAE.EL_B        --GGAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAG
                   * **  **  **   * **    * **  *****  *  *    ****     ****

ARA.TH_A        TGGACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATA
CAE.EL_B        TGGCCGGACTGCGCTTGTGAGTTG------ACACGTATACACAGCCTTCTCAATACCTTC
                *** ****   ** **  * ** *      **   ***   * **     * **  * * 

ARA.TH_A        TGAACCACCATTTT-
CAE.EL_B        AGACCACTTGTTTTT
                 ** *     **** 

[Download ClustalW]

#699

Mean pairwise ID: 46.35%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCG----GGGGCATTAAGGTGGTGTGGA
RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
                 *** ** * ** ***   ** ****  ** ***     ***    * **   *   *  

ZEA.MA_C        TGCTTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTT--TGTTGGCCTGCCCGTTC
RAT.NOR.        CGATTGAGTCCAGGAGTT---CTGGGCT-GTAGTGCGCTATGCCGATCGGGTGTCCGCAC
                 * ***   **  *  **   ***** *  * *** **  *   * * *  ** ***  *

ZEA.MA_C        CAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGG-ACCTATA
RAT.NOR.        TAAGTTCGGCATCAATATGGTGACCTCC--CGGGAGCGGGGGACCACCAGGTTGCCTAAG
                 ***** *   *     * *  * **    **   **   ** *  **  *   ****  

ZEA.MA_C        GTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGG
RAT.NOR.        GAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAG
                * **   **** *    ***  *     ** ******     *   ** *   * * * *

ZEA.MA_C        TGGAAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAG
RAT.NOR.        TAGTGGGATCGC--GCCTGTGAATAGCCACTGCACTCCAG-CCTGGGCAACATAGCGAGA
                * *  ****  *  ***  ** *         * **  ** *** * *  ****   *  

ZEA.MA_C        CAGACCACCATTTTT
RAT.NOR.        CCCGTCTCT------
                *    * *       

[Download ClustalW]

#700

Mean pairwise ID: 46.35%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     *** ****  

ZEA.MA_D        TTTGCGATG--GCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATG---TCGTTGT-CAACGTCGACCGAGC-GTCCGTGC
                  ** ** *  *  * *** *   *   *** * *    * * * ***  * * **** *

ZEA.MA_D        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.EL_C        CAAGCGCTGCGTCACCAGGGGATGACT-GTCGGAAGA--TGGTCAGTCCCG----GGTGC
                ****      **  *  * *** *  *   ******   *****  *** *    *  * 

ZEA.MA_D        GGCAGGAATGGCGTGAGGCT-GGCTTCACAGAGCAGCGATCACTCGCC--CGCTTCCAAC
CAE.EL_C        ATAAGGAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGC
                   **** *** *   ** *  *   *  *  * ***   **   ***  ***      *

ZEA.MA_D        GGTGGGAGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCC-CAGAGCCTCACTAA
CAE.EL_C        AGTGGCCGGACAGC--GCTTGTGAGTTGACACGTATACACAGCCTTCTCAATACCTTCAG
                 ****  *** * *  **   **   *   *     ** *** *  *  *    *   * 

ZEA.MA_D        GCAGACCACCATCTT
CAE.EL_C        ACCACTTGTCACT--
                 *       **    

[Download ClustalW]

#701

Mean pairwise ID: 46.41%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACGTTG
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCC-----CGCTTAGCGG
                    * *       *   *   *** * *   * ** *   **        *    *  *

ARA.TH_C        GGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTC-TGGCCCGCCCATTCCAAGT
TRY.BR_A        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                ** **   *      ** *** *   **** * *   **  **  * **    *      

ARA.TH_C        TGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGGGG
TRY.BR_A        TCGGTGTTGAGG--TCGCCACTGTAGAGAGGC---GTTCTCGCGCCGT-TAAAGTGGGGG
                * ** *******  * * *   *     ****   * ****  * * * ** ********

ARA.TH_C        AGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAAGG
TRY.BR_A        -GAACGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGA
                 ** ** ** **** ***   ** *******  ******  *** * *  * **   ** 

ARA.TH_C        ATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACCAT
TRY.BR_A        AGCACAC-CGAGGAGCATCTCAGGACTTTGCGCCCCAA-GTGTCGTCGCGAGGCGG----
                *  **   * *    * **  **  *  *  * *****   * **   ***   *     

ARA.TH_C        CACTTT
TRY.BR_A        ------
                      

[Download ClustalW]

#702

Mean pairwise ID: 46.43%


HUM.LU_C        GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACTTTGGGT
TET.THE.        -GCCAGGGTAGCA-ATACCTGTG-TCTATATGTGG---CATAAACAATGTAGGTTGTGAT
                 * *   * * *     *****   * *  ** **     *    **** *  **  * *

HUM.LU_C        CAACCCAGTGGTNCGGGNCCAGTGC--TAGCTGCTTACCCGGCTGCCCATTCCAAGCCGG
TET.THE.        AGATAGGATA-TGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAAT
                  *     *  *  * *     **    ** *   **   *  *****  ***** *   

HUM.LU_C        GAGGTGGGCTGAGGG--ACCTGGGCGAAGG-CTNNNGGNGCGCACTCCTAGACTGGAGGG
TET.THE.        GAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCT--AAGG
                *** **   **  **  **** *    *** **      * *** *      **  * **

HUM.LU_C        CAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGGA
TET.THE.        AAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGA
                 ** ** * ********   ***** *** **  ** * *****    *  *********

HUM.LU_C        TAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGACCA
TET.THE.        TAACATACTCATTAACTGTCAAACTAATCGGTTCTACTA--TCAAAGCCAGACATT----
                ****   *   *   *  * *  * *  * **** ***      *  *   * *      

HUM.LU_C        TTTCTTTT
TET.THE.        --------
                        

[Download ClustalW]

#703

Mean pairwise ID: 46.43%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGT-GGCGCGGATGC
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                    ***      **       *******   * ***   **   * *  *** *** * 

ZEA.MA_B        TTTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCCCAAGT
TRY.BR_B        CTTGGACAAGCG--GGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTG---GTTGCGTGT
                 ***     *     ***    *   *****      *   * *****    *  *  **

ZEA.MA_B        TGGTAGTGTCTGACGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGGCAG
TRY.BR_B        CGGTGTTGAG-GTCGCCACTGTAGAGAG------GCGTTCTCGCGCCGTTAAAGTGGGGG
                 ***  **   * **   ** *** **       * **    **     ** ** **  *

ZEA.MA_B        GAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCAC-TTCCAACGGTGGGA
TRY.BR_B        GAACGG-GTCAGGCCGG--TGACGGAGCAGCCCAC-CTTGCGCACGTTCCCGTTGCAGAA
                *** ** ** **** **  * ** *******   * ** ** *** ****    *  * *

ZEA.MA_B        GGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAAACCA
TRY.BR_B        GCACACCGAGGAGCATC--TCAGGACTTTGCGC---CCCAAGTG---TCGTCGCGAGGCG
                * * * * **  **  *  *  *  *    * *   ****  *    ** * ** *  * 

ZEA.MA_B        CCATCTTT
TRY.BR_B        GTTT----
                   *    

[Download ClustalW]

#704

Mean pairwise ID: 46.45%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
                * *****   *   **** ******** ***  *    * * *   *   **     * *

HUM.LU_D        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGC-TTACTGGTCTGCCCATTCCAAGCC
XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
                  * *  * **  * ** ** *     * ****   *   * *  ** **   * ***  

HUM.LU_D        GGGAGTTGGGCTGAGTGACCTGGGCGAAGGCTGGGTTGCGCAGCTCCTAGAGTGGAGGGC
XEN.LAE.        CGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGGT
                 **  *     **     ****** **     ** *  *   * * **  *  *  *** 

HUM.LU_D        AATGCG--TGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAAGG
XEN.LAE.        GAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGG
                 *  **    ***  **    ** ******     * * ****  *    **** *  **

HUM.LU_D        ATAACGGGCCGGTGCTACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGGAC-
XEN.LAE.        AT--CGCGCCTGTGAATAGCCGGTGCAGAACA----GCCTGAACAACAC--AGCGAGACA
                **  ** *** ***       * * **  *       *  *    ** *  *    *** 

HUM.LU_D        CATTTCTTTT
XEN.LAE.        CAGTTCT---
                ** ****   

[Download ClustalW]

#705

Mean pairwise ID: 46.45%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCA-TGTGGGGACATTAAGATGGTGGGACACT
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *    ****** *  **   *   ***  **     *** *     

ARA.TH_A        GGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCAAGC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 **  *       *    *  * **  ** * * * **         * **   ******

ARA.TH_A        TGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGGAG
CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGC--GGTTAGTCCCGGGTGCATAA----GG
                  *  ** *  ** *   *  **   ******  ** *  * * ** *  * *      *

ARA.TH_A        GGTAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACTTCCCGCTTACAGCAGTGGA
CAE.EL_A        AGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGC
                 **  **  **   * **    * **  *****  *  *    **** *   ******* 

ARA.TH_A        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAA
CAE.EL_A        CGGACCGCGCTTGTGAGTTGA-CACACATACGCAGCCTTCTCGATAC--CTTCAGACCAC
                **** * ** **  * ** *  ** *   **   * * *   * * *    *** *  * 

ARA.TH_A        CCACCATTTT
CAE.EL_A        TTATCATTT-
                  * ***** 

[Download ClustalW]

#706

Mean pairwise ID: 46.45%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-TGGGGGCAACAATGTGGTGGAATGTT
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
                **** **   **  ** * ** ****  ** ** *    *  *   ** **  * * * *

LYC.ES_F        GGGTCCATCTTGATGGAT--GGGCTTGAAGGGCTAATGTTC-TGGCCTGCCCTGTCCAAG
CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                 * *  * *      * *  *****  *  *    ***    * *  ** **   * ***

LYC.ES_F        CACAGAGTTGGGTCAAGTGGTCTATACGAAA-GTATAGCCACTTGGCC-TTTAGAGTGGG
CAN.SPE.        TTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
                  * *  *    *   ***  **    * *  *     ****  **     **  * ***

LYC.ES_F        ATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAA
CAN.SPE.        GTGAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTG
                 ** ** *    ***  **    ** *****      *   ****  ***  **** *  

LYC.ES_F        GGATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAAC
CAN.SPE.        GGATCGCG--CCTGTGAATAGCCACTGC--ACTCCAGCCTGT---GCAACATAGCGAGAC
                ***** **  *  ***       * * *  **   * ****    *   * **   * **

LYC.ES_F        CATCACTTTT
CAN.SPE.        CCCGTCTCT-
                *    ** * 

[Download ClustalW]

#707

Mean pairwise ID: 46.47%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGG--AAATGGGACTT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                          * * * * *  ********   * ***         *   **  **    

HUM.LU_D        TGGGTCAACCTA-GTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCA-TTCCAA
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGAC---GTGGTGCTCTGCTTGGCTGTGT
                **  *  ***    * *   *  * * * ***  *    *  ** *****     *    

HUM.LU_D        GCCGGGAGTTGGGCTGAGTGACCTGG-GCGAAGGCTGGGTTGCGCAGCTCCTAGAGTGGA
LEP.COL.        GTCGGAGGCC--TCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGA
                * ***  *     * * *** **    **  * *  * *   * *  *   ** *** **

HUM.LU_D        GGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTC-TCGGCAGTGGA
LEP.COL.        GGA-ACTGGGTCAGGCCGGC--AACGGAGCAGC--CCACCTCGCGCACGTCTGCCGTTGC
                **  * ** ** **** ***   ** *******  * ***** *** * ** ** ** * 

HUM.LU_D        AGGATAACGGGCCGGTGCTACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGG
LEP.COL.        AGAACCACA---CCGCGGAGCCTGTCATCACC-TGCGCCCCAGG--CGATCCT--GTGAA
                ** *  **    * * *   ****    **** ***  * * **   **  **   *   

HUM.LU_D        ACCATTTCTTTT
LEP.COL.        GCTTT-------
                 *  *       

[Download ClustalW]

#708

Mean pairwise ID: 46.47%


HUM.LU_D        ---GACGGGCTTAGCAACGTGGGCCTGTA-ACCCAAGTGGGGGCATGTGGGAAATGGGAC
DRO.MEL.        GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
                        * ** *** * *  *     *  *    *** ** *   * *      ** *

HUM.LU_D        TTTGGGTCA-ACCTAGTGGATCG-GGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCC
DRO.MEL.        TGAGGCTGGGATCTACTGCGTAGCGGACCAGC-TCA--TGTTGACGGAAC-GTCCGCACT
                *  ** *   * *** **  * * ** ****  * *  ** * ** *  * * **   * 

HUM.LU_D        AAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCTGGGTTGCGCAGCTCCTAGAGTGG
DRO.MEL.        AAGCTTGCCATCAATATGGGTGCCATGGA-GGAGTCCGTGGCATTCAGGTTGGCTAAGGA
                ****  *   *     ** *** * ***  * ** * * *     *** *     *  * 

HUM.LU_D        AGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGA
DRO.MEL.        GGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGT
                 **   *  ** *     **    *   ****** *  *  *****   * ****** * 

HUM.LU_D        AGGATAACGGGCCGGTGCTACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATAGG
DRO.MEL.        GGGATAGCGTACCGGAGTGGACTGCCGTTATCA-GCCCAACCGATATGGTT-------GG
                 ***** **  **** *    ***     * ** **   ** *   **  *       **

HUM.LU_D        ACCATTTCTTTT
DRO.MEL.        ACCACAATCTTT
                ****     ***

[Download ClustalW]

#709

Mean pairwise ID: 46.47%


ZEA.MA_E        -NCCGAGCTCTGTAGCGAGAGCTT-GTAACCCGAGCGGGGGCATTAAGGTGG-TGCGGAT
LEI.MAJ.        GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
                  * ********    *  * *** *    *  * * **   *    ** **  * *** 

ZEA.MA_E        TCTTTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
LEI.MAJ.        CAGCGAGGGTGATTTGCTGCGTT--GACGTG----GTGCTCT------GCTTGGCTGT--
                       * **  ** *** *    * *  *    ****  *      ** ** * **  

ZEA.MA_E        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
LEI.MAJ.        -GTGTCGGT-GTGGCTTGCC----CCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGC
                   ** *** ****** **     *    ** ** * *   *    ***     ***** 

ZEA.MA_E        GGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTTCCAACGGT
LEI.MAJ.        GA-GGGAACCGGGTCAGGCCGGAA--ACGGAGCAGC--CCACCCCACGCACGTCCGCCGT
                *   ****  * ** **** **    ** *******   *** *  **     *  * **

ZEA.MA_E        GGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAG
LEI.MAJ.        TGCAGAATCACACCGCGGAGCATGTC----CGCACTTGAGCCCCACGCTTCGTCGCGAAG
                 * ** ** **    **  ***  **    *  ***   ****   ** **     * **

ZEA.MA_E        ACCACCATCTTT
LEI.MAJ.        CCTT--------
                 *          

[Download ClustalW]

#710

Mean pairwise ID: 46.47%


LYC.ES_B        GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATGAGTGT-G
                  ***** * **   * * ****** *  **  *     * * *  ** *  ** *** *

LYC.ES_B        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_C        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *    * **    * * ** *   ***  **

LYC.ES_B        TTAGAGTTGGATCAT-GTGGCCCAATTG--AAGAAATGGAC--TACTTGATTCGTAAAGT
CAE.EL_C        CAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGA
                  ** * **  ***    **    * **     * **** *  * *  * * * *** * 

LYC.ES_B        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAAGCGGTG
CAE.EL_C        GTGGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
                * ** ***  *     * * *     *   ****   * ***   **** *   ** ***

LYC.ES_B        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAATGCCTGATGGGCTGCTCTAATTAA
CAE.EL_C        GCCGGACAGCGCTTGTGAGTTGAC-ACGTATA-CACAGCCTTCTCAATACCTTCAGACCA
                *  *** * **  *  * ***  *   **  *  *  ****  *      **  *    *

LYC.ES_B        ACCACCACTTTT
CAE.EL_C        CTTGTCACT---
                     ****   

[Download ClustalW]

#711

Mean pairwise ID: 46.47%


RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
LYC.ES_M        ---------------------------------CAAGTGGGGATGTTAAGGTGGTGGAAT
                                                 * * * **** * * **   *  * **

RAT.NOR.        CGATTGAG---TCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACT
LYC.ES_M        --ATTGGGCTGTCCCAGATGGCTGGGCT-TGGTGGGCTA-ATTTCTGGCCTGCCCTGTCC
                  **** *   ***  **   ******* * *** ****      * *  ** **   * 

RAT.NOR.        AAGTTCGGCATCA-ATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
LYC.ES_M        AAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT-CCTAAAGT
                ***  * *  *   **   * * **     * *     ** *  *  * ** ***** * 

RAT.NOR.        GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
LYC.ES_M        GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG
                **** * ****    ***  **    ** ******   * * ******  ***  **** 

RAT.NOR.        GTGGGAT--CGCGCCTGTGAATAGCCAC-TGCACTCCAGCCT---GGGCAACATAGCGAG
LYC.ES_M        GAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAA
                *  ****   * * * ***  *   **  * ** *   ****   ***   *      * 

RAT.NOR.        AC--CCGTCTCT
LYC.ES_M        ACAACCACCTTT
                **  **  ** *

[Download ClustalW]

#712

Mean pairwise ID: 46.47%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGA---GGGTATCAAAGTGGTTGAACT
RAT.NOR.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGA--GACAGGAGG
                 ******  ***  ***  * ** **   * **  *   ***   *  *  *   * *  

CIN.HYB.        TTGAGCTTGGCTTAGCTAGTTGGGTCTGTAG-ACACCGCACC--TGGCTTGCCCGTTCCA
RAT.NOR.        ATCGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                 *    *  *   **    *  ** ******  * *    **  * *  ** ***  * *

CIN.HYB.        AGTCGAG----AGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGA
RAT.NOR.        AGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT---GCCTAAGG
                ***   *    * *  * * *  *  *  *****  **  *    * *    ** * ** 

CIN.HYB.        ATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACT
RAT.NOR.        A--GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCA
                *  **** * *  *    ***  **    ** **** *   *** ***     **   * 

CIN.HYB.        GTGGAAGGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGCCCAACA
RAT.NOR.        GTAGTGGGATCGCGCCTGTGAATAGCCACTGCACT-----CCAGCCTGGGCAACATAGCG
                ** *  ****  *      ** *  *    ** *      *********  * *  * * 

CIN.HYB.        GGACACCCATTT
RAT.NOR.        AGACCCGTCTCT
                 *** *   * *

[Download ClustalW]

#713

Mean pairwise ID: 46.47%


ZEA.MA_G        -NCCGAGCTCTGTAGCGAGAGCTTGTAACC-CGAGCGGGGGCATTAAGGTGGTGCGGATT
DRO.MEL.        GACTGGAA--GGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTG-GGATG
                  * *      ** *  **    ***** * **     * *   *  * * *** **** 

ZEA.MA_G        CTTTGCGATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCCC
DRO.MEL.        GCCTGAGGCTGGGATCTACTGCGTAGCGGACCA-GCTCATGTTGACGGAACGTCCGCACT
                   ** *   *   ***    *   **   * * *  * * * * ***   * ***  * 

ZEA.MA_G        AAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGTG
DRO.MEL.        AAGCTTGCCATCAATA-TGGGTGCCATGGAGGAGTCCGTGGCATT--CAGGT-TGGCTAA
                *** * *   *   *   **  **  * * ***  *  ***  *   ***   **     

ZEA.MA_G        GCAGGAATGGCGTGAGGCTGGCTTCACAG--AGCAGCGATCACTGCCCGCTTCCAACGGT
DRO.MEL.        GGAGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGT
                * *** ***    * * * **  * * *   ****** *  * * ****       * **

ZEA.MA_G        GGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAGCAG
DRO.MEL.        AGTGGGATAGCGTACCGGAGTGGACTGCCGTTA--TCAGCCC---AACCGATATGGTTGG
                 *  ***** **  ***  *      *     *  **** **   * **    *     *

ZEA.MA_G        ACCACCATCTTT
DRO.MEL.        ACCACAATCTTT
                ***** ******

[Download ClustalW]

#714

Mean pairwise ID: 46.50%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGT----GGGGGCAAC--AATGTGG-TGG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ****** * **  ** * ****** *  *   *    *  ** *    * ***** ***

LYC.ES_F        AATGTTGGGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGT----CTACGTCGACCGAGCGTCCGTGCC
                * **   **   *      ** ***   ***     ***        *   * **   **

LYC.ES_F        AAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTA--TAGCCACTTGGCCTTTAGAGT
CAE.EL_A        AAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTC-CCGGGTGCATAAGGA
                **** *   **        *    ** *  *** *    *** * *  **    **  * 

LYC.ES_F        GGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTG
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                *   ****  *     * * *     *   ****   *  **   ****   ********

LYC.ES_F        GAAGGATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCT-AATT
CAE.EL_A        GCCGGACCGCG--CTTGTGA--GTTGACACACATACGCAGCCTTCTCGATACCTTCAGAC
                *  *** * **  ** ***    ****  *  *     * ***  * * *  * * *   

LYC.ES_F        AAACCATCACTTTT
CAE.EL_A        CACTTATCATTT--
                 *   **** **  

[Download ClustalW]

#715

Mean pairwise ID: 46.50%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGT-----GGGGACTATAAGATGGTGGAA
RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
                * ** **   **  **   ** ****  ** **      ***      * **  * *** 

ARA.TH_G        CACTGGATCGGCCCACGGGTCGGATTTGTTGTTGGC-ATAGGTCTGGACTGCCCAATCCA
RAT.RAT.        CGCTTGA--GTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                * ** **  * **    * ** *   *** **  ** **     * *  ** **   * *

ARA.TH_G        AGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTG
RAT.RAT.        AGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
                ** *  *  * **     *** *     * **    *  **    ******  ****  *

ARA.TH_G        AGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGA
RAT.RAT.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
                 * * *  *    ***  **    ** ******     * ******  ** * **** * 

ARA.TH_G        CGGACAACG---GTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCT
RAT.RAT.        GGGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTC
                 ***   **   **     *****   * ****   *** *  *        * ****  

ARA.TH_G        TGAACCACCATTTT
RAT.RAT.        TCTT----------
                *             

[Download ClustalW]

#716

Mean pairwise ID: 46.50%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGT-----GGGGACTATAAGATGGTGGAA
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
                * ** **   **  ** * ** ****  ** **      ***      * *  ** *** 

ARA.TH_G        CACTGGATCGGCCCACGGGTCGGATTTGTTGTTGGC-ATAGGTCTGGACTGCCCAATCCA
ORI.CUN.        CGCTTGA--GTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTA
                * ** **  * **    * ** *   *** **  ** **     * *  ** **   * *

ARA.TH_G        AGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTG
ORI.CUN.        AGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
                ** *  *  * **     *** *     * **    *  **    ******  ****  *

ARA.TH_G        AGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGA
ORI.CUN.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
                 * * *  *    ***  **    ** ******     * ******  ** * **** * 

ARA.TH_G        CGGACAACG---GTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCT
ORI.CUN.        GGGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCTGTC
                 ***   **   **     *****   * ****   *** *  *        * ** *  

ARA.TH_G        TGAACCACCATTTT
ORI.CUN.        TCC-----------
                *             

[Download ClustalW]

#717

Mean pairwise ID: 46.50%


CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGT-----GAGTCAGCTTCTTGACGGTAGATAAGTGTG
TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
                 ******   ** *** * ******     ****  *    ** * *  *  * *  *  

CAE.EL_A        GATGGAGTGA-GAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTG
TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTG-CTGGCCCGCCCG---TTCCAAG
                * ** ** *  * **    *  *** ** **    ** **    ** ***    ***  *

CAE.EL_A        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGG
TRI.AE_A        TTGCGTAGTGGACCGCCTGGGGCTTATG--CGAAAGCTGGGT--CTCACGGTCCATAATG
                    *   *    * ** **** * *    ** ***  ** *    *  *** ***** *

CAE.EL_A        AGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
TRI.AE_A        TGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGT
                 * *  * *  *     * * *     *   *****  * **  * **** *    * **

CAE.EL_A        GGCCGGAC--CGCGCTTGTGAGTTGACACACATACGCAGCCTTCTCG---ATACCTTCAG
TRI.AE_A        GGAAGGATAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCAG
                **  ***    * **   **   *   *  *  *    ****    *   *  **  ***

CAE.EL_A        ACCACTTATCATTT
TRI.AE_A        ACCACC--------
                *****         

[Download ClustalW]

#718

Mean pairwise ID: 46.50%


TET.THE.        -GCCAGGGTAGCAATAC-CTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGAT
TRY.BR_A        AGCCGGAGC-GCATTGCTCTGTAACCTTCGGGGGC-TGATCCCGCTTAGCGGGGACGTCT
                 *** * *  *** * * ****  *  *  * *** * * *    *  *  * **    *

TET.THE.        AGGATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGAGTT
TRY.BR_A        TGGACAAGCGGGGGTTCTGTTGC-GTTGACTTGGTGT---TCTGCTT--GGTTGCGTGTC
                 *** * * * *  *  **   * ***  **  * **    * ***         * ** 

TET.THE.        GCTATGGTGGTAACC-TAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAGGAAACGC
TRY.BR_A        GGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTG--GGGGGAACGG
                * * * * ***  **   ***    * *     *  * * ****** *    ** **** 

TET.THE.        CTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGATAACATAC
TRY.BR_A        GTCAGGCCGGTGACGGAGCAGCCC--ACCTTGCGCACGTTCCCGTTCGAGAAGCACACCG
                 ****** **  ** ** ***     ** *  ***  ***   **   ** *  ***   

TET.THE.        TCATTAACTGTCAAACTAATCGGTTCTACTATCAAAGCCAGACATT
TRY.BR_A        AGGAGCATCTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG-
                      *       ***   **   * * * **   ** ** *   

[Download ClustalW]

#719

Mean pairwise ID: 46.51%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
TRY.BR_B        --------AGCCGGAGCGCAT-TGCTCTGTAACCTTC--GGGGGCTGATCCCGCTTAGCG
                         *  ** ***    **   *  ** ** *  ** ******  * *       

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
TRY.BR_B        GGGACGTCTTGGACAAGCGGGGGTTCTG----TTGCGTTGACTTGGTGTTC-TGCTTGGT
                *      **  *     * *** *** *     *  ** **   ***** * * **  **

FUG.RUB.        TCGGTATCGATATGGTGCTC-CTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAGGGG
TRY.BR_B        TGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGGG
                *  ** *** * * * * ** *    * **   **  *   *  * **   ***  ****

FUG.RUB.        TGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGGA
TRY.BR_B        GAAC--GGGTCAGGCCGGTGACGGAGCAGCCCAC--CTTGCGCACGTTCCCGTTGCAGAA
                   *  **  **** ***  *** *****  **   *   **  *    * ** *  * *

FUG.RUB.        TCGCGCCCGTGAATAGACGCTGTAGTT--CAACCTGAGTAACACAGCGGGACTCAGTCTT
TRY.BR_B        GCACACCGAGGAGCAT-CTCAGGACTTTGCGCCCCAAGTGTCGTCGCGAGG--CGGTTT-
                 * * **   **  *  * * * * **  *  **  ***  *   *** *   * ** * 

FUG.RUB.        T
TRY.BR_B        -
                 

[Download ClustalW]

#720

Mean pairwise ID: 46.51%


TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
LEP.COL.        GCCGGAGCC--TTGC-----TCTGTAACCT--TCGGGGGCTTTCACCAGCTGAACAGGGA
                 ***    *  ****       *******     ****** ** *   * **   * *  

TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGT-TG
LEP.COL.        GCTGTCTGG--ACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTG
                * ***   *   *  ** * *  **  ** *    **  *    ** *        * **

TRI.AE_A        CGTAGTGGACCGCCTGGGGCTTA--TGCGAAAGCTGGGTCTCACGGTCCATAATGTGGCA
LEP.COL.        TGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAG-A
                 ** *  * ** ** ** **     ***  ***  * *   * *   *  *** ** * *

TRI.AE_A        GGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG
LEP.COL.        GGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCACCTCGCGCACGTCTGCCGTTGCAGA
                ** ** * ** **** ***   ** *******       ** * * **   ** ** *  

TRI.AE_A        GATAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCAGACCAC
LEP.COL.        ACCAC---ACCGCGGAGCCTGTCA-TCACCTGCGCCC--CAGGCGATCCTGTGAAGCTTT
                   *     **** *  *   *    **  ** ***   *** * *  *    *  *   

TRI.AE_A        C
LEP.COL.        -
                 

[Download ClustalW]

#721

Mean pairwise ID: 46.52%


ORY.SA_B        GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATGC
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                 ******   ** ***   ****** *  *        *     ** **    ****** 

ORY.SA_B        CTGGTCGTTTGCGCTTGGGGTCTGCGCCTGTGGTTTGCACTAT--GCGGCCCGCCCGTTC
CAE.EL_C        A-----GTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGC
                      **  * *   * *  *** *  *** ***  **   *   * *  ** **** *

ORY.SA_B        CAAGT--TGCGTAGCGTGTGTGGGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCACCTAG
CAE.EL_C        CAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGG-TCAGTCCCGGGTGCATAAGG
                ****   *****  *  * *   * *    **  ** ** **   *     ****    *

ORY.SA_B        AGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCTTCCAACG
CAE.EL_C        AGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGA-CAAAAGCCACCGCGCGGT----GCA
                ***** ** *  * *  **        *  **** **      ***** ** *     * 

ORY.SA_B        GTGGAAGGATAACGGGCCGCTGCAGCCCTG-GCCCGCTTCCGGCCCAAGTGCCTTCCATG
CAE.EL_C        GTGGCCGGACAGCGCTTGTGAGTTGACACGTATACACAGCCTTCTCAA-TACCTTC--AG
                ****  *** * **       *  * *  *    * *  **  * *** * *****   *

ORY.SA_B        GCAGACCACCACCTTT
CAE.EL_C        ACCACTTGTCACT---
                 *       ***    

[Download ClustalW]

#722

Mean pairwise ID: 46.53%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
TRY.BR_A        AGCCGGAGCG-CATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-GTCT
                 ***  ***  * * *  ********   * ***   **   *   *  *   *  *  *

HUM.LU_B        CAGCCCAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCGGGA
TRY.BR_A        TGGACAAGCGG---GGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGT
                  * * ** **   **** * **        ***  ** *****    *        ** 

HUM.LU_B        GTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGGGCAAT
TRY.BR_A        GTTGAGGTCGCCA--CTGTAGAGAGGC---GTTCTCGC-GCCGTTAAAGTGGGGGG-AAC
                **** * *       ***     ****   * *  *** **   ** ***** *** ** 

HUM.LU_B        GCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAGGATAAC
TRY.BR_A        GGGTCAGGCCGGT--GACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTCGAGAAGCAC
                * ** **** ***   ** *******  * ****  *** *    * **   ** *  **

HUM.LU_B        GGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACCATTTCC
TRY.BR_A        ACCGAGGAGCATCTCAGG--ACTTTGCGCCCCAAGTGTCGTCGCGAGGCGG---------
                     ** **  **  *   **  **  * *      *       *  ***         

HUM.LU_B        TTT
TRY.BR_A        ---
                   

[Download ClustalW]

#723

Mean pairwise ID: 46.56%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTAC-----TTGGAGGCTTGGGCTGTCG
                **** ** * ** *** * ******** ***           *  ***     ** *  *

ORY.SA_A        TTTGGTGTGGATTCTGA--TCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGT
XEN.LAE.        GATCGCTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATG---TCGATCGGGTGTCCGC
                  * *  **  * * *   * ******  **    * * *    * * * *  ** *** 

ORY.SA_A        TCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGC
XEN.LAE.        ACTAAGTTCGGTATCAATATGGT---GTTCCTGGGGGAGCCTCGGATCACCAGGTT--GC
                 * *****  ***       **    * *   * *   ****  * *   *   *   **

ORY.SA_A        CCTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
XEN.LAE.        TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC
                 **** * **   * ** *    ***  **    ** ******     *   ****   *

ORY.SA_A        CATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTC
XEN.LAE.        GATCAGTAGTGGGAT--CGCGCCTGTGAATAGCCGGTGCAGAAC-AGCCTGAA----CAA
                 *** ** *  ****  *  **   ** *     **  *    *  ***   *    *  

ORY.SA_A        TACAACAGACCACCATCTTT
XEN.LAE.        CACAGCGAGACACAGTTCT-
                 *** *    ***  *  * 

[Download ClustalW]

#724

Mean pairwise ID: 46.58%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGGGCATTAAGGT-GGTGTGGATGT
TRY.BR_A        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                    ***      **       ********  * ***   **   * *  * * *** **

ZEA.MA_F        TTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCCAAG
TRY.BR_A        CTTG-GACAAGCGGGGGTTCTG---TTGCGT---TGACTTGGTGTTCTGCTTG------G
                 *   ***       **  ***   ***  *     *** *  *  ****  *      *

ZEA.MA_F        TTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGAC-CTGAAGCGGCA
TRY.BR_A        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG
                ***  *** * ** ** **      *    *   **   ***   * *  * *** **  

ZEA.MA_F        GGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTGGGA
TRY.BR_A        GGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCAC-CTTGCGCACGTTC--CCGTTCGA
                ** * ** ** **** **  * ** *******   * ** ** * * * *  * **  **

ZEA.MA_F        GGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGACCAC
TRY.BR_A        GAAGCACACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCG-AGGCGG-
                * *  ***    *  ****  ** * *    *  * **  **  ** *     ** *   

ZEA.MA_F        CATCTTT
TRY.BR_A        -------
                       

[Download ClustalW]

#725

Mean pairwise ID: 46.58%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGGGCATTAAGGT-GGTGTGGATGT
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGT
                    ***      **       ********  * ***   **   * *  * * *** **

ZEA.MA_F        TTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCCAAG
TRY.BR_B        CTTG-GACAAGCGGGGGTTCTG---TTGCGT---TGACTTGGTGTTCTGCTTG------G
                 *   ***       **  ***   ***  *     *** *  *  ****  *      *

ZEA.MA_F        TTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGAC-CTGAAGCGGCA
TRY.BR_B        TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGTTAAAGTGGGG
                ***  *** * ** ** **      *    *   **   ***   * *  * *** **  

ZEA.MA_F        GGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTGGGA
TRY.BR_B        GGAACGG-GTCAGGCCGG--TGACGGAGCAGCCCAC-CTTGCGCACGTTC--CCGTTGCA
                ** * ** ** **** **  * ** *******   * ** ** * * * *  * ** * *

ZEA.MA_F        GGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGACCAC
TRY.BR_B        GAAGCACACCGAGGAGCATCTCAGGACT--TTGCGCCCCAAGTGTCGTCGCG-AGGCGGT
                * *  ***    *  ****  ** * *    *  * **  **  ** *     ** *   

ZEA.MA_F        CATCTTT
TRY.BR_B        TT-----
                       

[Download ClustalW]

#726

Mean pairwise ID: 46.60%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCA-TGTGGGGACATTAAGATGGTGGGACACT
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *    ****** *  **   *   ***  **     *** *     

ARA.TH_F        GGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCAAGC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 **  *       *    *  * **  ** * * * **         * **   ******

ARA.TH_F        TGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCT-TGGCTTGCAGGTTCTAGAGTCGGAGG
CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAG-----GA
                  *  ** *  ** *   *  **   ******  *   *  * *** *   **     * 

ARA.TH_F        GTAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACTTCCCGCTTACAGCAGTGGAC
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGCC
                **  **  **   * **    * **  *****  *  *    **** *   ******* *

ARA.TH_F        GGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAAC
CAE.EL_D        GGACCGCGCTTGTAAGTTGA-CACACATAC-ACAGCCTTCTCGAT-ACCTTCAGACCACT
                *** * ** **    ** *  ** *   ** *  **** ** *       *** *  *  

ARA.TH_F        CACCATTTT
CAE.EL_D        TATCATTT-
                 * ***** 

[Download ClustalW]

#727

Mean pairwise ID: 46.60%


ZEA.MA_B        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGCT
TRI.AE_C        ------------------------------------------------------------
                                                                            

ZEA.MA_B        TTGCGATGGTTTCTGGGCCTGGGCTCGTTGTGACTCTAGCCGGCTTGCCCATCCCAAGTT
TRI.AE_C        --------------------------------------GGTGGTCTGCCCGTTCCAAGTT
                                                      *  **  ***** * *******

ZEA.MA_B        G-GTAGTGTCTGAC--GGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTACAGCGGC
TRI.AE_C        GAGTAGTGGACCGCTTGGGGCCTATGCGAAAG--TTGGGCCTCACGGTCCATAATGTGGC
                * ******     *  *****    *******  ***** ***      * **  * ***

ZEA.MA_B        AGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTTCCAACGGTGGG
TRI.AE_C        AGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACT-GCCCGCTTCCAACGGTGGA
                *** *  **** ***********************  *** **** ************* 

ZEA.MA_B        AGGATAACAAGCCGCTGCACTTTGAGCCCAACACAGACCCAGATCCTCTCTTAGCAAACC
TRI.AE_C        AGGATAACGGGCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGA-CC
                ********  ***********   ** **      * * *  * ***     *** * **

ZEA.MA_B        ACCATCTTT
TRI.AE_C        ACCATC---
                ******   

[Download ClustalW]

#728

Mean pairwise ID: 46.60%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCTTTCACCAGCTGAACAGGG
                          * * * * *   ***** *    * * *   *   *   * **** *  *

LYC.ES_A        GGCTTT----ACCAGAAGGTTGGGCTTGGTGGGCTTA-GTTCTGGCCTGCCCTGTCCAAG
LEP.COL.        AGCTGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGTGT
                 *** *    ***** *    * *****  * * * * **  **  ****   *      

LYC.ES_A        CACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGG-GCTTCTTGATTCCTAAAGTGGG
LEP.COL.        GTCGGAG--GCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGTTAAAGTAGA
                  * ***  *  **  *  ****   ** * *   ** **  *        ****** * 

LYC.ES_A        GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTC-TGTGCAGTGGAA
LEP.COL.        G-GAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCAC-CTCGCGCACGTCTGCCGTTGCA
                * * ** *  * **** ***   ** ******   ** *** *** * * *** ** * *

LYC.ES_A        GGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAAACA
LEP.COL.        GAACCACACCGCGGAGCCT-GTCA---TCACCTGCGCCCCAGGCGATCCTGTGAAGCTTT
                * *  *     *** * **  ***   ***    ****  * * * * **   *      

LYC.ES_A        ACCACCTTT
LEP.COL.        ---------
                         

[Download ClustalW]

#729

Mean pairwise ID: 46.62%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTG---GGGACTATAAGATGGTGGAACA
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
                * ** **  ***  ** * ** ***** ***  *    **     *  * **  *** * 

ARA.TH_G        CTGGATCGGCCCACGGGTCGGATTTGTTGTTGGCATAGGTC--TGGACTGCCCAATCCAA
XEN.LAE.        CTTGA---GTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAA
                ** **   * *** * **            **   ** ***  * *  ** **   * **

ARA.TH_G        GCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTA-AAGGTTG
XEN.LAE.        GTTCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGG
                * *  *  * **     **  **  * * **  * *   *    *******  ****  *

ARA.TH_G        AGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGA
XEN.LAE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGT
                 * * *  *    ***  **    ** ******     * * ****  *  * **** * 

ARA.TH_G        CGGACAACGGTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTTGA
XEN.LAE.        GGGATCGCG--CCTGTGAATAGCCGGTGCAGAACAGCCTGA------ACAACACAGC-GA
                 ***   **   *   *     *   * **  *  * * *         *** *    **

ARA.TH_G        ACCACCATTTT
XEN.LAE.        GACACAGTTCT
                  ***  ** *

[Download ClustalW]

#730

Mean pairwise ID: 46.62%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGT----GAGGGTA--TCAAAGTGGTTGA
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
                **** ** * **  **   *  * * * ***  *    ** ****  * *  **** ** 

CIN.HYB.        ACTTTGAGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCA
CAE.EL_C        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCG-ACCGAGC--GTCCGTGCCA
                * *  ***   *  *    *   **    ***  **  ** ***  **  * **** ***

CIN.HYB.        AGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCG
CAE.EL_C        AGCGCTGCGTCACCAGGGGATGACTGTCGGAAGAT--GGTCAGTCCCGGGTGCATAAGGA
                **    * **        * *  ***   ****    **    *    * *  * **   

CIN.HYB.        GGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGG
CAE.EL_C        GTGGTGGATGGTTCAGGACCGAAAGGTAGCAG-ACAAAAGCCACCGCGCGGTG-CAGTGG
                * **   ***  * ***   *      **     * *** ** *  *     * * ****

CIN.HYB.        AAGGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGC-CCAACAGGA
CAE.EL_C        CCGGACAGC--GCTTGTGAGTT---GACACGTATACACAGCCTTCTCAATACCTTCAGAC
                  ***   *  **  * * **    * * * ****  ******    *   **  ***  

CIN.HYB.        CACCCATTT--
CAE.EL_C        CACTTGTCACT
                ***   *    

[Download ClustalW]

#731

Mean pairwise ID: 46.62%


ZEA.MA_A        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGCT
TRI.AE_C        ------------------------------------------------------------
                                                                            

ZEA.MA_A        TTGCGATGGCTTTCTGGGCCCTGGGCTCGTTGTGACACTGGCCGGCTTGCCCATCCCAAG
TRI.AE_C        ----------------------------------------GGTGGTCTGCCCGTTCCAAG
                                                        *  **  ***** * *****

ZEA.MA_A        TTG-GTAGTGT-CTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTGCAGACCTGGAGCG
TRI.AE_C        TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAG--TTGGGCCTCACGGTCCATAATGTG
                *** ******  * * * *****    *******  ***** ***      * *   * *

ZEA.MA_A        GCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCCCAACGGTGG
TRI.AE_C        GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG
                ***** *  **** ***********************  ******  ** **********

ZEA.MA_A        GAGGATAACGAAGCCGCTGCACTTTGAGCCTAACTCAGGCTCAGAACCTCACTAAGCAAA
TRI.AE_C        AAGGATAACGG-GCCGCTGCACTCCTAGGCCGCTTGGGCCTCGTAGCCTACTCCAGCGA-
                 *********  ***********   ** *    *  * ***  * ***     *** * 

ZEA.MA_A        CCACCATCTTT
TRI.AE_C        CCACCATC---
                ********   

[Download ClustalW]

#732

Mean pairwise ID: 46.62%


HUM.JA_B        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTA
XEN.LAE.        GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
                    ***   *   **** ******** ***  *    * * *   *   **     *  

HUM.JA_B        GTTCGGCCCATTGGATCGGATCCAGTGTTAGCTGC-TTGCTGGGCTGCCCATTCCAAGCC
XEN.LAE.        CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGTT
                 **  * ***   * ** *  *     * ****   * * * ** ** **   * ***  

HUM.JA_B        GAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCT--CCTAAAGCGGAG
XEN.LAE.        CGGTATCAATATG-GTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGGGG
                  *  *  *  ** ***  ** *  * **    ** *      * *   **** * ** *

HUM.JA_B        GGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGAAG
XEN.LAE.        TGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGG
                 * *  *    ***  **    ** ******    ** * ****  *    **** *  *

HUM.JA_B        GATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGGAC
XEN.LAE.        GAT--CGCGCCTGTGAATAGCCGGTGCAGAACAGC---CTGAACAA---CACAGCGAGAC
                ***  ** *** ***       *   **  *  *    **** *     *  *    ***

HUM.JA_B        -CATTTCTTTT
XEN.LAE.        ACAGTTCT---
                 ** ****   

[Download ClustalW]

#733

Mean pairwise ID: 46.62%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATG----TGGGGACATTAAGATGGTGGGAC
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGC--CGGAGG
                * ** **   **  *    ** ****  **  *    * ****   * **     **   

ARA.TH_A        ACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCA
ORI.CUN.        ATCGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTA
                *  * **  ** *    * ** *  ***  *** ** ***    *  * ** **   * *

ARA.TH_A        AGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCG
ORI.CUN.        AGTTCGGCATCAATA-TGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
                ** *  *  * * ** ** ***  *    * **    **  **    * * *   **  *

ARA.TH_A        GAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGG
ORI.CUN.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
                * * * *  *    ***  **    ** ******     *  *****     * **** *

ARA.TH_A        ACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGA
ORI.CUN.        TGGGATCGCGCCTGTGAATAGCCACTG--CACTCCAGCCTG--GG--CAACATAGCGAGA
                  ***** **  *  *  * **       ****   *****  **  * *  *     **

ARA.TH_A        ACCACCATTTT
ORI.CUN.        CCCTGTCTCC-
                 **    *   

[Download ClustalW]

#734

Mean pairwise ID: 46.62%


HUM.LU_C        ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGAACTT
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
                   ** *   *   *  *  ******  ** **      ** * *  *     ***   *

HUM.LU_C        TGGGTCAACCCAGTGGTNCGGGNC--CAGTGCTAGCTGCTTACCCGGCTGCCCATTCCAA
CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATC-GGGTGTCCGCACTAA
                 *  * * *****  ** * ** *  ******    ***  * * ** ** **   * **

HUM.LU_C        GCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCACT-CCTAGACTGGA
CAN.SPE.        GTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
                *   **        **  *  *    * **  *         *    * ****    ** 

HUM.LU_C        GGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCGGCAGTGGAA
CAN.SPE.        GTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTG
                * * *  *    ***  **    ** ******     * ******  **   **** *  

HUM.LU_C        GGATAACGGGCCGGTGCGCCTTGAGCCAACACTGTTCAACTGGGCTGACTCTTAATAGGA
CAN.SPE.        GGAT--CGCGCCTGTGAAT----AGCCACTGCACTCCAGCCTG--TGCAACATAGCGAGA
                ****  ** *** ***       *****   *  * ** *  *  **   * **    **

HUM.LU_C        CCATTTCTTTT
CAN.SPE.        CCCCGTCTCT-
                **   *** * 

[Download ClustalW]

#735

Mean pairwise ID: 46.62%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCATG----TGGGGACATTAAGATGGTGGGAC
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGA-
                * ** **   **  *    ** ****  **  *    * ****   * **   *  *** 

ARA.TH_A        ACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCA
CAN.SPE.        -TCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                   * **  *  *    * ** *  ***  *** ** ***    *  * ** **   * *

ARA.TH_A        AGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCG
CAN.SPE.        AGTTCGGCATCAATA-TGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
                ** *  *  * * ** ** ***  *    * **    **  **    * * *   **  *

ARA.TH_A        GAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGG
CAN.SPE.        GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAG
                * * * *  *    ***  **    ** ******     *  *****     * **** *

ARA.TH_A        ACGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGA
CAN.SPE.        TGGGATCGCGCCTGTGAATAGCC----ACTGCACT--CCAGCCTGTGCAACATAGCGAGA
                  ***** **  *  *  * **     **  *  *  ** **  ** * *  *     **

ARA.TH_A        ACCACCATTTT
CAN.SPE.        CCCCGTCTCT-
                 **    * * 

[Download ClustalW]

#736

Mean pairwise ID: 46.65%


ARA.TH_G        GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACACTG
TET.ROS.        -----GCCAGGGTAGCAATGCCTGTGACCTC-GTGTGGCATAAACAATGTAGTTAGAATA
                     ** * *  *  *  ** *** ***   *** **  ** *  ***  *  * * * 

ARA.TH_G        GATCG-GCCCACGGGTCGGATTTGTTGTTGGCATAGGTCTGGACTGCCCAATCCAAGCTG
TET.ROS.        GTCAGAGTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTG---TGCCCGTTCCAAACAG
                *   * *     * **  ***  *    *    ** *  **   *****  ***** * *

ARA.TH_G        TGAGTGA--ACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCTAAAGGTTGAGG
TET.ROS.        TGAGTTGCTATGGTGGAAACCTAGTAATAG--GACTTCACCAGGGCATTAAAGAGCTGAG
                *****    *  **   **** **  *  *     * *    **    *****      *

ARA.TH_G        GTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCAGCAGTGGACGG
TET.ROS.        GAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGG
                * *  ** * ********   ***** *** **  ** * *****    *  ***** **

ARA.TH_G        ACAACG-----GTTCGACGCCACACAAATCCACTATGGTCCGCTGGCTCGTAACCCGCTT
TET.ROS.        ATAACATACTCATTAACTGTCAAGCTAATCGGTTCTGCTATTCTGATCAGACACT-----
                * ***       **    * **  * ****   * ** *   ***    *  **      

ARA.TH_G        GAACCACCATTTT
TET.ROS.        -------------
                             

[Download ClustalW]

#737

Mean pairwise ID: 46.65%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *  * ****** *  **  *         *****    *   *  *

ARA.TH_E        GTTCGGGTCCACGGGCCGGT-TCTGTTGTTGGC-ATGTTTCTGGGCTGCCCAGTCCAAGC
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                  *  *       * ** ** * *** **** * * **     *   * **   ******

ARA.TH_E        ----TGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTG
CAE.EL_A        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG-CATAAGGAGTCG
                     ** *  * *   *   ****    *  ** * * * *    * * *    *** *

ARA.TH_E        GAGGGTAATGCGTGA--GGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGT
CAE.EL_A        T-GGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGA-------CCGCGTGGTGCAGT
                  ** *  * *  **  *   ***  ** * *  *****       **** *   *****

ARA.TH_E        GGACGGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATAT
CAE.EL_A        GGCCGGACCGCGCTTGTGAGTTGA-CACACATACGCAGCCTTCTCGATAC--CTTCAGAC
                ** **** * *  **  * ** *  ** *   **   * * *   * * *    *** * 

ARA.TH_E        GAACCACCATTTT
CAE.EL_A        CACTTATCATTT-
                 *   * ***** 

[Download ClustalW]

#738

Mean pairwise ID: 46.65%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATG----TGGGGACATTTAGATGGTGGAAC
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGA-
                * ** **   **  *    ** ****  **  *    * ****   * **   *  * * 

ARA.TH_E        ACTGGTTCGGGTCCACGGGC-CGGTTCTGTTGTTGGC-ATGTTTCTGGGCTGCCCAGTCC
GAL.GAL.        --TCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCT
                  * * * * * *** * *  * *  ***  **  ** ***      **  * **   * 

ARA.TH_E        AAG-CTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTT
GAL.GAL.        AAGGCCGGCATCAATATG-GTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGA
                *** * *  *  ** * * *** * *  * * ** *  *** **   ** * *  ***  

ARA.TH_E        GGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTG
GAL.GAL.        GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTA
                ** * * *  *    ***  **    ** ******     *  *****       **** 

ARA.TH_E        GACGGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCT-GCTGGTCCGATCTCATAT
GAL.GAL.        ACGGGATCGCGCCT-------GTGAATAGCCACTGCAGCGTAGCCTGGGCAACATAGCGA
                   ***** *   *       *   * * *****   ** * **  *  * *  *     

ARA.TH_E        GAACCACCATTTT
GAL.GAL.        GACCCTGTCTCC-
                ** **    *   

[Download ClustalW]

#739

Mean pairwise ID: 46.65%


ARA.TH_D        GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGT----GGGGACAATAAGGTGGTGGAAC
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  ** * ********  *   *    *  *  *   * ***  *    

ARA.TH_D        AGTGGTTCAATTCCTCGGGTCGGACCTGATGCTGACATATATCTGAGCTGCCCAGTCCAA
CAE.EL_B        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGT-CGACCGAGC-GTCCGTGCCAA
                ****     *    **  **       * **   ** *    * **** * **   ****

ARA.TH_D        GCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCTAAAGTCGGA
CAE.EL_B        GCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG-----
                **  ** ** * * * *   * * * ** * * * * *     *** * *  ***     

ARA.TH_D        GGGTAATGCGTGAGGCTGGTTTCACAG--AGCAGCGACTACTTCCCTCTTACAGCAGTGG
CAE.EL_B        GAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGG
                * **  **  **   * **    * **  *****  *  *    ** *     *******

ARA.TH_D        ATGGATCATAGTTCGAAGTCTCTCAGATCCACTATGGCCCGCTGGTTCGATCTCTCCTGG
CAE.EL_B        CCGGACTGCGCTTGTGAGTT-----GACACG-TATACACAGCCTTCTCAATACCTTC-AG
                  ***      **   ***      **  *  ***   * **    ** **  ** *  *

ARA.TH_D        ACCACCACTTT--
CAE.EL_B        ACCACTTGTTTTT
                *****   ***  

[Download ClustalW]

#740

Mean pairwise ID: 46.65%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACACTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *  * ****** *  **  *         *****    *   *  *

ARA.TH_E        GTTCGGGTCCACGGGCCGGT-TCTGTTGTTGGC-ATGTTTCTGGGCTGCCCAGTCCAAGC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                  *  *       * ** ** * *** ** * * * **     *   * **   ******

ARA.TH_E        ----TGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTG
CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG-CATAAGGAGTCG
                     ** *  * *   *   ****    *  ** * * * *    * * *    *** *

ARA.TH_E        GAGGGTAATGCGTGA--GGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGT
CAE.EL_D        T-GGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGA-------CCGCGTGGTGCAGT
                  ** *  * *  **  *   ***  ** * *  *****       **** *   *****

ARA.TH_E        GGACGGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATAT
CAE.EL_D        GGCCGGACCGCGCTTGTAAGTTGA-CACACATAC-ACAGCCTTCTCGAT-ACCTTCAGAC
                ** **** * *  **    ** *  ** *   ** *  **** ** *       *** * 

ARA.TH_E        GAACCACCATTTT
CAE.EL_D        CACTTATCATTT-
                 *   * ***** 

[Download ClustalW]

#741

Mean pairwise ID: 46.65%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATGTTG
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCT-----TCTTGACGGTAGATAAGTGTG
                   **** * **  ** * ****** *  **  *     * ** * *      **   **

LYC.ES_N        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_B        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *    * **    * * ** *   ***  **

LYC.ES_N        TTAGAGTTGGATCAT-GTGGCCCAATTG--AAGAAATGGAC--TACTTGATTCGTAAAGT
CAE.EL_B        CAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGA
                  ** * **  ***    **    * **     * **** *  * *  * * * *** * 

LYC.ES_N        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGTG
CAE.EL_B        GTGGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
                * ** ***  *     * * *     *   ****   * ***    *** *   ** ***

LYC.ES_N        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAA
CAE.EL_B        GCCGGACTGCGCTTGTGAGTTGAC-ACGTATA-CACAGCCTTCTCAATACCTTCAG----
                *  ***   **  *  * ***  *   **  *  *  ****  *   *  ** **     

LYC.ES_N        ACCACCATTTTT-
CAE.EL_B        ACCACTTGTTTTT
                *****   **** 

[Download ClustalW]

#742

Mean pairwise ID: 46.65%


LYC.ES_N        GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATG-TGGTGGAATGTT
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCT-----TCTTGACGGTAGATGAGTGT-
                   **** * **  ** * ****** *  **  *     * ** * * * *  ** *** 

LYC.ES_N        GGGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAG
CAE.EL_C        GGATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTG
                **   *    *** *    * * ** **  *    * **    * * ** *   ***  *

LYC.ES_N        CTTAGAGTTGGATCAT-GTGGCCCAATTG--AAGAAATGGAC--TACTTGATTCGTAAAG
CAE.EL_C        CCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGG
                *  ** * **  ***    **    * **     * **** *  * *  * * * *** *

LYC.ES_N        TGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGT
CAE.EL_C        AGTGGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGT
                 * ** ***  *     * * *     *   ****   * ***    *** *   ** **

LYC.ES_N        GGAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTA
CAE.EL_C        GGCCGGACAGCGCTTGTGAGTTGAC-ACGTATA-CACAGCCTTCTCAATACCTTCAGACC
                **  *** * **  *  * ***  *   **  *  *  ****  *   *  ** **    

LYC.ES_N        AACCACCATTTTT
CAE.EL_C        ACTTGTCACT---
                *     ** *   

[Download ClustalW]

#743

Mean pairwise ID: 46.67%


TRI.AE_B        NCCGAGC-TAGTTGCGGGAGCTTGTCACCCATG----TGGGGGCATTGAGGCGGTGTGGA
RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGG----ACAGA
                 *** **   ** ***   ** ***   **  *    * ***    *****       **

TRI.AE_B        TGCTTGGTGCGGTTTGTTGGCCTGGGCTTGTGATGTAACCTTGCTGGCC---TGCCCGTT
RAT.RAT.        GGATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCG-CTATGCCGATCGGGTGTCCGCA
                 * * * *   **      *    **  ***  **   *  *** *  *   ** ***  

TRI.AE_B        CCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGG---CCTTAA
RAT.RAT.        CTAAGTTCGGCATCAATATGGTGACCTCC-CGGGAGCGGGGGACCACCAGGTTGCCTAAG
                * ***** *   *      **** *     **  ***   *      ****   *** * 

TRI.AE_B        GTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAG-CGACAACTGCCGCTTCCAACGG
RAT.RAT.        GAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAG
                * **   * ***     ***  **    ** ******   * **** ***     * * *

TRI.AE_B        TGGAAGGATAACAGGCCGCTGCAGCATGGGCCCGCTCTGGGCCTCCTACCCCGCCATAGC
RAT.RAT.        TAGTGGGATCGC--GCCTGTGAATAGCCACTGCACTCCAG----CCTGGGC-AACATAGC
                * *  ****  *  ***  ** *         * ***  *    ***   *   ******

TRI.AE_B        AGACCACCATCTTT-
RAT.RAT.        GAGACCCCGTCTCTT
                    * ** *** * 

[Download ClustalW]

#744

Mean pairwise ID: 46.67%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGTGGATGC
CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ******   ** *** * ****** *  *        * *  **     ********* 

ZEA.MA_C        TTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCC---TGCCCGTTCCA
CAE.EL_B        --AGTGAGAGGAGGAGTCCTGTGTATGTCGT-TGTCAACGTCGACCGAGCGTCCGTGCCA
                   **     *      **** **   * ** ** *   ** * **    * **** ***

ZEA.MA_C        AGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGGACCTATAGTG
CAE.EL_B        AGCGCTGCGTCACCAGGGGATGACTGTCGGAAGA---TGGTCAGTCCCGGGTGCATA---
                **      **  **   *** *  **   * **    *** *   *  **    ***   

ZEA.MA_C        GCAGGAACGGCGTGAGGCT-GTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTG
CAE.EL_B        --AGGAGTGGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGC--GCGGTG
                  ****  ** *   ** *      *  *  * ***   **    *  *      *****

ZEA.MA_C        GAAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAG-C
CAE.EL_B        CAGTGGCCGGACTGCGCTTGTGAGTTGACACGTATA---CACAGCCTTCTCAATACCTTC
                 *  *     *   * **   *  * * * **  **   *  ** ****  * **    *

ZEA.MA_C        AGACCACCATTTTT-
CAE.EL_B        AGACCACTTGTTTTT
                *******   **** 

[Download ClustalW]

#745

Mean pairwise ID: 46.71%


TRI.AE_B        -NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGGCATTGAGGCGGTGTGGATGCT
LEI.MAJ.        GCCGGAGCT--CTGC-----TCTGTAACCTTCG-GGGGCTAACCAGGCTTAGCGG--GGA
                  * *****   ***       *** ***   * ****  *   ****   * **  *  

TRI.AE_B        TGGTGCGGTTTGTTGGCCTGGGCTTGTGATGTAACCTTGCTGGCCTGCCCG-TTCCAAGT
LEI.MAJ.        GGACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTCTGCTTGGCTGTGTGT
                 *  * **      *     *  ***    **   * ** **  ****  *  *    **

TRI.AE_B        TGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGCCTTAAGTGGCAGGC
LEI.MAJ.        CGGT-GTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGC---CGTTGAAGCGAGGGA
                 *** ****  **     ***  * *   *   **  * * *   * ** *   *  ** 

TRI.AE_B        ACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCCGCTTCCAACGGTGGAAGGATA
LEI.MAJ.        ACCGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCAGAATC
                ***  ** **** **    ** *******     *  *      *  * ** * ** ** 

TRI.AE_B        ACAGGCCGCTGCAGCATGGGCCCGCTCTGGGCCTCCTACCCCGCCATAGCAGACCACCAT
LEI.MAJ.        ACA--CCGCGG-AGCATGTCCGCACT-TGAGCCCCACGCTTCGTCGCG--AAGCCTT---
                ***  **** * ******  * * ** ** *** *   *  ** *     *  **     

TRI.AE_B        CTTT
LEI.MAJ.        ----
                    

[Download ClustalW]

#746

Mean pairwise ID: 46.73%


ZEA.MA_E        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                 *** *    ** *** * ** *** *  *        * *  **     *** ****  

ZEA.MA_E        TTTGC--GATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGC----GACCGAGC-GTCCGTGC
                  **   *  **  * *** *   *   ***  *   **    * ***  * * **** *

ZEA.MA_E        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.BRI.        CAAGCGCTGCGTCGCCA--GGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATA--
                ****      ** **    ** * **   *  * *    ***     ** * *    *  

ZEA.MA_E        GGCAGGAATGGCGTGAGGCT-GGCTTCACAGAGCAGCGATCACTCGCCGGCTTCCAACG-
CAE.BRI.        ---AGGAGTGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGC
                   **** *** *   ****  *   *  *  *****   **   ***  *   *   * 

ZEA.MA_E        -GTGGGAGGATAACGGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAG
CAE.BRI.        AGTGGCCGGATAGCG----------CTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGAT
                 ****  ***** **          ***         * *  ***** ****** ** * 

ZEA.MA_E        -----CAGACCACC-ATCTTT
CAE.BRI.        ACCTTCAGACCACTTGTCATT
                     ********   ** **

[Download ClustalW]

#747

Mean pairwise ID: 46.73%


ZEA.MA_D        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGG-GGCATTAAGGTGGTGCGGATTC
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                 *** *    ** *** * ** *** *  *        * *  **     *** ****  

ZEA.MA_D        TTTGC--GATGGCTTTCTGGGCCCGGGCTCGCTATGTGCCTTTGGCCGGCCTGCCCGTCC
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGC----GACCGAGC-GTCCGTGC
                  **   *  **  * *** *   *   ***  *   **    * ***  * * **** *

ZEA.MA_D        CAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCTCCAGACCTGAAGT
CAE.BRI.        CAAGCGCTGCGTCGCCA--GGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATA--
                ****      ** **    ** * **   *  * *    ***     ** * *    *  

ZEA.MA_D        GGCAGGAATGGCGTGAGGCT-GGCTTCACAGAGCAGCGATCACTCGCC--CGCTTCCAAC
CAE.BRI.        ---AGGAGTGGTGCACGGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGC
                   **** *** *   ****  *   *  *  *****   **   ***  ***      *

ZEA.MA_D        GGTGGGAGGATAACAGGCCGCTGCACTTCGAGCCCAACTCAGGCCCAGAGCCTCACTAAG
CAE.BRI.        AGTGGCCGGATA----------GCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGAT
                 ****  *****          ** ***         * *  ***** ****** ** * 

ZEA.MA_D        -----CAGACCACC-ATCTT-
CAE.BRI.        ACCTTCAGACCACTTGTCATT
                     ********   ** * 

[Download ClustalW]

#748

Mean pairwise ID: 46.73%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGA--
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGC
                        * * ***      ********   * ***    *   ** **     ***  

ORY.SA_A        TGTTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGT
LEP.COL.        TGTCTGGACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTGCTCT-GCTTGGCTGTGTGT
                *** ***    *  *  * * ** *   *  **  ** **  *** *** *  **   **

ORY.SA_A        TCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGC
LEP.COL.        CGGAGGCCTCCGGGTGCCCC--------CTTGCAGAAGGGGCGCGC----CCCCTCCG--
                   * *   *   ***  **         ***  *****     **    *  *****  

ORY.SA_A        CCTAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
LEP.COL.        -TTAAAGTAG-AGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCACCTCGCGCACGTC
                  ****** * *** ** * ** **** ***   ** *******   *   ** * * **

ORY.SA_A        CATCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGA-GTCCCT
LEP.COL.        TGCCGTTGCAGA---ACCACACCGCGG-AGCCTGTCATCACCTGCGCCCCAGGCGATCCT
                   ** ** *     * **  * ** * * * **    * * *  * *****  *  ***

ORY.SA_A        CTACAACAGACCACCATCTTT
LEP.COL.        GTGAAGCTTT-----------
                 *  * *              

[Download ClustalW]

#749

Mean pairwise ID: 46.73%


ARA.TH_C        GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACGTTG
TRY.BR_B        ----AGCCGGAGCGCATTGCTCTGTAACCTTCG-GGGGCTGATCC-----CGCTTAGCGG
                    * *       *   *   *** * *   * ** *   **        *    *  *

ARA.TH_C        GGTCGATCTCATTGGGCCGGGTTCGGGTTGGGCTATATTC-TGGCCCGCCCATTCCAAGT
TRY.BR_B        GGACGTCTTGGACAAGCGGGGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTG
                ** **   *      ** *** *   **** * *   **  **  * **    *      

ARA.TH_C        TGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCTAGAGTGGGGG
TRY.BR_B        TCGGTGTTGAGG--TCGCCACTGTAGAGAGGC---GTTCTCGCGCCGT-TAAAGTGGGGG
                * ** *******  * * *   *     ****   * ****  * * * ** ********

ARA.TH_C        AGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTGACGGTGGAAGG
TRY.BR_B        -GAACGGGTCAGGCCGGTG--ACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGA
                 ** ** ** **** ***   ** *******  ******  *** * *  * ** * ** 

ARA.TH_C        ATTACGGGCCATTGCCTTCCGAGCCCACTATGACCCAATAAGCCGCTCCGATTGGACCAT
TRY.BR_B        AGCACAC-CGAGGAGCATCTCAGGACTTTGCGCCCCAA-GTGTCGTCGCGAGGCGGTTT-
                *  **   * *    * **  **  *  *  * *****   * **   ***   *     

ARA.TH_C        CACTTT
TRY.BR_B        ------
                      

[Download ClustalW]

#750

Mean pairwise ID: 46.77%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATG----TGGGGACATTAAGATGGTGGGAC
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGA-
                * ** **   **  *    ** ****  **  *    * ****   * **   *  *** 

ARA.TH_F        ACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCA
CAN.SPE.        -TCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTA
                   * **  *  *    * ** *  ***  *** ** ***    *  * ** **   * *

ARA.TH_F        AGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCAGGTT-CTAGAGTCGG
CAN.SPE.        AGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
                ** *  *  * * **  **    *   * **  *   * *   ****** *   **  **

ARA.TH_F        AGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGA
CAN.SPE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
                 * * *  *    ***  **    ** ******     *  *****     * **** * 

ARA.TH_F        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAA
CAN.SPE.        GGGATCGCGCCTGTGAATAGCC----ACTGCACT--CCAGCCTGTGCAACATAGCGAGAC
                 ***** **  *  *  * **     **  *  *  ** **  ** * *  *     ** 

ARA.TH_F        CCACCATTTT
CAN.SPE.        CCCGTCTCT-
                **    * * 

[Download ClustalW]

#751

Mean pairwise ID: 46.77%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGGGCATTAA---GGTGGTGTGGAT
LEP.COL.        -------GCCGGAGCCTTGCTCTGTAACCTT--CGGGGGCTTTCACCAGCTGAACAGGGA
                        * * ***       ********   ******* ** *   * **    **  

ZEA.MA_F        GTTTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCG-TTCC
LEP.COL.        GCTGTCTGGACCAGCATAGG---GTGCTTGCGGCGTTGACGTGGTGCTCTGCTTGGCTGT
                * *  ***    *   * **   * *****        **  *  *  ****  *  *  

ZEA.MA_F        AAGTTGGTTGTGGCTGGTGGGGCTCGGGC-GAAGGCCTGGGCCTCTTTAGACCTGAAGCG
LEP.COL.        GTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCG--TTAAAGTA
                  ** **  *   * **  *  * *  ** *****   * *** * *  *   * ***  

ZEA.MA_F        GCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTTCCAACGGTG
LEP.COL.        G-AGGAACTGGGTCAGGCCGGC--AACGGAGCAGCCCAC-CTCGCGCACGTCTGCCGTTG
                * *** *  * ** **** ***   ** *******   * ***** * * **   ** **

ZEA.MA_F        GGAGGATAACAGGCCGCTGCATTGCAAGCCCAACTCGGTCCAGAGCCTCATTAAACAGAC
LEP.COL.        C-AGAACCACACCGCGGAGCCTGTCA---TCACCTGCGCCCCAGGCGATCCTGTGAAGCT
                  ** *  ***   **  ** *  **    ** **  * **   **     *    **  

ZEA.MA_F        CACCATCTTT
LEP.COL.        TT--------
                          

[Download ClustalW]

#752

Mean pairwise ID: 46.77%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-TGGGGGCAACAATGTGGTGGAATGTT
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
                **** **   **  ** * ** ****  ** ** *    *  *   ** **  * * * *

LYC.ES_F        GGGTCCATCTTGATGGAT--GGGCT-TGAAGGGCTAATGTTCTGGCCTGCCCTGTCCAAG
ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                 * *  *        * *  ***** *   * ****      * *  ** **   * ***

LYC.ES_F        CACAGAGTTGGGTCAAGTGGTCTATACGAAA-GTATAGCCACTTGGCC-TTTAGAGTGGG
ORI.CUN.        TTCGGCATCAA-TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGG
                  * *  *    *   ***  **    * *  *     ****  **     **  * ***

LYC.ES_F        ATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTGGAA
ORI.CUN.        GTGAACCGGCCCAGGTCGGA--AACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTG
                 ** ** *    ***  **    ** *****      *   ****  ***  **** *  

LYC.ES_F        GGATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCTAATTAAAC
ORI.CUN.        GGATCGCG--CCTGTGAATAGCCACTGC--ACTCCAGCCTG---GGCAACATAGCGAGAC
                ***** **  *  ***       * * *  **   * ****   **   * **   * **

LYC.ES_F        CATCACTTTT
ORI.CUN.        CCTGTCTCC-
                * *  **   

[Download ClustalW]

#753

Mean pairwise ID: 46.77%


ARA.TH_A        GTCGAGCTAAGTAACAATAGCTTGTAACCCA-TGTGGGGACATTAAGATGGTGGGACACT
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                  *****   **  *    ****** *  **   *   ***  **     *** *     

ARA.TH_A        GGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCAAGC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAGC
                 **  *       *    *  * **  ** * * * **         * **   ******

ARA.TH_A        TGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCTAGAGTCGGAG
CAE.EL_D        GCTACGTCACCAGGGGATAACTGTCGGAAGGC--GGTTAGTCCCGGGTGCATAA----GG
                  *  ** *  ** *   *  **   ******  ** *  * * ** *  * *      *

ARA.TH_A        GGTAATGCGTGAGGCTGGCTTCACAG--AGCAGCGACTACTTCCCGCTTACAGCAGTGGA
CAE.EL_D        AGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGGC
                 **  **  **   * **    * **  *****  *  *    **** *   ******* 

ARA.TH_A        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAA
CAE.EL_D        CGGACCGCGCTTGTAAGTTGA-CACACATAC-ACAGCCTTCTCGAT-ACCTTCAGACCAC
                **** * ** **    ** *  ** *   ** *  **** ** *       *** *  * 

ARA.TH_A        CCACCATTTT
CAE.EL_D        TTATCATTT-
                  * ***** 

[Download ClustalW]

#754

Mean pairwise ID: 46.77%


ARA.TH_F        GTCGAGCTAAGTAACAATAGCTTGTAACCCATG----TGGGGACATTAAGATGGTGGGAC
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGC--CGGAGG
                * ** **   **  *    ** ****  **  *    * ****   * **     **   

ARA.TH_F        ACTGGTTCGGTTCCTCGGATCGGTTCTGATGTGGGC-ATGTTTCTGAGCTGCCCAGTCCA
ORI.CUN.        ATCGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTA
                *  * **  ** *    * ** *  ***  *** ** ***    *  * ** **   * *

ARA.TH_F        AGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCAGGTT-CTAGAGTCGG
ORI.CUN.        AGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
                ** *  *  * * **  **    *   * **  *   * *   ****** *   **  **

ARA.TH_F        AGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGGA
ORI.CUN.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
                 * * *  *    ***  **    ** ******     *  *****     * **** * 

ARA.TH_F        CGGATCACGGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGAA
ORI.CUN.        GGGATCGCGCCTGTGAATAGCC--ACTGCACTCCAGCCTG--GG--CAACATAGCGAGAC
                 ***** **  *  *  * **       ****   *****  **  * *  *     ** 

ARA.TH_F        CCACCATTTT
ORI.CUN.        CCTGTCTCC-
                **    *   

[Download ClustalW]

#755

Mean pairwise ID: 46.79%


ZEA.MA_C        NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCG---GGGGCATTAAGGTGGTGTGGAT
FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
                 *** *  * ** *** * ** ***** ** ***    ***    * ***  *   *   

ZEA.MA_C        GCTTGGTACCGTGTCTTTGCCTGGGTTCATGGTGTGCCTTTGTTGGCCTGCCCGTTCCAA
FUG.RUB.        GCTTGAGCTCAGGAGTT--CTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAA
                *****    *  *  **  *  ** ****  *       * * * *  ** **** * **

ZEA.MA_C        GTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCCTTGG-ACCTATAGTG
FUG.RUB.        GTTCG--GTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAG
                *** *  **  *  *  *  ***   * *   **** **    **  *   ****  * *

ZEA.MA_C        GCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTATTAACGGTGG
FUG.RUB.        GGGTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCT--CAGTAG
                *   *  * *    ***  *    *  **     * *   *  *  **   *  * ** *

ZEA.MA_C        AAGGATAACAGGCCACTGCAGCATGGGCTCGCTTAAGGCCTAGACTTCATACTAAAGCAG
FUG.RUB.        TGGGATCGC--GCCCGTGAA---TAGACGC---TGTAGTTCAACCTGAGTAACACAGCGG
                  ****  *  ***  ** *   * * * *   *   *   *  **   **  * *** *

ZEA.MA_C        ACCACCATTTTT
FUG.RUB.        GACTCAGTCTTT
                  * *  * ***

[Download ClustalW]

#756

Mean pairwise ID: 46.79%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT-G
                 ****** * **   * * ****** *  **  *     * * *  ** *   * *** *

LYC.ES_I        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_A        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *    * ***   * * ** *   ***  **

LYC.ES_I        TTAGAGTTGGATCAT-GTGGCCCAATTGAAGAAATG-GACTACTT---GATTCGTAAAGT
CAE.EL_A        CAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
                  ** * *   ***    **   ** **  * ** * *  ** *    * * * *** * 

LYC.ES_I        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGTG
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                *  * ***  *     * * *     *   ****   * ***    ***     ** ***

LYC.ES_I        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAA
CAE.EL_A        GCCGGACCGCGCTTGTGAGTTGACACACATACGCA--GCCTTCTCGATACCTTCAGACCA
                *  ***   **  *  * ***  *  *     * *  ****  * * *  ** **    *

LYC.ES_I        ACCACCATTTTT
CAE.EL_A        CTTATCATTT--
                   * *****  

[Download ClustalW]

#757

Mean pairwise ID: 46.79%


HUM.JA_B        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGGACTT
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
                    ***   *   ** * *******  ** **      ** * *  *     **    *

HUM.JA_B        TAGTTCGGCCCATTGGATCGGATCCAGTGTTAGCTGC-TTGCTGGGCTGCCCATTCCAAG
CAN.SPE.        CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                   **  *****   * ** *  *    **  ***     * * ** ** **   * ***

HUM.JA_B        CCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCT--CCTAAAGCGG
CAN.SPE.        TTCGGCATCAA--TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
                    *  *  *  * **    **   **   *   **      *** *  ***** * **

HUM.JA_B        AGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGA
CAN.SPE.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
                 * * *  *    ***  **    ** ******    ** ******  **   **** * 

HUM.JA_B        AGGATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCACTGAGCTGACTCTTAATAGG
CAN.SPE.        GGGAT--CGCGCCTGTGA-----ATAGCCACTGCACTCCAGCCTG-TGCAACATAGCGAG
                 ****  ** *** ***        * ****     * **    * **   * **    *

HUM.JA_B        ACCATTTCTTTT
CAN.SPE.        ACCCCGTCTCT-
                ***   *** * 

[Download ClustalW]

#758

Mean pairwise ID: 46.79%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGT----GAGGGTA--TCAAAGTGGTTGA
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                **** ** * **  **   *  * * * ***  *    ** ****  * *  **** ** 

CIN.HYB.        ACTTTGAGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCA
CAE.EL_A        AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCG-ACCGAGC--GTCCGTGCCA
                * *  ***   *  *    *   **    ***  **  ** ***  **  * **** ***

CIN.HYB.        AGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTAGAATCG
CAE.EL_A        AGCGCTACGTCACCAGGGGATAACTGTCGGAAGGC--GGTTAGTCCCGGGTGCATAAGGA
                **      **        * *  ***   ******  ** *  *    * *  * **   

CIN.HYB.        GGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGG
CAE.EL_A        GTCGTGGATGGTTCAGGACCGAAAGGTAGCAG-ACAAAAGCGACCGCGTGGTG-CAGTGG
                *  *   ***  * ***   *      **     * *** *  *  * *   * * ****

CIN.HYB.        AAGGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGC-CCAACAGGA
CAE.EL_A        CCGGACCGC--GCTTGTGAGTT---GACACACATACGCAGCCTTCTCGATACCTTCAGAC
                  ***   *  **  * * **    * * ** ***  ******        **  ***  

CIN.HYB.        CACCCATTT---
CAE.EL_A        CACTTATCATTT
                ***  **     

[Download ClustalW]

#759

Mean pairwise ID: 46.79%


LYC.ES_I        GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATGTTG
CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATGAGTGT-G
                 ****** * **   * * ****** *  **  *     * * *  ** *  ** *** *

LYC.ES_I        GGCTGTACCAGATGGTTGGGCTTG-GTGGGCTAATTTCTGACTTGCCCTA---TCCAAGC
CAE.EL_C        GATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGC
                *   *    *** *    * * ** **  *    * **    * * ** *   ***  **

LYC.ES_I        TTAGAGTTGGATCAT-GTGGCCCAATTG--AAGAAATGGAC--TACTTGATTCGTAAAGT
CAE.EL_C        CAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGA
                  ** * **  ***    **    * **     * **** *  * *  * * * *** * 

LYC.ES_I        GGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTT-TCGCTCTAAGCGGTG
CAE.EL_C        GTGGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
                * ** ***  *     * * *     *   ****   * ***    *** *   ** ***

LYC.ES_I        GAAGGATAACGAGTCGGTGTTCTCTGAGTCCAGTAACGCCTGATGGGTTGCTCCAATTAA
CAE.EL_C        GCCGGACAGCGCTTGTGAGTTGAC-ACGTATA-CACAGCCTTCTCAATACCTTCAGACCA
                *  *** * **  *  * ***  *   **  *  *  ****  *   *  ** **    *

LYC.ES_I        ACCACCATTTTT
CAE.EL_C        CTTGTCACT---
                     ** *   

[Download ClustalW]

#760

Mean pairwise ID: 46.79%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG----TGGAGACATCAAAGTGGTTGAAT
GAL.GAL.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
                * ** **   **  **   ** **** *** **    * * **     *    *  * **

LYC.ES_J        A--TTGGGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTTCTGGCC---TGCCCTGTC
GAL.GAL.        CGCTTGAGC----CCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGC
                   *** **    **** ** *  **  **  * **    * * *  *    * **   *

LYC.ES_J        CAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGT
GAL.GAL.        TAAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGA
                 ***  * *  *           ****    **    * *  *  *  * * ***** * 

LYC.ES_J        GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG
GAL.GAL.        GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTA
                **** * ****    ***  **    ** ******   * * ******  * *  **** 

LYC.ES_J        GAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATAA
GAL.GAL.        ACGGGAT--CGCGCCTGTGAAT-AGCCACTGCAGCGTAGCCTGG-GCAACATAGCGAGAC
                   ****   * * * ***  * * * * * ***    ****   *        * * * 

LYC.ES_J        ACAACCACCTTT
GAL.GAL.        CCTGTCTCC---
                 *   * **   

[Download ClustalW]

#761

Mean pairwise ID: 46.79%


ARA.TH_E        GTCGAGCTAAGTAACATGAGCTTGTAACC-CATGTGGGGACATTTAGATGGTGGAACACT
DRO.MEL.        GACTGGAAGGTTGGCA-GCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGC
                * *  *     *  ** *    ***** * *   *  *     *  *** **** *    

ARA.TH_E        ----GGTTCGGGTCCACGGGCCGGTTCTGTTGTTGGCATGTTTCTGGGCTGCCCAGTCCA
DRO.MEL.        CTGAGGCTGGGATCTACTGCGTAGCGGACCAGCT--CATGTTGACGGAACGTCCGCACTA
                    ** * ** ** ** *    *       * *  ******   **   * **   * *

ARA.TH_E        AGCT-GTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCTAAAGTTG
DRO.MEL.        AGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGG
                **** *  *  ** * * ***        **   * ****    * *    **** *  *

ARA.TH_E        GAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACAGCAGTGG
DRO.MEL.        GATGA-ACCGGGCCAGG--GGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
                ** *  *  * *  ***  ***   *   ****** *  * ******      ***** *

ARA.TH_E        ACGGATCACAGTTTAGCGTCGCTCAGAACCACTATGGCCTGCTGGTCCGATCTCATATGA
DRO.MEL.        TGGGATAGCGTACCGGAGT------GGACTGCCGTTATCAGCCCAACCGATATGGT-TGG
                  ****  *      * **      * **  *  *   * **    ***** *  * ** 

ARA.TH_E        ACCACCATTTT-
DRO.MEL.        ACCACAATCTTT
                ***** ** ** 

[Download ClustalW]

#762

Mean pairwise ID: 46.82%


TRI.AE_A        -NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGC
LEI.MAJ.        GCCGGAGCTCTGCT--------CTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAG-
                  * ****** * *         *******   * ***   *  *   * *   *   * 

TRI.AE_A        TGTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGCCCGCCCGTTCCAAGTTG
LEI.MAJ.        -GACGTGGACCAGCGAGGGTGATTTGC-TGCGTTGACG-TGGTGCTCTGCTT---GGCTG
                 *  ** *  * *** *  ** * **  ** * *   * ***  * *   **    * **

TRI.AE_A        CGTAGTGGACCGCCTGGGGCTTATGCGAAAGCTGGGTCTCACGGTCCATAATGTGGCAGG
LEI.MAJ.        TGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAGGG
                 **   **   * ** *  *   ***  * * ***  *       ** *      *  **

TRI.AE_A        CACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGA
LEI.MAJ.        AACCGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACGTCCGCCGTTGCA-GAA
                 ** * ** **** **    ** *******     *  * * * ***  ** ** * * *

TRI.AE_A        TAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCAGACCACC
LEI.MAJ.        TCACACCGCGGAGCATGTCCG---CACTTGAGCCCCAC-GCTTCGTCGCGAAGCCTT--
                * *     **  ***   *     ** *** *** * * ** *  **  * ** *    

[Download ClustalW]

#763

Mean pairwise ID: 46.82%


HUM.JA_B        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGGACTT
ORI.CUN.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
                    ***   *   ** * *******  ** **      ** * *  *     **    *

HUM.JA_B        TAGTTCGGCCCATTGGATCGGATCCAGTGTTAGCTGC-TTGCTGGGCTGCCCATTCCAAG
ORI.CUN.        CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                   **  * ***   * ** *  *    **  ***     * * ** ** **   * ***

HUM.JA_B        CCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCT--CCTAAAGCGG
ORI.CUN.        TTCGGCATCAA--TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
                    *  *  *  * **    **   **   *   **      *** *  ***** * **

HUM.JA_B        AGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGA
ORI.CUN.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
                 * * *  *    ***  **    ** ******    ** ******  **   **** * 

HUM.JA_B        AGGATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCA--CTGAGCTGACTCTTAATA
ORI.CUN.        GGGAT--CGCGCCTGTGA-----ATAGCCACTGCACTCCAGCCTGGGCAA---CATAGCG
                 ****  ** *** ***        * ****     * **  *** **     * **   

HUM.JA_B        GGACCATTTCTTTT
ORI.CUN.        AGACCCTGTCTCC-
                 **** * ***   

[Download ClustalW]

#764

Mean pairwise ID: 46.82%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT--
                  ***** * **  ** * ****** *  **  *     * * *  ** * * * * *  

LYC.ES_A        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT--CTGGCCTGCCC---TGTCCAAG
CAE.EL_A        GGATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTG
                ** *  *     ***  * *    ***    * ***  **     * **    ****  *

LYC.ES_A        CACAGAGTTGGATC-TCGAGGCCCAAATG--AAAATATGGGC--TTCTTGATTCCTAAAG
CAE.EL_A        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGG
                *  ** * *   **  *  **   ** **    **   **    * *  * * * *** *

LYC.ES_A        TGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAG-TGAACGCTCCCGCTCTGTGCAGT
CAE.EL_A        AGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
                 *  * ***  *     * * *     *   *****   ** **  ****   *******

LYC.ES_A        GGAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATA
CAE.EL_A        GGCCGGAC--CGCGCTTGTGAGTTGACACACATA-CGCAGCCTTCTCGATACCTTCAG--
                **  ***    * *   ***  **  **     *     ****  * * *  ** **   

LYC.ES_A        AACAACCACCTTT-
CAE.EL_A        ACCACTTATCATTT
                * **   * * ** 

[Download ClustalW]

#765

Mean pairwise ID: 46.82%


FUG.RUB.        GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
LEI.MAJ.        ------------GCCGGAGCTCTGCTCTGTAACCTTC--GGGGGCTAAC-CAGGCTTAGC
                            * **     ***   *  ** ** *  ** **** *  * ***  * *

FUG.RUB.        GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTGTCCGTACTAAGT
LEI.MAJ.        GGGGAGGACGTGGACCAGCGAGGGTGATTTG-CTGCGTTGACGTGGTGCTC-TGCTTGGC
                *     *    ***     * *  * *   * **  ** **   ****  * * **  * 

FUG.RUB.        TCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAG-GGG
LEI.MAJ.        TGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAG
                *  ** *** * ***    **     *     **   * *  *  ****   * ** * *

FUG.RUB.        TGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAGTGGGA
LEI.MAJ.        GGAACCGGGTCAGGCCGGAAACGGAGCAGCCCACCCCACGCACGTC-CGCCGTTGCAGAA
                 *  ****  **** ******** *****  **   * * *  * * * * ** *  * *

FUG.RUB.        TCGCGCCCGTGAATAGACGCTGTAGTTCAACCTGAGTAACACAGCGGGACTCAGTCTTT
LEI.MAJ.        TCACACCGCGGAGCATGT-CCGCACTTGAGCCCCA----CGCTTCGTCGCGAAGCCTT-
                ** * **   **  *    * * * ** * **  *    * *  **   *  ** *** 

[Download ClustalW]

#766

Mean pairwise ID: 46.82%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT--
                  ***** * **  ** * ****** *  **  *     * * *  ** * * * * *  

LYC.ES_J        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGT--TCTGGCCTGCCC---TGTCCAAG
CAE.EL_D        GGATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTG
                ** *  *     ***  * *    ***    * **  ***     * **    ****  *

LYC.ES_J        CACAGAGTTGGATCACGAGGCCCAAAT-----GAAAATATGGGCTTCTTGATTCCTAAAG
CAE.EL_D        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGG
                *  ** * *   **** ***    **      ***         * *  * * * *** *

LYC.ES_J        TGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT
CAE.EL_D        AGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
                 *  * ***  *     * * *     *   *****  ** ***  ****   *******

LYC.ES_J        GGAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATA
CAE.EL_D        GGCCGGAC--CGCGCTTGTAAGTTGACACACATA-CACAGCCTTCTCGATACCTTCAG--
                **  ***    * *   **   **  **     *  *  ****  * * *  ** **   

LYC.ES_J        AACAACCACCTTT-
CAE.EL_D        ACCACTTATCATTT
                * **   * * ** 

[Download ClustalW]

#767

Mean pairwise ID: 46.82%


CAE.EL_C        ACCGAGCGTCGTGGCGGGCGCTTGT-----GAGTCAGCTTCTTGACGGTAGATGAGTGTG
TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
                 ******   ** *** * ******     ****  *    ** * *  *  ***  *  

CAE.EL_C        GATGGAGTGA-GAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTG
TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGC-CCGCCCGT---TCCAAG
                * ** ** *  * **    *  *** ** **    **    *  ** ***    ***  *

CAE.EL_C        CCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCG-GGTGCATAAG
TRI.AE_A        TTGCGTAGTGGACCGCCTGGGGCTTATG--CGAAAGCTGG---GTCTCACGGTCCATAAT
                    *   **   * ** **** * *    ** *** ***   *** *  *** ***** 

CAE.EL_C        GAGTGGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAG
TRI.AE_A        GTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGG
                * *    * *  *     * * *     *   *****  * **    ****      * *

CAE.EL_C        TGGCCGGACAGCG--CTTGTGAGTTGACACGTATACACAGCCTTCT---CAATACCTTCA
TRI.AE_A        TGGAAGGATAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCA
                ***  *** *  *  *   **   *   * *   *    ****      * *  **  **

CAE.EL_C        GACCACTTGTCACT
TRI.AE_A        GACCACC-------
                ******        

[Download ClustalW]

#768

Mean pairwise ID: 46.82%


ZEA.MA_F        NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGG-GGCATTAAGGTGGTGTGGATG-
CAE.BRI.        ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
                 *** *    ** *** * ** *** *   *       * *  **     ********* 

ZEA.MA_F        --TTTCCTGACGGATTCTGGGCCTGGGCTTGTATGTGCCACTGGCCGGCCTGCCCGTTCC
CAE.BRI.        AGTGAAGGGAGGAGTCCTGTG---GGTGTTGTCGGCAACGGCGACCGAGC-GTCCGTGCC
                  *     ** *  * *** *   **  ****  *   *   * ***  * * **** **

ZEA.MA_F        AAGTTGGTTGTGGCTGGTGGGGCTCGGGCGAAGGCCTGGGCCTCTTTAGACCTGAAGCGG
CAE.BRI.        AAGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAG
                ***      ** **  * **    *** ** * * ****   **    *  *  ***  *

ZEA.MA_F        CAG-GCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCC--CGCTTCCAACGG
CAE.BRI.        TGGTGCACGGCTCAGGGCCGA------AAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAG
                  * *** ***    *** *       *  *****   **   ***  ***      * *

ZEA.MA_F        TGGGAGGATAACAGGC-CGCTGCATTGCAAGCCCA-ACTCGGTCCAGAGCCTCATTAAAC
CAE.BRI.        TGGCCGGATAGCGCTTGTGAGTTGTCGCTCGCCCACAGCCTCTCTGATACCT--TCAGAC
                ***  ***** *      *     * **  ***** *  *  **     ***  * * **

ZEA.MA_F        AGACCACCATCTTT
CAE.BRI.        CACTTGTCATT---
                       ***    

[Download ClustalW]

#769

Mean pairwise ID: 46.82%


HUM.JA_B        ----GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGG--GGCATGTGGGAAATGGGACTT
RAT.RAT.        GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
                    ***   *   **   *******  ** **      ** * *  *   *  *    *

HUM.JA_B        TAGTTCGGCCCATTGGATCGGATCCAGTGTTAGCTGC-TTGCTGGGCTGCCCATTCCAAG
RAT.RAT.        CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG
                   **  * ***   * ** *  *    **  ***     * * ** ** **   * ***

HUM.JA_B        CCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCT--CCTAAAGCGG
RAT.RAT.        TTCGGCATCAA--TATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGG
                    *  *  *  * **    **   **   *   **      *** *  ***** * **

HUM.JA_B        AGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCGGCAGTGGA
RAT.RAT.        GGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGT
                 * * *  *    ***  **    ** ******    ** ******  **   **** * 

HUM.JA_B        AGGATAACGGGCCGGTGCTGCTTGGACCCACCATGGTTCA--CTGAGCTGACTCTTAATA
RAT.RAT.        GGGAT--CGCGCCTGTGA-----ATAGCCACTGCACTCCAGCCTGGGCAA---CATAGCG
                 ****  ** *** ***        * ****     * **  *** **     * **   

HUM.JA_B        GGACCATTTCTTTT
RAT.RAT.        AGACCCCGTCTCTT
                 ****   *** **

[Download ClustalW]

#770

Mean pairwise ID: 46.82%


CAE.EL_B        ACCGAGCGTCGTGGCGGGCGCTTGT-----GAGTCAGCTTCTTGACGGTAGATAAGTGTG
TRI.AE_A        NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGCT
                 ******   ** *** * ******     ****  *    ** * *  *  * *  *  

CAE.EL_B        GATGGAGTGA-GAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTG
TRI.AE_A        GTTGTAGCGCTGCGGGCCTGGTCTGGGTGTGCTACTGCTGGC-CCGCCCGT---TCCAAG
                * ** ** *  * **    *  *** ** **    **    *  ** ***    ***  *

CAE.EL_B        CCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCG-GGTGCATAAG
TRI.AE_A        TTGCGTAGTGGACCGCCTGGGGCTTATG--CGAAAGCTGG---GTCTCACGGTCCATAAT
                    *   **   * ** **** * *    ** *** ***   *** *  *** ***** 

CAE.EL_B        GAGTGGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCCACCGCGCGGTGCAG
TRI.AE_A        GTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGG
                * *    * *  *     * * *     *   *****  * **    ****      * *

CAE.EL_B        TGGCCGGAC--TGCGCTTGTGAGTTGACACGTATACACAGCCTTCT---CAATACCTTCA
TRI.AE_A        TGGAAGGATAATGGGCCGCTGCACTCCTAGGCCAATTGGGCCTCGCAGCCTACTCCAGCA
                ***  ***   ** **   **   *   * *   *    ****      * *  **  **

CAE.EL_B        GACCACTTGTTTTT
TRI.AE_A        GACCACC-------
                ******        

[Download ClustalW]

#771

Mean pairwise ID: 46.82%


LYC.ES_J        GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
CAE.EL_A        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT--
                  ***** * **  ** * ****** *  **  *     * * *  ** * * * * *  

LYC.ES_J        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGTT--CTGGCCTGCCC---TGTCCAAG
CAE.EL_A        GGATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTG
                ** *  *     ***  * *    ***    * ***  **     * **    ****  *

LYC.ES_J        CACAGAGTTGGATCACGAGGCCCAAAT-----GAAAATATGGGCTTCTTGATTCCTAAAG
CAE.EL_A        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGG
                *  ** * *   **** ***    **      ***         * *  * * * *** *

LYC.ES_J        TGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT
CAE.EL_A        AGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
                 *  * ***  *     * * *     *   *****  ** ***  ****   *******

LYC.ES_J        GGAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATA
CAE.EL_A        GGCCGGAC--CGCGCTTGTGAGTTGACACACATA-CGCAGCCTTCTCGATACCTTCAG--
                **  ***    * *   ***  **  **     *     ****  * * *  ** **   

LYC.ES_J        AACAACCACCTTT-
CAE.EL_A        ACCACTTATCATTT
                * **   * * ** 

[Download ClustalW]

#772

Mean pairwise ID: 46.82%


LYC.ES_F        GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGT----GGGGGCAAC--AATGTGG-TGG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
                 ****** * **  ** * ****** *  *   *    *  ** *    * ***** ***

LYC.ES_F        AATGTTGGGTCCATCTTGATGGATGGGCTTGAAGGGCTAATGTTCTGGCCTGCCCTGTCC
CAE.EL_D        AGTGAGAGGAGGAGTCCTGTGTATG---TCGTCGTCTACGTCGACCGAGCGTCCGTG-CC
                * **   **   *      ** ***   * *  *      *   * *  *  ** ** **

LYC.ES_F        AAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTA--TAGCCACTTGGCCTTTAGAGT
CAE.EL_D        AAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTC-CCGGGTGCATAAGGA
                **** *   **        *    ** *  *** *    *** * *  **    **  * 

LYC.ES_F        GGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTGTGCAGTG
CAE.EL_D        GTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                *   ****  *     * * *     *   ****   *  **   ****   ********

LYC.ES_F        GAAGGATCACGGGCTAGTGCTCTTTGAGTCCTAACAAAAACCTGATAGGTTGCCT-AATT
CAE.EL_D        GCCGGACCGCG--CTTGTAA--GTTGACACACATACACAGCCTTCTCGATACCTTCAGAC
                *  *** * **  ** **     ****  *  *   * * ***  * * *  * * *   

LYC.ES_F        AAACCATCACTTTT
CAE.EL_D        CACTTATCATTT--
                 *   **** **  

[Download ClustalW]

#773

Mean pairwise ID: 46.82%


LYC.ES_A        GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTT----CTTGACGGTAGATAAGTGT--
                  ***** * **  ** * ****** *  **  *     * * *  ** * * * * *  

LYC.ES_A        GGCTTTACCAGAAGGTTGGGCTTGGTGGGCTTAGT--TCTGGCCTGCCC---TGTCCAAG
CAE.EL_D        GGATGGAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTG
                ** *  *     ***  * *    ***    * **  ***     * **    ****  *

LYC.ES_A        CACAGAGTTGGATC-TCGAGGCCCAAATG--AAAATATGGGC--TTCTTGATTCCTAAAG
CAE.EL_D        CCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGG
                *  ** * *   **  *  **   ** **    **   **    * *  * * * *** *

LYC.ES_A        TGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAG-TGAACGCTCCCGCTCTGTGCAGT
CAE.EL_D        AGTCGTGGATGGTTCAGGACCGAA---AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGT
                 *  * ***  *     * * *     *   *****   ** **  ****   *******

LYC.ES_A        GGAAGGATAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAATA
CAE.EL_D        GGCCGGAC--CGCGCTTGTAAGTTGACACACATA-CACAGCCTTCTCGATACCTTCAG--
                **  ***    * *   **   **  **     *  *  ****  * * *  ** **   

LYC.ES_A        AACAACCACCTTT-
CAE.EL_D        ACCACTTATCATTT
                * **   * * ** 

[Download ClustalW]

#774

Mean pairwise ID: 46.84%


XEN.LAE.        GCC-GGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATC
TET.THE.        GCCAGGGTAGCAATACCTGTGTCTATA-TGTGGCA--TAAACAATGTAGGTTGT--GATA
                *** ***        * **** ** ** *   **   *        * ** ***  *** 

XEN.LAE.        GCTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTGTCCGCACTAAGT
TET.THE.        GATAGGATATGAGAGTTTGATGAGACAGTTTGCTAAG-----AGTGTGCCCGCTCCAAAC
                * * *  *    *****    *   ** *  **** *      * *** **** * **  

XEN.LAE.        TCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAGG-G
TET.THE.        AATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGG--GCATTAAAGAGCTA
                   *  *   ******* *      * *         *******  **  *** ***   

XEN.LAE.        GTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAGTGGG
TET.THE.        AGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGG
                  *** ** * ****  ** *** ** ****  ***    ***         ** *  **

XEN.LAE.        AT--CGCGCCTGTGAATAGCCGGTGCAGAACAGCCTGAACAACACAGCGAGACACAGTTC
TET.THE.        ATAACATACTCATTAACTGTCAA-ACTAATCGGTTCTACTATCAAAGCCAGACATT----
                **  *   *   * **  * *    *  * * *    *  * ** *** *****      

XEN.LAE.        T
TET.THE.        -
                 

[Download ClustalW]

#775

Mean pairwise ID: 46.84%


CIN.HYB.        ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGA----GGGTATCAAAGTGGTTGAAC
CAN.SPE.        GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
                 ******  ***  ***  * ** **   * **  *    **      * *  *  * * 

CIN.HYB.        TTTGAGCTTG-GCTTAGCTAGTTGGGTCTGTAG-ACACCGCACC--TGGCTTGCCCGTTC
CAN.SPE.        C----GCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCAC
                     ***** **  **    *  ** *** **  * *    **  * *  ** ***  *

CIN.HYB.        CAAGTCGAG----AGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTTA
CAN.SPE.        TAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT---GCCTAA
                 ****   *    * *  * * *  *  *  *****  **  *    * *    ** * *

CIN.HYB.        GAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGA
CAN.SPE.        GGA--GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGAT
                * *  **** * *  *    ***  **    ** **** *   *** ***     **   

CIN.HYB.        CTGTGGAAGGATTACAAGCCGGAGTGTCTTAGGCTCATATAACCAGCCTGGCTAGCCCAA
CAN.SPE.        CAGTAGTGGGATCGCGCCTGTGAATAGCCACTGCACT-----CCAGCCTGTGCAACATAG
                * ** *  ****  *      ** *  *    ** *      ********   * *  * 

CIN.HYB.        CAGGACACCCATTT--
CAN.SPE.        CGAGAC-CCCGTCTCT
                *  *** *** * *  

[Download ClustalW]

#776

Mean pairwise ID: 46.84%


HUM.LU_D        GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
CAE.EL_D        ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTG---ACGGTAGATAAG--TGTG
                  ** ** * *   ** * ** *** *  **  *    *     ** * **  *  * **

HUM.LU_D        GGTCAACCTAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCG
CAE.EL_D        GATGGAGTGAGAGGAG-GAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGC--GTCCG
                * *  *   ** ***  * **** ****  *  *    **     * **   *    ***

HUM.LU_D        GGAGTTGGGCTGAGTGACCTGGGCGAAG--GCTGGGTTGCG--CAGCTCCTAGAGTGGAG
CAE.EL_D        TGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAA
                 *    * ***  ** *** ***   *   *  **   ***   **  **  * *   * 

HUM.LU_D        GGCAATGCGTGAGGCT--GGCTTCACAG--AGCAGCGACTACCTCCCGCTCTCGGCAGTG
CAE.EL_D        GGAGTCGTGGATGGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
                **    * *   ** *  **    * **  *****  *  * *  ****     ******

HUM.LU_D        GAAGGATAACGGGCCGGTGCTACCTGGATCCACCATGCTTCACTGGGCTGACTCTTAATA
CAE.EL_D        GCCGGAC--CGCGCTTG---TAAGTTGACACAC-ATACACAGCCTTCTCGATACCT--TC
                *  ***   ** **  *   **  * **  *** ** *    *      **  * *  * 

HUM.LU_D        GGACCATTTCTTTT--
CAE.EL_D        AGACCACTTATCATTT
                 ***** ** *  *  

[Download ClustalW]

#777

Mean pairwise ID: 46.84%


HUM.LU_A        GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACTTTG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTT--CGGGGGC-------TAACCAGGCTTAG
                          * * *   *  ********     ******        **   * *** *

HUM.LU_A        GGTCAACCTAGTGGATCGGGTCCAGTG-TTAGCTGC-TTACTGGTCTGCCCATTCCAAGC
LEI.MAJ.        CGGGGAGGACGTGGACCAGCGAGGGTGATTTGCTGCGTTGACGTGGTGCTC-TGCTTGGC
                 *   *    ***** * *     *** ** ***** **   *   *** * * *   **

HUM.LU_A        CGGGAGTTGGGCTGAGTGACCTGGGCGAAG-GGCTGGGTTGCGCACGTCCTAGAGTGGAG
LEI.MAJ.        TGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGTTGAAGCGAG
                 * * ** **  **  *  **     * ** ** ***   * *  ** * * **   ***

HUM.LU_A        GGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTC-TCGGCAGTGGAA
LEI.MAJ.        GGAACCGGGTCAGGCCGGAA--ACGGAGCAGC--CCACCCCACGCACGTCCGCCGTTGCA
                ** *  * ** **** **    ** *******  * *** * *** * ** ** ** * *

HUM.LU_A        GGATAACGGGCCGGTGC-TACCTGGGTCCA----CCATGCTTCACTAGGCTGACTCTTAA
LEI.MAJ.        GAATCACACCGCGGAGCATGTCCGCACTTGAGCCCCACGCTTCGTCGCGAAGCCTT----
                * ** **    *** ** *  * *          *** *****     *  * **     

HUM.LU_A        TAGGACCATTTCTTTT
LEI.MAJ.        ----------------
                                

[Download ClustalW]

#778

Mean pairwise ID: 46.86%


ORY.SA_A        GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
LEI.MAJ.        -------GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAG--
                        * * ***      ********   * ***   ** *    * ** * *    

ORY.SA_A        TTTGGTGTGGATTCTGATCCTGGGCCCCATGTTGTTGTAATCTTGCTGGCTTGCCCGTTC
LEI.MAJ.        ---GACGTGGACC---AGCGAGGGTGATTTGCTGC-GTTGACGTGGTGCTCTGCTTG---
                   *  *****     * *  ***     ** **  **   * ** **   ***  *   

ORY.SA_A        CAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCC
LEI.MAJ.        ---GCTGTGT-GTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGC---GCGGGTCCGCCGT
                   * ** ** ** **   *    **      * **    * **   **   **** *  

ORY.SA_A        TAAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTCCA
LEI.MAJ.        TGAAGCGA-GGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCCACGCACGTCCG
                * *** *   ** ** * ** **** **    ** *******   * *  * * * *** 

ORY.SA_A        TCGGTGGAAGGATAACAGGCTGCTGCACCTTGGGCCCGCTTCTGGCCCAGAGTCCCTCTA
LEI.MAJ.        CCGTTGCA-GAATCACA--CCGCGG-AGCATGTCCGCACTTGAGCCCCACGCTTCGTC-G
                 ** ** * * ** ***  * ** * * * **  * * ***  * ****   * * **  

ORY.SA_A        CAACAGACCACCATCTTT
LEI.MAJ.        CGA-AGCCTT--------
                * * ** *          

[Download ClustalW]

#779

Mean pairwise ID: 46.86%


HUM.LU_B        GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACATTGGGT
TRY.BR_B        AGCCGGAGCG-CATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGAC-GTCT
                 ***  ***  * * *  ********   * ***   **   *   *  *   *  *  *

HUM.LU_B        CAGCCCAGTGGATCGGGTCCAGTGTTAGCTGCTTACTGGTCTGCCCATTCCAAGCCGGGA
TRY.BR_B        TGGACAAGCGG---GGGTTCTGTTGCGTTGACTTGGTGTTCTGCTTGGTTGCGTGTCGGT
                  * * ** **   **** * **        ***  ** *****    *        ** 

HUM.LU_B        GTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCTAGAGTGGAGGGCAAT
TRY.BR_B        GTTGAGGTCGCCA--CTGTAGAGAGGC---GTTCTCGC-GCCGTTAAAGTGGGGGG-AAC
                **** * *       ***     ****   * *  *** **   ** ***** *** ** 

HUM.LU_B        GCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCCGGCAGTGGAAGGATAAC
TRY.BR_B        GGGTCAGGCCGGT--GACGGAGCAGC--CCACCTTGCGCACGTTCCCGTTGCAGAAGCAC
                * ** **** ***   ** *******  * ****  *** *    * ** * ** *  **

HUM.LU_B        GGGCCGGTGCTACTTGGTCCACCATGTTCACTGGTCCTGACTCTTAATCGGACCATTTCC
TRY.BR_B        ACCGAGGAGCATCTCAGG--ACTTTGCGCCCCAAGTGTCGTCGCGAGGCGGTTT------
                     ** **  **  *   **  **  * *      *       *  ***         

HUM.LU_B        TTT
TRY.BR_B        ---
                   

[Download ClustalW]

#780

Mean pairwise ID: 46.88%


TET.THE.        -GCCAGGGTAGCAATAC-CTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGAT
TRY.BR_B        AGCCGGAGC-GCATTGCTCTGTAACCTTCGGGGGC-TGATCCCGCTTAGCGGGGACGTCT
                 ***