SRP RNA structural alignments

There are 2083 alignments in the test set.

#1

Mean pairwise ID: 16.00%


YAR.LI_B      AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTCGAGTTCTG
TRI.AE_C      ------------------------------------------------------------


YAR.LI_B      GACTCTGCACTGGGCTA-CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTC
TRI.AE_C      -----------------GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTG-GACCGCTTGGG


YAR.LI_B      G-GTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGA
TRI.AE_C      GCCTATGCGAAAGT-TGGGCCTCA-CGGTC-CATAATGTGGCAGGCACCGCGTGAGGCTG


YAR.LI_B      GCA--ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG
TRI.AE_C      GCTTCACAGAGCAGCGACAACTGCCCGCTTC-CAACG-GTGGAA-GGATAACG-GGCCGC


YAR.LI_B      ---TGGTATATGTTAT--------------GGAAGGT--ATTTGCA--ATCACGACTCTC
TRI.AE_C      TGCACT-CCTAGGCCGCTTGGGCCTCGTAG---CCTACTCCAGC-GACCACCATC-----


[Download ClustalW]

#2

Mean pairwise ID: 16.67%


YAR.LI_A      CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTTCGAGTC
TRI.AE_C      ------------------------------------------------------------


YAR.LI_A      TTGGGCTCTGCACTTGGCCA-TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-T
TRI.AE_C      --------------------GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTG-GACCGCTT


YAR.LI_A      CTCG-GTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGT
TRI.AE_C      GGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTC-CATAATGTGGCAGGCACCGCGTGAGG


YAR.LI_A      GGAGCA--ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACC
TRI.AE_C      CTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC-CAACG-GTGGAA-GGATAACG-GGC


YAR.LI_A      AAG---TGGTATATGTTAT--------------GGAAGAT--ATTTACG--ATCACGATT
TRI.AE_C      CGCTGCACT-CCTAGGCCGCTTGGGCCTCGTAG---CCTACTCCAGC-GACCACCATC--


[Download ClustalW]

#3

Mean pairwise ID: 17.93%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATGC
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT----GGTA


ORY.SA_B      -CTGGTCGTTTGCG-------------------------------CTTGGGGTCTGCGCC
YAR.LI_B      AATC----GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC---------------


ORY.SA_B      TGTGGTTTGCACTATGCGGCC-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCT
YAR.LI_B      -TGGGCTA-------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


ORY.SA_B      GGGCGAAGGCTCGAGCGTCCCTGCAC-CT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTT
YAR.LI_B      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA-


ORY.SA_B      CACAGAGCAGCGAGTACCGCCCGCTTC-CAACG-GTGGAA-GGATAACG-GGCCGCTGCA
YAR.LI_B      -ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---T


ORY.SA_B      GC-CCTGGCCCGCTTCCGGCCCAAGT--GCCTTCCATG-GCAGACCACCACCTTT--
YAR.LI_B      GGTATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#4

Mean pairwise ID: 18.31%


TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGC-
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


TRI.AE_A      TGTTGTA-GCG-------------------------------CTGCGGGCCTGGTCTGGG
YAR.LI_B      ATC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TG


TRI.AE_A      --TGTGCTACTGCTGGCC-CGCCCGTTCCAAGTTGCGTAGTG-GACCGCCTGGGGCTTAT
YAR.LI_B      GGCTA-------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCT


TRI.AE_A      GCGAAAGC-TGGGTCTCA-CGGTC-CATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCA
YAR.LI_B      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--A


TRI.AE_A      CAGAGCAGCGACAACTGCCCGCTTC-CAACG-GTGGAA-GGATAATG-GGCCGCTGCACT
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGG


TRI.AE_A      -CCTAGGCCAATTGGGCCTCGCAG---CCTACTCCA-GCAGACCACC--------
YAR.LI_B      TATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#5

Mean pairwise ID: 18.59%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGGGCATTAAGGTGGTGTGGATGT-
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_F      TTCCTGACGGA-------------------------------TTCTGGGCCTGGGCTTGT
YAR.LI_B      ATC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TG


ZEA.MA_F      -ATGTGCCACTGGCCGGCC-TGCCCGTTCCAAGTTG-GTTGTG-GCTGGTGGGG-CTCGG
YAR.LI_B      GGCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_F      GCGAAGGCCTGGGCCTCT-TTAGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCA
YAR.LI_B      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--A


ZEA.MA_F      CAGAGCAGCGATCACTCGCCCGCTTC-CAACG-GTGGGA-GGATAACA-GGCCGCTGCAT
YAR.LI_B      TCCAGCAGAGATCCAG-TTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TG


ZEA.MA_F      T-GCAAGCCCAACTCGGTCCAGAG--CC-TCATTAA-ACAGACCACCATCTTT--
YAR.LI_B      GTATATGTTAT-------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#6

Mean pairwise ID: 18.63%


YAR.LI_A      CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGTCTTCTTGTTGTGCGTTCGAGTC
LYC.ES_D      ------------------------------------------------------------


YAR.LI_A      TTGGGCTCTGCACTTGGCCA-----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGG
LYC.ES_D      --------------------TAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTA-GGAT


YAR.LI_A      CGTCTCG-GTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTC
LYC.ES_D      CACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-AAAGCGGGGCGGACCGCATG


YAR.LI_A      AGTGGAGCA--ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCA
LYC.ES_D      AGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-


YAR.LI_A      ACCAAG---TGGT-ATATGTTAT--------------GGAAGAT---ATTTACG--ATCA
LYC.ES_D      GGTCGGTGTCTT-ATCAAGTTCAGTAACGCCTAATGG--GTTGCTCCAA-CTAAACCACC


YAR.LI_A      CGATT-
LYC.ES_D      ACTTTT


[Download ClustalW]

#7

Mean pairwise ID: 18.75%


TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGC-
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


TRI.AE_A      TGTTGTA-GCG-------------------------------CTGCGGGCCTGGTCTGGG
YAR.LI_A      ATC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TT


TRI.AE_A      --TGTGCTACTGCTGGCC-CGCCCGTTCCAAGTTGCGTAGTG-GACCGCCTGGGGCTTAT
YAR.LI_A      GGCCA-------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCT


TRI.AE_A      GCGAAAGC-TGGGTCTCA-CGGTC-CATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCA
YAR.LI_A      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--A


TRI.AE_A      CAGAGCAGCGACAACTGCCCGCTTC-CAACG-GTGGAA-GGATAATG-GGCCGCTGCACT
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGG


TRI.AE_A      -CCTAGGCCAATTGGGCCTCGCAG---CCTACTCCA-GCAGACCACC-----
YAR.LI_A      TATATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#8

Mean pairwise ID: 18.82%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGC-
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_B      TTTGCGATGGT-------------------------------TTCTGGGCCTGGGCTCGT
YAR.LI_B      ATC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TG


ZEA.MA_B      --TGTGACTCTAGCCGGCT-TGCCCATCCCAAGTTG-GTAGT-GTCTGACGGGG-CTCTA
YAR.LI_B      GGCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_B      GCGAAAGCTTTGGGTCTCTG-CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTC
YAR.LI_B      GAGTAATCG-GCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--


ZEA.MA_B      ACAGAGCAGCGATCACTCGCCCACTTC-CAACG-GTGGGA-GGATAACA-AGCCGCTGCA
YAR.LI_B      ATCCAGCAGAGATCCAG-TTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---T


ZEA.MA_B      CT-TTGAGCCCAACACAGACCCAGA-TCC-TCTCTTA-GCAAACCACCATCTTT--
YAR.LI_B      GGTATATGTTAT-------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#9

Mean pairwise ID: 18.87%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATGC
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT----GGTA


ORY.SA_B      -CTGGTCGTTTGCG-------------------------------CTTGGGGTCTGCGCC
YAR.LI_A      AATC----GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC---------------


ORY.SA_B      TGTGGTTTGCACTATGCGGCC-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCT
YAR.LI_A      -TTGGCCA-------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


ORY.SA_B      GGGCGAAGGCTCGAGCGTCCCTGCAC-CT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTT
YAR.LI_A      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA-


ORY.SA_B      CACAGAGCAGCGAGTACCGCCCGCTTC-CAACG-GTGGAA-GGATAACG-GGCCGCTGCA
YAR.LI_A      -ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---T


ORY.SA_B      GC-CCTGGCCCGCTTCCGGCCCAAGT--GCCTTCCATG-GCAGACCACCACCTTT
YAR.LI_A      GGTATATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#10

Mean pairwise ID: 18.98%


TRI.AE_B      NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGGCATTGAGGCGGTGTGGATGC-T
YAR.LI_B      -----------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAAA


TRI.AE_B      TGGTGCGGT-------------------------------TTGTTGGCCTGGGCTTGTGA
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


TRI.AE_B      TGTAACCTTGCTGGCC-TGCCCGTTCCAAGTTG-GTAGT--GGGCTGGGTGGCTGGGGCG
YAR.LI_B      CTA-------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAG


TRI.AE_B      AAAGCTTCGCCTTCTCAGGC--CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAG
YAR.LI_B      TAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATCC


TRI.AE_B      AGCAGCGACAACTGCC-GCTTC-CAACG-GTGGAA-GGATAACA-GGCCGCTGCAGC-AT
YAR.LI_B      AGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTAT


TRI.AE_B      GGGCCCGCTCTGGGCCTCCTA--CCCCGCCAT-A-GCAGACCACCATCTTT--
YAR.LI_B      ATGTTAT--------------GGAAGGT----ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#11

Mean pairwise ID: 19.10%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_E      TTTGCGATGGCT------------------------------TTCTGGGCCCGGGCTCGC
YAR.LI_B      ATC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TG


ZEA.MA_E      TATGTGCCTTTGGCCGGCC-TGCCCGTCCCAAGTTG-GTAGT-GGCTGGCGGAGGCTTTA
YAR.LI_B      GGCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_E      GCGGAAGCTTTGGTCTCT-CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCA
YAR.LI_B      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--A


ZEA.MA_E      CAGAGCAGCGATCACTCGCCGGCTTC-CAACG-GTGGGA-GGATAACG-GGCCGCTGCAC
YAR.LI_B      TCCAGCAGAGATCCAG-TTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TG


ZEA.MA_E      T-TCGAGCCCAACTCAGGCCCAGAG--CC-TCACTAA-GCAGACCACCATCTTT--
YAR.LI_B      GTATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#12

Mean pairwise ID: 19.21%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGC-
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_B      TTTGCGATGGT-------------------------------TTCTGGGCCTGGGCTCGT
YAR.LI_A      ATC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TT


ZEA.MA_B      --TGTGACTCTAGCCGGCT-TGCCCATCCCAAGTTG-GTAGT-GTCTGACGGGG-CTCTA
YAR.LI_A      GGCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_B      GCGAAAGCTTTGGGTCTCTG-CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTC
YAR.LI_A      GAGTAATCG-GCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--


ZEA.MA_B      ACAGAGCAGCGATCACTCGCCCACTTC-CAACG-GTGGGA-GGATAACA-AGCCGCTGCA
YAR.LI_A      ATCCAGCAGAGATCCAG-TTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---T


ZEA.MA_B      CT-TTGAGCCCAACACAGACCCAGA-TCC-TCTCTTA-GCAAACCACCATCTTT
YAR.LI_A      GGTATATGTTAT-------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#13

Mean pairwise ID: 19.23%


YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGT-


YAR.LI_B      ATC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TG
ZEA.MA_H      CAATTGT-GGT-------------------------------GCATGTGCCTGGGTCTA-


YAR.LI_B      GGCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT
ZEA.MA_H      -GTGCTACAAACTGTGGAC-CACCCATTCCAAGTTGCGTAGTG-GGTTTCGGATGCCTTG


YAR.LI_B      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--A
ZEA.MA_H      GCGAAAGCTTTG-CATCC-CAACA-CT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCA


YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGG
ZEA.MA_H      TAGAGCAGCGAGTACCGCCCGCCAC-CAGCG-GTGGAA-GGATAATG-AGTCGCTATGCT


YAR.LI_B      TATATGTTAT--GGAAGGTATTTGCAATCACGACTCTC
ZEA.MA_H      -ATAGGCCCAAT--------------------------


[Download ClustalW]

#14

Mean pairwise ID: 19.34%


YAR.LI_B      AGCTGTAATGGCATTTTGTCGGAGTGGTAAATCGCCTTCTTGTTGTGCGTTCGAGTTCTG
LYC.ES_D      ------------------------------------------------------------


YAR.LI_B      GACTCTGCACTGGGCTA-----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGT
LYC.ES_D      -----------------TAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTA-GGATCAC


YAR.LI_B      CTCG-GTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGT
LYC.ES_D      GAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-AAAGCGGGGCGGACCGCATGAGG


YAR.LI_B      GGAGCA--ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACA
LYC.ES_D      CTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGT


YAR.LI_B      AAG---TGGT-ATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGA
LYC.ES_D      CGGTGTCTT-ATCAAGTTCAGTAACGCCTAATGG--GTTGCTCCAA-CTAAACCACCACT


YAR.LI_B      CTCTC
LYC.ES_D      TTT--


[Download ClustalW]

#15

Mean pairwise ID: 19.37%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT---AGATAAGTGTGGA
YAR.LI_B      ------------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.EL_A      TGGAGTGAGAGGAGGA------------------------------GTCCTGTGTATGTC
YAR.LI_B      TAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------


CAE.EL_A      GTTG-TCTACGTCGACCGAGCG-TCCGTGCCAAGCGC-TACGT--CACCAGGGGATAACT
YAR.LI_B      ---TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.EL_A      GTCGGAAGGCGGTTAGTCCCGGGTG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAAAG
YAR.LI_B      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAAT


CAE.EL_A      GTAGCAGACAAAAGCGACCGCGTG-GTGCA-GTGGCC-GGACCGCGCTTGT-GAGTTGA-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-A


CAE.EL_A      -CACA---CATACGCAG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT
YAR.LI_B      TATGTTAT---------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#16

Mean pairwise ID: 19.37%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT---AGATAAGTGTGGA
YAR.LI_B      ------------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.EL_D      TGGAGTGAGAGGAGGA------------------------------GTCCTGTGTATGTC
YAR.LI_B      TAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------


CAE.EL_D      GTCG-TCTACGTCGACCGAGCG-TCCGTGCCAAGCGC-TACGT--CACCAGGGGATAACT
YAR.LI_B      ---TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.EL_D      GTCGGAAGGCGGTTAGTCCCGGGTG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAAAG
YAR.LI_B      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAAT


CAE.EL_D      GTAGCAGACAAAAGCGACCGCGTG-GTGCA-GTGGCC-GGACCGCGCTTGT-AAGTTGA-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-A


CAE.EL_D      -CACA---CATACACAG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT
YAR.LI_B      TATGTTAT---------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#17

Mean pairwise ID: 19.40%


YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGT-


YAR.LI_A      ATC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TT
ZEA.MA_H      CAATTGT-GGT-------------------------------GCATGTGCCTGGGTCTA-


YAR.LI_A      GGCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT
ZEA.MA_H      -GTGCTACAAACTGTGGAC-CACCCATTCCAAGTTGCGTAGTG-GGTTTCGGATGCCTTG


YAR.LI_A      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--A
ZEA.MA_H      GCGAAAGCTTTG-CATCC-CAACA-CT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCA


YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGG
ZEA.MA_H      TAGAGCAGCGAGTACCGCCCGCCAC-CAGCG-GTGGAA-GGATAATG-AGTCGCTATGCT


YAR.LI_A      TATATGTTAT--GGAAGATATTTACGATCACGATT
ZEA.MA_H      -ATAGGCCCAAT-----------------------


[Download ClustalW]

#18

Mean pairwise ID: 19.55%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGGGCATTAAGGTGGTGTGGATGT-
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_F      TTCCTGACGGA-------------------------------TTCTGGGCCTGGGCTTGT
YAR.LI_A      ATC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TT


ZEA.MA_F      -ATGTGCCACTGGCCGGCC-TGCCCGTTCCAAGTTG-GTTGTG-GCTGGTGGGG-CTCGG
YAR.LI_A      GGCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_F      GCGAAGGCCTGGGCCTCT-TTAGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCA
YAR.LI_A      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--A


ZEA.MA_F      CAGAGCAGCGATCACTCGCCCGCTTC-CAACG-GTGGGA-GGATAACA-GGCCGCTGCAT
YAR.LI_A      TCCAGCAGAGATCCAG-TTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TG


ZEA.MA_F      T-GCAAGCCCAACTCGGTCCAGAG--CC-TCATTAA-ACAGACCACCATCTTT
YAR.LI_A      GTATATGTTAT-------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#19

Mean pairwise ID: 19.66%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT---AGATAAGTGTGGA
YAR.LI_A      CTT---------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.EL_A      TGGAGTGAGAGGAGGA------------------------------GTCCTGTGTATGTC
YAR.LI_A      TAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------


CAE.EL_A      GTTG-TCTACGTCGACCGAGCG-TCCGTGCCAAGCGC-TACGT--CACCAGGGGATAACT
YAR.LI_A      ---TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.EL_A      GTCGGAAGGCGGTTAGTCCCGGGTG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAAAG
YAR.LI_A      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAAT


CAE.EL_A      GTAGCAGACAAAAGCGACCGCGTG-GTGCA-GTGGCC-GGACCGCGCTTGT-GAGTTGA-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-A


CAE.EL_A      -CACA---CATACGCAG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT
YAR.LI_A      TATGTTAT---------GGAAGAT------ATTTACG--ATCACGATT---


[Download ClustalW]

#20

Mean pairwise ID: 19.66%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_D      TTTGCGATGGCT------------------------------TTCTGGGCCCGGGCTCGC
YAR.LI_B      ATC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TG


ZEA.MA_D      TATGTGCCTTTGGCCGGCC-TGCCCGTCCCAAGTTG-GTAGTG-GCTGGCGGAGGCTTTA
YAR.LI_B      GGCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_D      GCGGAAGCTTTGGTCTCT-CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCA
YAR.LI_B      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--A


ZEA.MA_D      CAGAGCAGCGATCACTCGCCCGCTTC-CAACG-GTGGGA-GGATAACA-GGCCGCTGCAC
YAR.LI_B      TCCAGCAGAGATCCAG-TTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TG


ZEA.MA_D      T-TCGAGCCCAACTCAGGCCCAGAG--CC-TCACTAA-GCAGACCACCATCTT---
YAR.LI_B      GTATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#21

Mean pairwise ID: 19.66%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT---AGATAAGTGTGGA
YAR.LI_A      CTT---------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.EL_D      TGGAGTGAGAGGAGGA------------------------------GTCCTGTGTATGTC
YAR.LI_A      TAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------


CAE.EL_D      GTCG-TCTACGTCGACCGAGCG-TCCGTGCCAAGCGC-TACGT--CACCAGGGGATAACT
YAR.LI_A      ---TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.EL_D      GTCGGAAGGCGGTTAGTCCCGGGTG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAAAG
YAR.LI_A      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAAT


CAE.EL_D      GTAGCAGACAAAAGCGACCGCGTG-GTGCA-GTGGCC-GGACCGCGCTTGT-AAGTTGA-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-A


CAE.EL_D      -CACA---CATACACAG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT
YAR.LI_A      TATGTTAT---------GGAAGAT------ATTTACG--ATCACGATT---


[Download ClustalW]

#22

Mean pairwise ID: 19.72%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_G      TTTGCGATGGCT------------------------------TTCTGGGCCCGGGCTCGC
YAR.LI_B      ATC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TG


ZEA.MA_G      TATGTGCCTTTGGCCGGCC-TGCCCGTCCCAAGTTG-GTAGTG-GCTGGCGGAGGCTTTA
YAR.LI_B      GGCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_G      GCGGAAGCTTTGGTCTCT-CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCA
YAR.LI_B      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--A


ZEA.MA_G      CAGAGCAGCGATCACTGCCCGCTTC-CAACG-GTGGGA-GGATAACG-GGCCGCTGCACT
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGG


ZEA.MA_G      -TCGAGCCCAACTCAGGCCCAGAG--CC-TCACTAA-GCAGACCACCATCTTT--
YAR.LI_B      TATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#23

Mean pairwise ID: 19.77%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_E      TTTGCGATGGCT------------------------------TTCTGGGCCCGGGCTCGC
YAR.LI_A      ATC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TT


ZEA.MA_E      TATGTGCCTTTGGCCGGCC-TGCCCGTCCCAAGTTG-GTAGT-GGCTGGCGGAGGCTTTA
YAR.LI_A      GGCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_E      GCGGAAGCTTTGGTCTCT-CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCA
YAR.LI_A      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--A


ZEA.MA_E      CAGAGCAGCGATCACTCGCCGGCTTC-CAACG-GTGGGA-GGATAACG-GGCCGCTGCAC
YAR.LI_A      TCCAGCAGAGATCCAG-TTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TG


ZEA.MA_E      T-TCGAGCCCAACTCAGGCCCAGAG--CC-TCACTAA-GCAGACCACCATCTTT
YAR.LI_A      GTATATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#24

Mean pairwise ID: 19.81%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGG-GATGGC
SCH.POM.      -----CGC-------------TGTAA---TG---------GC---TTGGTCG-AAGTGTT


DRO.MEL.      CTGAGGCTGGGAT-CTACTGCGTAGCGG--ACCAG--CTCATGTTGACGGAACGTCCGCA
SCH.POM.      TA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTTT


DRO.MEL.      CTAAGCTT-GCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTG-GCTA
SCH.POM.      CG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTA


DRO.MEL.      AGGAGGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGT-AGGCA
SCH.POM.      AACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGGCA


DRO.MEL.      -GTAGTG-GGATAGCGTACCGGAGTGGACTGC----CGTTAT-CAG-CCCAACCGATATG
SCH.POM.      GTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT-----A


DRO.MEL.      GTTGG-ACCACAATCTTT
SCH.POM.      AACACA-ACGGTCGTT--


[Download ClustalW]

#25

Mean pairwise ID: 19.89%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGC-
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_A      TTTGCGATGGCT------------------------------TTCTGGGCCCTGGGCTCG
YAR.LI_B      ATC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC-----------------T


ZEA.MA_A      T--TGTGACACTGGCCGGCT-TGCCCATCCCAAGTTG-GTAGT-GTCTGGTGGGGGCTCT
YAR.LI_B      GGGCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


ZEA.MA_A      AGCGAAAGCTTTGGGTCTCTG-CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTT
YAR.LI_B      TGAGTAATCG-GCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA-


ZEA.MA_A      CACAGAGCAGCGATCACTGCCGACTCC-CAACG-GTGGGA-GGATAACGAAGCCGCTGCA
YAR.LI_B      -ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---T


ZEA.MA_A      CT-TTGAGCCTAACTCAGGCTCAGAA--CC-TCACTAA-GCAAACCACCATCTTT--
YAR.LI_B      GGTATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#26

Mean pairwise ID: 19.94%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACG--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_C      TGGGTCGAT-------------------------------CTCATTGGGCCGGGTTCGGG
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC-----------------TGG


ARA.TH_C      TTGGGCTATATTCTGGCC-CGCCCATTCCAAGTTG-GGAGTT-GAGGCATGGGCTTCGAG
YAR.LI_B      GCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTG


ARA.TH_C      CGAAGGCTCGGGTCTCATGTCTT-CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCAC
YAR.LI_B      AGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--AT


ARA.TH_C      AGAGCAGCGTCCACCTCCCGCTCT-TGACG-GTGGAA-GGATTACG-GGCCATTGCCT--
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGT


ARA.TH_C      TCCGAGCCCACTATGACCCAATAAG---CCGCTCCGA-TTGGACCATCACTTT---
YAR.LI_B      ATATGTTAT----------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#27

Mean pairwise ID: 19.94%


TRI.AE_B      NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGGCATTGAGGCGGTGTGGATGC-T
YAR.LI_A      CTT--------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAAA


TRI.AE_B      TGGTGCGGT-------------------------------TTGTTGGCCTGGGCTTGTGA
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


TRI.AE_B      TGTAACCTTGCTGGCC-TGCCCGTTCCAAGTTG-GTAGT--GGGCTGGGTGGCTGGGGCG
YAR.LI_A      CCA-------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAG


TRI.AE_B      AAAGCTTCGCCTTCTCAGGC--CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAG
YAR.LI_A      TAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATCC


TRI.AE_B      AGCAGCGACAACTGCC-GCTTC-CAACG-GTGGAA-GGATAACA-GGCCGCTGCAGC-AT
YAR.LI_A      AGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTAT


TRI.AE_B      GGGCCCGCTCTGGGCCTCCTA--CCCCGCCAT-A-GCAGACCACCATCTTT
YAR.LI_A      ATGTTAT--------------GGAAGAT----ATTTACG--ATCACGATT-


[Download ClustalW]

#28

Mean pairwise ID: 19.94%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT---AGATAAGTGTGGA
YAR.LI_B      ------------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.EL_B      TGGAGTGAGAGGAGGA------------------------------GTCCTGTGTATGTC
YAR.LI_B      TAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------


CAE.EL_B      GTTG-TCAACGTCGACCGAGCG-TCCGTGCCAAGCGC-TGCGT--CACCAGGGGATGACT
YAR.LI_B      ---TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.EL_B      GTCGGAAGATGGTCAGTCCCGGGTG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAAAG
YAR.LI_B      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAAT


CAE.EL_B      GTAGCAGACAAAAGCCACCGCGCG-GTGCA-GTGGCC-GGACTGCGCTTGT-GAGTTGA-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-A


CAE.EL_B      -CACG---TATACACAG-CCTTCTCAATACCTTCAG-ACCACTTGTTTTT-
YAR.LI_B      TATGTTAT---------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#29

Mean pairwise ID: 20.00%


YAR.LI_A      CTTAGCTGTAATGGCATTTTGTCGGAGTGGTAAATC-GTCTTCTTGTTGTGCGTTCGAGT
LYC.ES_L      -------------------------------G-TTGGGTTGAC-----------------


YAR.LI_A      CTTGGGCTCTGCAC----------------TTGGCCA---------TTTGGTTGTCCTTT
LYC.ES_L      --------------CCAGATGGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCTC


YAR.LI_A      CCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTAATCG-GCTTTGAGATTTCCGTT
LYC.ES_L      TCCAAGCAT-GGAGTT-GGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTC-C


YAR.LI_A      CTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATCCAGCAGAGATCCAGTTGC---CGT
LYC.ES_L      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCT-


YAR.LI_A      GGGTATGGCGGTGGGATC-GCAACCAAG---TGGT-ATATGTTAT---------------
LYC.ES_L      GTGCA-GTGGAA-GGATAACG-GGTCAGTGCTC--AGCGAGTCC-AGTTAACGCCCTGAT


YAR.LI_A      --GGAAGAT---ATTTACG--ATCACGATT
LYC.ES_L      GG--GCTGCTCCAA-CTAAACCACCACTTT


[Download ClustalW]

#30

Mean pairwise ID: 20.11%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATT-TTGTCGGAGT----GGT


ORY.SA_A      T-TTGGTGTGGATTCTG------------------------------ATCCTGGGCCCCA
YAR.LI_B      AAATC-----GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC-------------


ORY.SA_A      TGTTGTTGTAATCTTGCTGGCT-TGCCCGTTCCAAGTTGCGTAGT-GGGCCGGAGGGGCT
YAR.LI_B      ----TGGGCTA-----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-G


ORY.SA_A      TTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCT
YAR.LI_B      TCTGAGTAATCGGCTTTGAGATTTCCGT----TCTAAGATTAACTGGGATACTTCAGTGG


ORY.SA_A      GGCTTCACAGAGCAGCGATCACTGCCCGCTTC-CATCG-GTGGAA-GGATAACA-GGCTG
YAR.LI_B      AGCA--ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAA


ORY.SA_A      CTGCACC-TTGGGCCCGCTTCTGGCCCAGAGT--CCCTCTACAA--CAGACCACCATCTT
YAR.LI_B      G---TGGTATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACT


ORY.SA_A      T--
YAR.LI_B      CTC


[Download ClustalW]

#31

Mean pairwise ID: 20.25%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
SCH.POM.      ----CGC---------------TGTAA---TG---------GC---TTGGTCG-AAGTGT


CAE.EL_D      AGTGAGAGGAGGA--GTCCTGTGTATG----TCGTCG-TCTACGTCGACCGAGCGTCCGT
SCH.POM.      TTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTT


CAE.EL_D      GCCAAGCGC-TACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG-CAT
SCH.POM.      TCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTT


CAE.EL_D      AAGGAGTCGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTG-GTGC
SCH.POM.      AAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGGC


CAE.EL_D      A-GTGGCC-GGACCGCGCTTGTAAGTTGACACA-----CATACACAG-CCTTCTCGATAC
SCH.POM.      AGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT-----


CAE.EL_D      CTTCAG-ACCACTTATCATTT
SCH.POM.      AAACACA-ACGGTCGTT----


[Download ClustalW]

#32

Mean pairwise ID: 20.28%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAG--
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_D      TGGTTCAAT-------------------------------TCCTCGGGTCGGACCTGATG
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


ARA.TH_D      CTGACATATATCTGAGC-TGCCCAGTCCAAGCTG-TGAGT--AATCTGTGTGGGTCAGGC
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


ARA.TH_D      GAAGGCTTGACTCAGGCGGATT-CT-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCAC
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGATACTTCAGTGGAGCA--AT


ARA.TH_D      AGAGCAGCGACTACTTCCCTCTTA-CAGCA-GTGGAT-GGATCATA-GTTCGAAGTCTC-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGT


ARA.TH_D      TCAGATCCACTATGGCCCGCTGGT--TCGATCTCTC-CTGGACCACCACTTT---
YAR.LI_B      ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#33

Mean pairwise ID: 20.28%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGC-
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_A      TTTGCGATGGCT------------------------------TTCTGGGCCCTGGGCTCG
YAR.LI_A      ATC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC-----------------T


ZEA.MA_A      T--TGTGACACTGGCCGGCT-TGCCCATCCCAAGTTG-GTAGT-GTCTGGTGGGGGCTCT
YAR.LI_A      TGGCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


ZEA.MA_A      AGCGAAAGCTTTGGGTCTCTG-CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTT
YAR.LI_A      TGAGTAATCG-GCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA-


ZEA.MA_A      CACAGAGCAGCGATCACTGCCGACTCC-CAACG-GTGGGA-GGATAACGAAGCCGCTGCA
YAR.LI_A      -ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---T


ZEA.MA_A      CT-TTGAGCCTAACTCAGGCTCAGAA--CC-TCACTAA-GCAAACCACCATCTTT
YAR.LI_A      GGTATATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#34

Mean pairwise ID: 20.28%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACAC-T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_A      G-GTTCGGT-------------------------------TCCTCGGATCGGTTCTGATG
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


ARA.TH_A      TGGGCATGTTTCTGAGC-TGCCCAGTCCAAGCTG-TGAGT--AATTAGTGTTGAGTTGAG
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTG


ARA.TH_A      CGAAGGCTTGGCTCATGCAGGTT-CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCA
YAR.LI_B      AGTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGATACTTCAGTGGAGCA--A


ARA.TH_A      CAGAGCAGCGACTACTTCCCGCTTA-CAGCA-GTGGAC-GGATCACG-GTTTAGCGTCGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGG


ARA.TH_A      -TCAGAACCACTATGGCCTGCTGG--TCCGATCTCATATGAACCACCATTTT---
YAR.LI_B      TATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#35

Mean pairwise ID: 20.29%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT---AGATGAGTGTGGA
YAR.LI_A      CTT---------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.EL_C      TGGAGTGAGAGGAGGA------------------------------GTCCTGTGTATGTC
YAR.LI_A      TAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------


CAE.EL_C      GTTG-TCAACGTCGACCGAGCG-TCCGTGCCAAGCGC-TGCGT--CACCAGGGGATGACT
YAR.LI_A      ---TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.EL_C      GTCGGAAGATGGTCAGTCCCGGGTG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAAAG
YAR.LI_A      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAAT


CAE.EL_C      GTAGCAGACAAAAGCCACCGCGCG-GTGCA-GTGGCC-GGACAGCGCTTGT-GAGTTGA-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-A


CAE.EL_C      -CACG---TATACACAG-CCTTCTCAATACCTTCAG-ACCACTTGTCACT
YAR.LI_A      TATGTTAT---------GGAAGAT------ATTTACG--ATCACGATT--


[Download ClustalW]

#36

Mean pairwise ID: 20.40%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_G      TTTGCGATGGCT------------------------------TTCTGGGCCCGGGCTCGC
YAR.LI_A      ATC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TT


ZEA.MA_G      TATGTGCCTTTGGCCGGCC-TGCCCGTCCCAAGTTG-GTAGTG-GCTGGCGGAGGCTTTA
YAR.LI_A      GGCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_G      GCGGAAGCTTTGGTCTCT-CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCA
YAR.LI_A      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--A


ZEA.MA_G      CAGAGCAGCGATCACTGCCCGCTTC-CAACG-GTGGGA-GGATAACG-GGCCGCTGCACT
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGG


ZEA.MA_G      -TCGAGCCCAACTCAGGCCCAGAG--CC-TCACTAA-GCAGACCACCATCTTT
YAR.LI_A      TATATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#37

Mean pairwise ID: 20.40%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_D      TTTGCGATGGCT------------------------------TTCTGGGCCCGGGCTCGC
YAR.LI_A      ATC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TT


ZEA.MA_D      TATGTGCCTTTGGCCGGCC-TGCCCGTCCCAAGTTG-GTAGTG-GCTGGCGGAGGCTTTA
YAR.LI_A      GGCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


ZEA.MA_D      GCGGAAGCTTTGGTCTCT-CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCA
YAR.LI_A      GAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--A


ZEA.MA_D      CAGAGCAGCGATCACTCGCCCGCTTC-CAACG-GTGGGA-GGATAACA-GGCCGCTGCAC
YAR.LI_A      TCCAGCAGAGATCCAG-TTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TG


ZEA.MA_D      T-TCGAGCCCAACTCAGGCCCAGAG--CC-TCACTAA-GCAGACCACCATCTT
YAR.LI_A      GTATATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#38

Mean pairwise ID: 20.40%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGGATGC-
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_C      TTGGTACCGT------------------------------GTCTTTGCCTGGGTTCATGG
YAR.LI_B      ATCGCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


ZEA.MA_C      TGTGCCTTTGTTGGCC-TGCCCGTTCCAAGTTG-GTAGT-GGCCGTTGGAAGCTTGGGCG
YAR.LI_B      CTA-------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAG


ZEA.MA_C      TAGGCCCTGGGCTTCC-TTGGACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACA
YAR.LI_B      TAATCG-GCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


ZEA.MA_C      GAGCAGCGATCACTGCCGGCTAT-TAACG-GTGGAA-GGATAACA-GGCCACTGCAGC-A
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTA


ZEA.MA_C      TGGGCTCGCTTAAGGCCTAGAC-TTC-ATACTAAAGCAGACCACCATTTTT--
YAR.LI_B      TATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#39

Mean pairwise ID: 20.45%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACAC-T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_A      G-GTTCGGT-------------------------------TCCTCGGATCGGTTCTGATG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


ARA.TH_A      TGGGCATGTTTCTGAGC-TGCCCAGTCCAAGCTG-TGAGT--AATTAGTGTTGAGTTGAG
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTG


ARA.TH_A      CGAAGGCTTGGCTCATGCAGGTT-CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCA
YAR.LI_A      AGTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGAAACTTCAGTGGAGCA--A


ARA.TH_A      CAGAGCAGCGACTACTTCCCGCTTA-CAGCA-GTGGAC-GGATCACG-GTTTAGCGTCGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGG


ARA.TH_A      -TCAGAACCACTATGGCCTGCTGG--TCCGATCTCATATGAACCACCATTTT
YAR.LI_A      TATATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#40

Mean pairwise ID: 20.54%


LYC.ES_M      -----------CAAGTGGGGATGTTAAGGTGGTGGAATA--TTGGGCTGTC---------
YAR.LI_A      CTTAGCTGTAA--TG----GCATTTTGTCGGAGT--GGTAAATC-GTCTTCTTGTTGTGC


LYC.ES_M      ----------------------CCAGATGGCTGGGCTTGGT--GGGCTAATTTCTGGCC-
YAR.LI_A      GTTCGAGTCTTGGGCTCTGCAC----------------TTGGCCA--------TTTGGTT


LYC.ES_M      TGCCCTGTCCAAGCAC-AGAGTT-GGATCACGAGGCCCAAATGAAAATATGGGCTTCTTG
YAR.LI_A      GTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTAATCGGCTTTGAGATT


LYC.ES_M      ATTC-CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCC
YAR.LI_A      TCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATCCAGCAGAGATCCAGTTGC


LYC.ES_M      GCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--ATCAAGTTC-AGTAACGC
YAR.LI_A      ---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT-ATATGTTAT--------


LYC.ES_M      CTAATGG--GTTGCTCCAA--TAAACAACCACCTTT
YAR.LI_A      -------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#41

Mean pairwise ID: 20.56%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
SCH.POM.      ----CGC---------------TGTAA---TG---------GC---TTGGTCG-AAGTGT


CAE.EL_A      AGTGAGAGGAGGA--GTCCTGTGTATG----TCGTTG-TCTACGTCGACCGAGCGTCCGT
SCH.POM.      TTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTT


CAE.EL_A      GCCAAGCGC-TACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG-CAT
SCH.POM.      TCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTT


CAE.EL_A      AAGGAGTCGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTG-GTGC
SCH.POM.      AAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGGC


CAE.EL_A      A-GTGGCC-GGACCGCGCTTGTGAGTTGACACA-----CATACGCAG-CCTTCTCGATAC
SCH.POM.      AGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT-----


CAE.EL_A      CTTCAG-ACCACTTATCATTT
SCH.POM.      AAACACA-ACGGTCGTT----


[Download ClustalW]

#42

Mean pairwise ID: 20.57%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT---AGATAAGTGTGGA
YAR.LI_A      CTT---------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.EL_B      TGGAGTGAGAGGAGGA------------------------------GTCCTGTGTATGTC
YAR.LI_A      TAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------


CAE.EL_B      GTTG-TCAACGTCGACCGAGCG-TCCGTGCCAAGCGC-TGCGT--CACCAGGGGATGACT
YAR.LI_A      ---TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.EL_B      GTCGGAAGATGGTCAGTCCCGGGTG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAAAG
YAR.LI_A      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAAT


CAE.EL_B      GTAGCAGACAAAAGCCACCGCGCG-GTGCA-GTGGCC-GGACTGCGCTTGT-GAGTTGA-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-A


CAE.EL_B      -CACG---TATACACAG-CCTTCTCAATACCTTCAG-ACCACTTGTTTTT
YAR.LI_A      TATGTTAT---------GGAAGAT------ATTTACG--ATCACGATT--


[Download ClustalW]

#43

Mean pairwise ID: 20.80%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG
YAR.LI_B      ------------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


GAL.GAL.      GATCGCTTGAGCCCAGGA------------------------------GTTCTGGGCTGC
YAR.LI_B      GGTAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC------------


GAL.GAL.      AGTGC-GCTATGCCGAGCGGGCG-TCCGCGCTAAGGCC-GGCAT--CAATATGGTGAGCC
YAR.LI_B      ----TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


GAL.GAL.      CCGGGGAGCCGAGGCACACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_B      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAA


GAL.GAL.      CGGAGCAGGTCAAAACTCCCGTGCC-GGTCA-GTAACG-GGATCGCGCCTGT-GAATAGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-


GAL.GAL.      --CACTG--CAGCGTAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC---
YAR.LI_B      ATATGTTAT--------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#44

Mean pairwise ID: 20.80%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT---AGATGAGTGTGGA
YAR.LI_B      ------------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.EL_C      TGGAGTGAGAGGAGGA------------------------------GTCCTGTGTATGTC
YAR.LI_B      TAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------


CAE.EL_C      GTTG-TCAACGTCGACCGAGCG-TCCGTGCCAAGCGC-TGCGT--CACCAGGGGATGACT
YAR.LI_B      ---TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.EL_C      GTCGGAAGATGGTCAGTCCCGGGTG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAAAG
YAR.LI_B      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAAT


CAE.EL_C      GTAGCAGACAAAAGCCACCGCGCG-GTGCA-GTGGCC-GGACAGCGCTTGT-GAGTTGA-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-A


CAE.EL_C      -CACG---TATACACAG-CCTTCTCAATACCTTCAG-ACCACTTGTCACT-
YAR.LI_B      TATGTTAT---------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#45

Mean pairwise ID: 20.86%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGT---AGACAAGTGTGGA
YAR.LI_A      CTT---------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.BRI.      TGGAGTGAAGGGAGGA------------------------------GTCCTGTGGGTGTT
YAR.LI_A      TAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------


CAE.BRI.      GTCG-GCAACGGCGACCGAGCG-TCCGTGCCAAGCGC-TGCGT--CGCCAGGGGTCTCCG
YAR.LI_A      ---TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.BRI.      GTCGGAAGGCTGGCGGTCCCGGGCG-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAAAG
YAR.LI_A      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAAT


CAE.BRI.      GCAGCAGGCAAAAGCCACCGCGCG-GTGCA-GTGGCC-GGATAGCGCTTGT-GAGTTGT-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-A


CAE.BRI.      -CGCT---CGCCCACAG-CCTCTCTGATACCTTCAG-ACCACTTGTCATT
YAR.LI_A      TATGTTAT---------GGAAGAT------ATTTACG--ATCACGATT--


[Download ClustalW]

#46

Mean pairwise ID: 20.91%


YAR.LI_B      AGCTGTAATGGCATTTTGTCGGAGTGGTAAATC-GCCTTCTTGTTGTGCGTTCGAGTTCT
LYC.ES_L      ----------------------------G-TTGGGTTGAC--------------------


YAR.LI_B      GGACTCTGCAC----------------TGGGCTA---------CTTTGTTGTCCTTTCCG
LYC.ES_L      -----------CCAGATGGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCTCTCC


YAR.LI_B      AATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTAATCG-GCTTTGAGATTTCCGTTCTA
LYC.ES_L      AAGCAT-GGAGTT-GGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTC-CT-A


YAR.LI_B      AGATTAACTGGGATACTTCAGTGGAGCA--ATCCAGCAGAGATCCAGTTGC---CGTGGG
LYC.ES_L      AAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCT-GTG


YAR.LI_B      TATGGCGGTGGGATA-GCAACAAAG---TGGT-ATATGTTAT-----------------G
LYC.ES_L      CA-GTGGAA-GGATAACG-GGTCAGTGCTC--AGCGAGTCC-AGTTAACGCCCTGATGG-


YAR.LI_B      GAAGGT---ATTTGCA--ATCACGACTCTC
LYC.ES_L      -GCTGCTCCAA-CTAAACCACCACTTT---


[Download ClustalW]

#47

Mean pairwise ID: 20.96%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACG--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_C      TGGGTCGAT-------------------------------CTCATTGGGCCGGGTTCGGG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC-----------------TTG


ARA.TH_C      TTGGGCTATATTCTGGCC-CGCCCATTCCAAGTTG-GGAGTT-GAGGCATGGGCTTCGAG
YAR.LI_A      GCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTG


ARA.TH_C      CGAAGGCTCGGGTCTCATGTCTT-CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCAC
YAR.LI_A      AGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--AT


ARA.TH_C      AGAGCAGCGTCCACCTCCCGCTCT-TGACG-GTGGAA-GGATTACG-GGCCATTGCCT--
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGT


ARA.TH_C      TCCGAGCCCACTATGACCCAATAAG---CCGCTCCGA-TTGGACCATCACTTT
YAR.LI_A      ATATGTTAT----------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#48

Mean pairwise ID: 20.96%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_I      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_I      -GGGCTAATTTCTGACT-TGCCCTATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_I      GAAGAAATGGACTACTTGATTC-GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_I      GAGCAACGATAAG-TTTCGCTCT-AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT--
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT


LYC.ES_I      CTGAGTCC-AGTAACGCCTGATGG--GTTGCTCCAA-TTAAACCACCATTTTT
YAR.LI_A      ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#49

Mean pairwise ID: 20.98%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG
YAR.LI_A      CTT---------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


GAL.GAL.      GATCGCTTGAGCCCAGGA------------------------------GTTCTGGGCTGC
YAR.LI_A      GGTAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC------------


GAL.GAL.      AGTGC-GCTATGCCGAGCGGGCG-TCCGCGCTAAGGCC-GGCAT--CAATATGGTGAGCC
YAR.LI_A      ----TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


GAL.GAL.      CCGGGGAGCCGAGGCACACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_A      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAA


GAL.GAL.      CGGAGCAGGTCAAAACTCCCGTGCC-GGTCA-GTAACG-GGATCGCGCCTGT-GAATAGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-


GAL.GAL.      --CACTG--CAGCGTAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC
YAR.LI_A      ATATGTTAT--------GGAAGAT------ATTTACG--ATCACGATT


[Download ClustalW]

#50

Mean pairwise ID: 21.07%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACAC--
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_F      TGGTTCGGT-------------------------------TCCTCGGATCGGTTCTGATG
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


ARA.TH_F      TGGGCATGTTTCTGAGC-TGCCCAGTCCAAGCTG-TGAGT--AATTAGTGTTGAGTTGAG
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTG


ARA.TH_F      CGAAGGCTTGGCTTGCA--GGTT-CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCA
YAR.LI_B      AGTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGATACTTCAGTGGAGCA--A


ARA.TH_F      CAGAGCAGCGACTACTTCCCGCTTA-CAGCA-GTGGAC-GGATCACG-GTTTAGCGTCGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGG


ARA.TH_F      -TCAGAACCACTATGGCCTGCTGGT--CCGATCTCAT-ATGAACCACCATTTT---
YAR.LI_B      TATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#51

Mean pairwise ID: 21.08%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGT---AGACAAGTGTGGA
YAR.LI_B      ------------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


CAE.BRI.      TGGAGTGAAGGGAGGA------------------------------GTCCTGTGGGTGTT
YAR.LI_B      TAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------


CAE.BRI.      GTCG-GCAACGGCGACCGAGCG-TCCGTGCCAAGCGC-TGCGT--CGCCAGGGGTCTCCG
YAR.LI_B      ---TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


CAE.BRI.      GTCGGAAGGCTGGCGGTCCCGGGCG-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAAAG
YAR.LI_B      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAAT


CAE.BRI.      GCAGCAGGCAAAAGCCACCGCGCG-GTGCA-GTGGCC-GGATAGCGCTTGT-GAGTTGT-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-A


CAE.BRI.      -CGCT---CGCCCACAG-CCTCTCTGATACCTTCAG-ACCACTTGTCATT-
YAR.LI_B      TATGTTAT---------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#52

Mean pairwise ID: 21.13%


LEI.MAJ.      GCCGGAGCTC-TGCTCTGTAACCT--TCGGGGGCT---AACCAGGCTT-AGCGGGGAGGA
YAR.LI_A      CTT-----AGC-----TGTAA---TG------GCATTTTGTCGGAGT-GGTAAATC---G


LEI.MAJ.      CGTGGA------------------------------CCAGCGAGGGTGATTTG-C-TGCG
YAR.LI_A      TCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGGCCA-


LEI.MAJ.      TTGACGTGGTG-CTC-TGCTTGGCTG-TGTGT--CGGTGTGGCTTGCCCCCCTGCAGAGG
YAR.LI_A      ---TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTGAGTAATCG


LEI.MAJ.      GTGGCGCGGGT-CCG-CCGTTGAAGCGAGGGAACCGGGTCAGGCCGGAAACGGAGCAGCC
YAR.LI_A      GCTTTGAGATTTCCGT-TCTAAGATTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAG


LEI.MAJ.      CA-CCCC-ACGCACGTCCGCC-GTTGCA-GAATCACACCGCG-GAGCATGTCC------G
YAR.LI_A      ATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-ATATGTTAT-


LEI.MAJ.      CACTTGAGCCCCACGCTTCGTCGCG-AAGCCTT---
YAR.LI_A      ---------GGAAGAT---ATTTACG-ATCACGATT


[Download ClustalW]

#53

Mean pairwise ID: 21.24%


TRY.BR_A      AGCCGGAGCGCATTGCTCTGTAACCT--TCGGGGGCTGATCCCGCTT--AGCGGGGACGT
SCH.POM.      -----CGC----------TGTAA---TG------GC---TTGGTCG-AAGTGTTTA--GT


TRY.BR_A      CTTGGA--CAAGCGGGG-----GTTCTG-T-TGCGTTGACTTGGTGTTC-TGCTTGGTTG
SCH.POM.      ACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTTTCG-ATCCC


TRY.BR_A      -CGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-T-TAA-AGTGG
SCH.POM.      TCGATCTGCCACG-TCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTAAACCGTG


TRY.BR_A      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCACCTT-GCGCACGTTCCC--GTTCGA-
SCH.POM.      TAGTACCGATGGAGGTTGGAAACAATGCACATCACTACCGG-GTCTTGGGCAGTGCGATA


TRY.BR_A      GAAGCACACCGAGGAGCATCTCAGGAC----TTTGCGC-CCCAAG-TGTCGTCGCG-AGG
SCH.POM.      GCGA-TGGGATTC--ACCT----TCGCAGGAT-GTGCATGGAAGTAT---AAACACAACG


TRY.BR_A      CGG---
SCH.POM.      GTCGTT


[Download ClustalW]

#54

Mean pairwise ID: 21.31%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAG--
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_D      TGGTTCAAT-------------------------------TCCTCGGGTCGGACCTGATG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


ARA.TH_D      CTGACATATATCTGAGC-TGCCCAGTCCAAGCTG-TGAGT--AATCTGTGTGGGTCAGGC
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


ARA.TH_D      GAAGGCTTGACTCAGGCGGATT-CT-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCAC
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGAAACTTCAGTGGAGCA--AT


ARA.TH_D      AGAGCAGCGACTACTTCCCTCTTA-CAGCA-GTGGAT-GGATCATA-GTTCGAAGTCTC-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGT


ARA.TH_D      TCAGATCCACTATGGCCCGCTGGT--TCGATCTCTC-CTGGACCACCACTTT
YAR.LI_A      ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#55

Mean pairwise ID: 21.31%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_A      TGGGCTTTA-------------------------------CCAGAAGGTTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_A      -GGGCTTAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTT-GGATCTCGAGGCCCAAAT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_A      GAAAATATGGGCTTCTTGATTC-CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_A      GAGCAGTGAA-CGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT-A
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGT-


LYC.ES_A      TCAAGTTCAGTAACGCCTAATGG--GTTGCTCCAA--TAAACAACCACCTTT
YAR.LI_A      ATATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#56

Mean pairwise ID: 21.33%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATT-TTGTCGGAGT----GGT


ORY.SA_A      T-TTGGTGTGGATTCTG------------------------------ATCCTGGGCCCCA
YAR.LI_A      AAATC-----GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC-------------


ORY.SA_A      TGTTGTTGTAATCTTGCTGGCT-TGCCCGTTCCAAGTTGCGTAGT-GGGCCGGAGGGGCT
YAR.LI_A      ----TTGGCCA-----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-G


ORY.SA_A      TTGGCGAAGGCCTTTGCTTTGCTTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCT
YAR.LI_A      TCTGAGTAATCGGCTTTGAGATTTCCGT----TCTAAGATTAACTGGGAAACTTCAGTGG


ORY.SA_A      GGCTTCACAGAGCAGCGATCACTGCCCGCTTC-CATCG-GTGGAA-GGATAACA-GGCTG
YAR.LI_A      AGCA--ATCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAA


ORY.SA_A      CTGCACC-TTGGGCCCGCTTCTGGCCCAGAGT--CCCTCTACAA--CAGACCACCATCTT
YAR.LI_A      G---TGGTATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT


ORY.SA_A      T
YAR.LI_A      -


[Download ClustalW]

#57

Mean pairwise ID: 21.41%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACAC--
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_G      TGGATCGGC-------------------------------CCACGGGTCGGATTTGTTGT
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC---------------TGGGC


ARA.TH_G      TGGCATAGGTCTGGAC-TGCCCAATCCAAGCTG-TGAGT--GAACCGTATGAACCAAGCG
YAR.LI_B      TA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAG


ARA.TH_G      AAGGTTTGATCCGTACGGTTG-CT-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACA
YAR.LI_B      TAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGATACTTCAGTGGAGCA--ATC


ARA.TH_G      GAGCAGCGACTACCTCCCGCTCT-CAGCA-GTGGAC-GGACAACG-GTTCGACGCCAC-A
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTA


ARA.TH_G      CAAATCCACTATGGTCCGCTGGC--TCGTAACCCGC-TTGAACCACCATTTT---
YAR.LI_B      TATGTTAT---------------GGAAGGT----ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#58

Mean pairwise ID: 21.53%


LEI.MAJ.      GCCGGAGCTC-TGCTCTGTAACCT--TCGGGGGCT---AACCAGGCTT-AGCGGGGAGGA
YAR.LI_B      --------AGC-----TGTAA---TG------GCATTTTGTCGGAGT-GGTAAATC---G


LEI.MAJ.      CGTGGA------------------------------CCAGCGAGGGTGATTTG-C-TGCG
YAR.LI_B      CCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGGCTA-


LEI.MAJ.      TTGACGTGGTG-CTC-TGCTTGGCTG-TGTGT--CGGTGTGGCTTGCCCCCCTGCAGAGG
YAR.LI_B      ---CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTGAGTAATCG


LEI.MAJ.      GTGGCGCGGGT-CCG-CCGTTGAAGCGAGGGAACCGGGTCAGGCCGGAAACGGAGCAGCC
YAR.LI_B      GCTTTGAGATTTCCGT-TCTAAGATTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAG


LEI.MAJ.      CA-CCCC-ACGCACGTCCGCC-GTTGCA-GAATCACACCGCG-GAGCATGTCC------G
YAR.LI_B      ATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-ATATGTTAT-


LEI.MAJ.      CACTTGAGCCCCACGCTTCGTCGCG-AAGCCTT------
YAR.LI_B      ---------GGAAGGT---ATTTGCA-ATCACGACTCTC


[Download ClustalW]

#59

Mean pairwise ID: 21.53%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_G      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_G      -GGGCTAATTTCTGGCC-TGCCCTATCCAAGCAC-AGAGTT-GGATCATGTGGTCCAATT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_G      GAAAGAATGGGCTACTAGATTC-CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_G      GAGCAACGAAAAACTTCCGCTTT-GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT


LYC.ES_G      CCAAGTTCCATTAATGCCTGATGG--GCTGCTCCAA-TTAAACCACCACTTTT
YAR.LI_A      ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#60

Mean pairwise ID: 21.59%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACAC--
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_G      TGGATCGGC-------------------------------CCACGGGTCGGATTTGTTGT
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC---------------TTGGC


ARA.TH_G      TGGCATAGGTCTGGAC-TGCCCAATCCAAGCTG-TGAGT--GAACCGTATGAACCAAGCG
YAR.LI_A      CA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAG


ARA.TH_G      AAGGTTTGATCCGTACGGTTG-CT-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACA
YAR.LI_A      TAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGAAACTTCAGTGGAGCA--ATC


ARA.TH_G      GAGCAGCGACTACCTCCCGCTCT-CAGCA-GTGGAC-GGACAACG-GTTCGACGCCAC-A
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTA


ARA.TH_G      CAAATCCACTATGGTCCGCTGGC--TCGTAACCCGC-TTGAACCACCATTTT
YAR.LI_A      TATGTTAT---------------GGAAGAT----ATTTACG--ATCACGATT


[Download ClustalW]

#61

Mean pairwise ID: 21.65%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG
YAR.LI_B      ------------AGC-------TGTAA----TG---------GCATTTTGTCGGAGT--G


FUG.RUB.      ATCGCTTGAGCTCAGGA------------------------------GTTCTGGGCTTCA
YAR.LI_B      GTAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC-------------


FUG.RUB.      GCGG-ACTATGTCGATCGGGTG-TCCGTACTAAGTTC-GGTAT--CGATATGGTGCTCCT
YAR.LI_B      ---TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


FUG.RUB.      GGGGGAGCCCGGGATCACCAGGTCG-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAAAC
YAR.LI_B      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAAT


FUG.RUB.      GAAGCAGGTCAAAGCCCCCGTGCC-GCTCA-GTAGTG-GGATCGCGCCCGT-GAATAGA-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-A


FUG.RUB.      -CGCT---GTAGTTCAA-CCTGAGTAACACAGCGGG-ACTCAGTCTTT---
YAR.LI_B      TATGTTAT---------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#62

Mean pairwise ID: 21.65%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG
YAR.LI_B      ------------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


ORI.CUN.      GATCGCTTGAGTCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_B      GGTAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC------------


ORI.CUN.      CGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_B      ----TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


ORI.CUN.      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_B      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAA


ORI.CUN.      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-


ORI.CUN.      --CACTG--CACTCCAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC---
YAR.LI_B      ATATGTTAT--------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#63

Mean pairwise ID: 21.65%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_B      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_B      -GGGCTAATTTCTGACT-TGCCCTATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_B      GAAGAAATGGACTACTTGATTC-GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_B      GAGCAACGATAAGTTTCCGCTCT-AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT-C
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTA


LYC.ES_B      TGAGTCCAGTAATGCCTGATGG--GCTGCTCTAA-TTAAACCACCACTTTT
YAR.LI_A      TATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#64

Mean pairwise ID: 21.71%


XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGC---TTGGGCTGTCGGA
YAR.LI_B      ------------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


XEN.LAE.      TCGCTTGAGTCCAGGA------------------------------GTTCTGGGCTGCAC
YAR.LI_B      TAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------


XEN.LAE.      TGA-GCTATGTCGATCGGGTG-TCCGCACTAAGTTC-GGTAT--CAATATGGTGTTCCTG
YAR.LI_B      --TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


XEN.LAE.      GGGGAGCCTCGGATCACCAGGTTG-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAAC
YAR.LI_B      GAGTAATCGGCTTTGAGATTTCCGT-TCTAAGATTAACTGGGATACTTCAGTGGAGCAAT


XEN.LAE.      GGAGCAGGTCAAAACCCCCGTGCC-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-A


XEN.LAE.      -CGGTG--CAGAACAG-CCTGAACAACACAGCGAG-ACACAGTTCT----
YAR.LI_B      TATGTTAT--------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#65

Mean pairwise ID: 21.74%


TET.THE.      GCCAGGGTAGCA--ATACCTGTGTCTA--TATGTGGC--ATAAACAATGT-AGGTT--GT
YAR.LI_B      -----------AGC-----TGTAA---TG-----GCATTTTGTCGGAGT-GGTAAATC--


TET.THE.      GATAGATA------------------------------GGATATGAGAGTTTGATGAGAC
YAR.LI_B      -GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------------TG


TET.THE.      AGTTTGCTAAGAGTGTG-CCCGCTCCAAACAA-TGAGT--TGCTATGGTGGTAACCTAGT
YAR.LI_B      GGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGT


TET.THE.      AATAGGACTCCACCAGGGCA-TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAAC
YAR.LI_B      AATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAATCCAGC


TET.THE.      AGGGAAAACTTGCCGCTTG-TTGTG-GTGGAA-GGATAACATACTC-ATTAACTGTCAA-
YAR.LI_B      AGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-ATATGT


TET.THE.      ---ACTAATCGGTTCTA-CTATCAAAGCCA-GACATT--------
YAR.LI_B      TAT------------GGAAGGT--ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#66

Mean pairwise ID: 21.75%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_J      TGGGCTTTA-------------------------------CCAGAAGGTTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_J      -GGGCTTAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTT-GGATCACGAGGCCCAAAT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_J      GAAAATATGGGCTTCTTGATTC-CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_J      GAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT


LYC.ES_J      ATCAAGTTC-AGTAACGCCTAATGG--GTTGCTCCAA--TAAACAACCACCTTT
YAR.LI_A      -ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#67

Mean pairwise ID: 21.75%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_K      TGGGCTTTA-------------------------------CCAGAAGGTTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_K      -GGGCTTAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTA-GGATCACGAGGCCCAAAT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_K      GAAAATATGGGCTTCTTGATTC-CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_K      GAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT


LYC.ES_K      ATCAAGTTC-AGTAACGCCTAATGG--GTTGCTCCAA--TAAACAACCACCTTT
YAR.LI_A      -ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#68

Mean pairwise ID: 21.79%


LYC.ES_M      --------CAAGTGGGGATGTTAAGGTGGTGGAATA--TTGGGCTGTC------------
YAR.LI_B      AGCTGTAA--TG----GCATTTTGTCGGAGT--GGTAAATC-GCCTTCTTGTTGTGCGTT


LYC.ES_M      -------------------CCAGATGGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
YAR.LI_B      CGAGTTCTGGACTCTGCAC----------------TGGGCTA--------CTTTGTTGTC


LYC.ES_M      CCTGTCCAAGCAC-AGAGTT-GGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATT
YAR.LI_B      CTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTAATCGGCTTTGAGATTTCC


LYC.ES_M      C-CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCT
YAR.LI_B      GTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATCCAGCAGAGATCCAGTTGC---


LYC.ES_M      CT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--ATCAAGTTC-AGTAACGCCTA
YAR.LI_B      CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT-ATATGTTAT-----------


LYC.ES_M      ATGG--GTTGCTCCAA--TAAACAACCACCTTT--
YAR.LI_B      ----GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#69

Mean pairwise ID: 21.81%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACAC--
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_F      TGGTTCGGT-------------------------------TCCTCGGATCGGTTCTGATG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


ARA.TH_F      TGGGCATGTTTCTGAGC-TGCCCAGTCCAAGCTG-TGAGT--AATTAGTGTTGAGTTGAG
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTG


ARA.TH_F      CGAAGGCTTGGCTTGCA--GGTT-CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCA
YAR.LI_A      AGTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGAAACTTCAGTGGAGCA--A


ARA.TH_F      CAGAGCAGCGACTACTTCCCGCTTA-CAGCA-GTGGAC-GGATCACG-GTTTAGCGTCGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGG


ARA.TH_F      -TCAGAACCACTATGGCCTGCTGGT--CCGATCTCAT-ATGAACCACCATTTT
YAR.LI_A      TATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#70

Mean pairwise ID: 21.84%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG
YAR.LI_A      CTT---------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


ORI.CUN.      GATCGCTTGAGTCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_A      GGTAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC------------


ORI.CUN.      CGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_A      ----TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


ORI.CUN.      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_A      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAA


ORI.CUN.      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-


ORI.CUN.      --CACTG--CACTCCAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC
YAR.LI_A      ATATGTTAT--------GGAAGAT------ATTTACG--ATCACGATT


[Download ClustalW]

#71

Mean pairwise ID: 21.94%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG
YAR.LI_B      ------------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


HOM.SA_A      GATCGCTTGAGTCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_B      GGTAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC------------


HOM.SA_A      AGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_B      ----TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


HOM.SA_A      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_B      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAA


HOM.SA_A      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-


HOM.SA_A      --CACTG--CACTCCAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT--
YAR.LI_B      ATATGTTAT--------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#72

Mean pairwise ID: 21.94%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG
YAR.LI_B      ------------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


RAT.RAT.      GATCGCTTGAGTCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_B      GGTAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC------------


RAT.RAT.      AGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_B      ----TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


RAT.RAT.      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_B      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAA


RAT.RAT.      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-


RAT.RAT.      --CACTG--CACTCCAG-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT--
YAR.LI_B      ATATGTTAT--------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#73

Mean pairwise ID: 21.94%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG
YAR.LI_B      ------------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


HOM.SA_B      GATCGCTTGAGCCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_B      GGTAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC------------


HOM.SA_B      AGTGC-GCTATGCCGATGGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_B      ----TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


HOM.SA_B      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_B      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAA


HOM.SA_B      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-


HOM.SA_B      --CACTG--CACTCCAG-CCTGAGCAACATAGCGAG-ACCCCGTCTCT---
YAR.LI_B      ATATGTTAT--------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#74

Mean pairwise ID: 21.94%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGT---CTGATTGTGGGATG
YAR.LI_B      ------------AGC------TGTAA---TG---------GCATTTTGTCGGAGT-GGTA


DRO.MEL.      GCCTGAGGCTGGGAT-----------------------------CTACTGCGTAGCGGAC
YAR.LI_B      AATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------


DRO.MEL.      CAG--CTCATGTTGACGGAACG-TCCGCACTAAGCTT-GCCAT--CAATATGGGTGCCAT
YAR.LI_B      ---TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


DRO.MEL.      GGAGGAGTCCGTGGCATTCAGGTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAAAA
YAR.LI_B      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAAT


DRO.MEL.      CCAGCAGCCAAGAGTTCCCGTGGT-AGGCA-GTAGTG-GGATAGCGTACCG-GAGTGGA-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-A


DRO.MEL.      -CTGC---CGTTATCAG-CCCAACCGATATGGTTGG-ACCACAATCTTT--
YAR.LI_B      TATGTTAT---------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#75

Mean pairwise ID: 21.97%


TRY.BR_A      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
TRI.AE_C      ------------------------------------------------------------


TRY.BR_A      GACAAGCGGGGGTTCTGTTGCGTTGACTTGGTG-TTC-TGCTTGGTTG-CGTGT-CGGTG
TRI.AE_C      ------------------------GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTGGACCG


TRY.BR_A      TT-GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGGGGGGAACGGGTC
TRI.AE_C      C-TTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTGGCAGGCACCGCGTG


TRY.BR_A      AGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAGAAGC-ACACC
TRI.AE_C      AGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC-CAACGGTGGAAGGATAACG-GG


TRY.BR_A      GAG--GA-GCATCTCAGGAC------TTTGCGC----CCCAAG-TGT-CGTCGCG--AGG
TRI.AE_C      CCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG---CCTA---CTCCAGC-GACCA


TRY.BR_A      CGG--
TRI.AE_C      CCATC


[Download ClustalW]

#76

Mean pairwise ID: 22.01%


TRY.BR_A      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
LYC.ES_D      ------------------------------------------------------------


TRY.BR_A      GACAAGCGGGGGTTCTGTTGCGTT---GACTTGGTG-TTC-TGCTTGGTTGCGTGT-CGG
LYC.ES_D      -----------------------TAGTTCTGGCC-TGCCCTGTCCAAGCACAGAGTAGGA


TRY.BR_A      TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGGGGGGAACGGGT
LYC.ES_D      TCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGCGGGGCGGACCGCAT


TRY.BR_A      CAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAGAAGC-ACAC
LYC.ES_D      GAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCAGTGGAAGGATAATG-G


TRY.BR_A      CGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCAAG-TGT-CGTCGCG--AG
LYC.ES_D      GTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG--GTTGCT--CCAA-CTAAACC


TRY.BR_A      GCGG-----
LYC.ES_D      ACCACTTTT


[Download ClustalW]

#77

Mean pairwise ID: 22.06%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG
YAR.LI_A      CTT---------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


RAT.RAT.      GATCGCTTGAGTCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_A      GGTAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC------------


RAT.RAT.      AGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_A      ----TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


RAT.RAT.      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_A      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAA


RAT.RAT.      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-


RAT.RAT.      --CACTG--CACTCCAG-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT
YAR.LI_A      ATATGTTAT--------GGAAGAT------ATTTACG--ATCACGATT-


[Download ClustalW]

#78

Mean pairwise ID: 22.10%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATG--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_N      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_N      -GGGCTAATTTCTGACT-TGCCCTATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_N      GAAGAAATGGACTACTTGATTC-GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_N      GAGCAACGATAAG-TTTCGCTCT-AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT--
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT


LYC.ES_N      CTGAGTCC-AGTAACGCCTGATGG--GTTGCTCCAA-TTAAACCACCATTTTT
YAR.LI_A      ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#79

Mean pairwise ID: 22.12%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
TRI.AE_C      ------------------------------------------------------------


GAL.GAL.      CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCG-TCCGCGCTAA
TRI.AE_C      ----------------------------------------GGTGGTC-TGCCCGTTCCAA


GAL.GAL.      GGCC-GGCAT-CAATAT-GGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGA
TRI.AE_C      GTTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGT


GAL.GAL.      GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGTA
TRI.AE_C      GGCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTG


GAL.GAL.      ACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--CCTGGGCAA
TRI.AE_C      GAAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA---


GAL.GAL.      CATAGCGAG-ACCCTGTCTCC
TRI.AE_C      -CTCCAGC-GACCACCATC--


[Download ClustalW]

#80

Mean pairwise ID: 22.16%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATA--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_O      TGGGCTGTC-------------------------------CCAGATGGCTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_O      -GGGCTAATTTCTGGCC-TGCCCTATCCAAGCAC-AGAGTT-GGATCATGTGGTCCAATT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_O      GAAAGAATGGGCTACTAGATTC-CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_O      GAGCAACGAAAAACTTCCGCTTT-GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT


LYC.ES_O      CCAAGTTCCATTAATGCCTGATGG--GCTGCTCCAA-TTAAACCACCACTTT
YAR.LI_A      ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#81

Mean pairwise ID: 22.19%


ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGT-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


ZEA.MA_H      CAATTGT-GGT---GCATG-TGCCT--GGGTCTA--GTGCTACAAACTGTGGAC-CACCC
SCH.POM.      TTA-GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


ZEA.MA_H      ATTCCAAGTTGCGTAGTG-GGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAACA-
SCH.POM.      TTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA


ZEA.MA_H      CT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCAC
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCT


ZEA.MA_H      -CAGCG-GTGGAA-GGATAATG-AGTCGCTATGCT-ATAGGCCCAAT-------------
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GATGTGCATGGAA


ZEA.MA_H      --------------------
SCH.POM.      GTATAAACACAACGGTCGTT


[Download ClustalW]

#82

Mean pairwise ID: 22.19%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATG--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_F      TGGGTCCAT-------------------------------CTTGATGGATGGGCTTGAA-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_F      -GGGCTAATGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTT-GGGTCAAGTGGTCTATA
YAR.LI_B      CTA---------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTG


LYC.ES_F      CGAAAGTATAG-CCACTTGGCCT-TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCAC
YAR.LI_B      AGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--AT


LYC.ES_F      AGAGCAACGACTAGTCCCCGCTCT-GTGCA-GTGGAA-GGATCACG-GGCTAGTGCTCT-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGG


LYC.ES_F      -TTGAGTCCTAACAAAAACCTGATAG--GTTGCCTAA-TTAAACCATCACTTTT--
YAR.LI_B      TATATGTTAT----------------GGAAGGT--ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#83

Mean pairwise ID: 22.19%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_K      TGGGCTTTA-------------------------------CCAGAAGGTTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_K      -GGGCTTAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTA-GGATCACGAGGCCCAAAT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_K      GAAAATATGGGCTTCTTGATTC-CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_K      GAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT


LYC.ES_K      ATCAAGTTC-AGTAACGCCTAATGG--GTTGCTCCAA--TAAACAACCACCTTT--
YAR.LI_B      -ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#84

Mean pairwise ID: 22.22%


TRY.BR_B      AGCCGGAGCGCATTGCTCTGTAACCT--TCGGGGGCTGATCCCGCTT--AGCGGGGACGT
SCH.POM.      -----CGC----------TGTAA---TG------GC---TTGGTCG-AAGTGTTTA--GT


TRY.BR_B      CTTGGA--CAAGCGGGG-----GTTCTG-T-TGCGTTGACTTGGTGTTC-TGCTTGGTTG
SCH.POM.      ACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTTTCG-ATCCC


TRY.BR_B      -CGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-T-TAA-AGTGG
SCH.POM.      TCGATCTGCCACG-TCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTAAACCGTG


TRY.BR_B      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCACCTT-GCGCACGTTCCC--GTTGCA-
SCH.POM.      TAGTACCGATGGAGGTTGGAAACAATGCACATCACTACCGG-GTCTTGGGCAGTGCGATA


TRY.BR_B      GAAGCACACCGAGGAGCATCTCAGGAC----TTTGCGC-CCCAAG-TGTCGTCGCG-AGG
SCH.POM.      GCGA-TGGGATTC--ACCT----TCGCAGGAT-GTGCATGGAAGTAT---AAACACAACG


TRY.BR_B      CGGTTT
SCH.POM.      GTCGTT


[Download ClustalW]

#85

Mean pairwise ID: 22.22%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG
YAR.LI_B      ------------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


RAT.NOR.      GATCGATTGAGTCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_B      GGTAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC------------


RAT.NOR.      AGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_B      ----TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


RAT.NOR.      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_B      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAA


RAT.NOR.      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-


RAT.NOR.      --CACTG--CACTCCAG-CCTGGGCAACATAGCGAG-ACCC-GTCTCT---
YAR.LI_B      ATATGTTAT--------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#86

Mean pairwise ID: 22.22%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG
YAR.LI_B      ------------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


CAN.SPE.      GATCGCTTGAGCCCAGGA------------------------------GTTCTGGGCTGC
YAR.LI_B      GGTAAATC---GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC------------


CAN.SPE.      AGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_B      ----TGGGCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


CAN.SPE.      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_B      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAA


CAN.SPE.      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-


CAN.SPE.      --CACTG--CACTCCAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCT---
YAR.LI_B      ATATGTTAT--------GGAAGGT------ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#87

Mean pairwise ID: 22.25%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_G      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_G      -GGGCTAATTTCTGGCC-TGCCCTATCCAAGCAC-AGAGTT-GGATCATGTGGTCCAATT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_G      GAAAGAATGGGCTACTAGATTC-CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_G      GAGCAACGAAAAACTTCCGCTTT-GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT


LYC.ES_G      CCAAGTTCCATTAATGCCTGATGG--GCTGCTCCAA-TTAAACCACCACTTTT--
YAR.LI_B      ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#88

Mean pairwise ID: 22.29%


LEP.COL.      GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCTGG
LYC.ES_D      ------------------------------------------------------------


LEP.COL.      ACCAGCATAGGGTGCTTGCGGCGTT---GACGTGGTG-CTC-TGCTTGGCTGTGTGT-CG
LYC.ES_D      ------------------------TAGTTCTGGCC-TGCCCTGTCCAAGCACAGAGTAGG


LEP.COL.      GAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGT-TAA-AGTAGAGGAA
LYC.ES_D      ATCA-----CGAGGCCCAAATGAAAATA-TGGGCTTCTTGATTCCT-AAAGCGGGGCGGA


LEP.COL.      CTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCACGTCTGCCGTTGCAGAAC
LYC.ES_D      CCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCAGTGGAAGGAT


LEP.COL.      C-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC----CCCAGGCGA-TCCTGT
LYC.ES_D      AATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--CCAA-CT


LEP.COL.      G--AAGCTTT----
LYC.ES_D      AAACCACCACTTTT


[Download ClustalW]

#89

Mean pairwise ID: 22.32%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_A      TGGGCTTTA-------------------------------CCAGAAGGTTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_A      -GGGCTTAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTT-GGATCTCGAGGCCCAAAT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_A      GAAAATATGGGCTTCTTGATTC-CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_A      GAGCAGTGAA-CGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT-A
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGT-


LYC.ES_A      TCAAGTTCAGTAACGCCTAATGG--GTTGCTCCAA--TAAACAACCACCTTT--
YAR.LI_B      ATATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#90

Mean pairwise ID: 22.35%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGT---CTGATTGTGGGATG
YAR.LI_A      CTT---------AGC------TGTAA---TG---------GCATTTTGTCGGAGT-GGTA


DRO.MEL.      GCCTGAGGCTGGGAT-----------------------------CTACTGCGTAGCGGAC
YAR.LI_A      AATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------


DRO.MEL.      CAG--CTCATGTTGACGGAACG-TCCGCACTAAGCTT-GCCAT--CAATATGGGTGCCAT
YAR.LI_A      ---TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


DRO.MEL.      GGAGGAGTCCGTGGCATTCAGGTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAAAA
YAR.LI_A      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAAT


DRO.MEL.      CCAGCAGCCAAGAGTTCCCGTGGT-AGGCA-GTAGTG-GGATAGCGTACCG-GAGTGGA-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-A


DRO.MEL.      -CTGC---CGTTATCAG-CCCAACCGATATGGTTGG-ACCACAATCTTT
YAR.LI_A      TATGTTAT---------GGAAGAT------ATTTACG--ATCACGATT-


[Download ClustalW]

#91

Mean pairwise ID: 22.35%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG
YAR.LI_A      CTT---------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


HOM.SA_A      GATCGCTTGAGTCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_A      GGTAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC------------


HOM.SA_A      AGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_A      ----TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


HOM.SA_A      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_A      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAA


HOM.SA_A      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-


HOM.SA_A      --CACTG--CACTCCAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT
YAR.LI_A      ATATGTTAT--------GGAAGAT------ATTTACG--ATCACGATT-


[Download ClustalW]

#92

Mean pairwise ID: 22.37%


LEI.MAJ.      GCCGGAGCTCTGCTCTGTAACCT--TCGGGGGCTAACCAGGCTT--AGCGGGGAGGACGT
SCH.POM.      ----CGC--------TGTAA---TG------GC---TTGGTCG-AAGTGTTTA--GTACT


LEI.MAJ.      GGA--CCAGCGAGGGT---GATTTG-C-TGCGTTGACGTGGTGCTC-TGCTTGGCTG-TG
SCH.POM.      CCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTTTCG-ATCCCTCG


LEI.MAJ.      TGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCG-CCGTTGAAGCGAGG
SCH.POM.      ATCTGCCACG-TCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA-GTTAAACCGTGTA


LEI.MAJ.      GAACCGGGTCAGGCCGGAAACGGAGCAGCCCACCCC-ACGCACGTCCGCC-GTTGCA-GA
SCH.POM.      GTACCGATGGAGGTTGGAAACAATGCACATCACTACCGG-GTCTTGGGCAGTGCGATAGC


LEI.MAJ.      ATCACACCGCGGAGCATGTCC------GCACTTGAGC-CCCACGCTTCGTCGCG-AAGCC
SCH.POM.      GA-TGGGATTC--ACCT----TCGCAG-GAT-GTGCATGGAAGTAT--AAACACAACGGT


LEI.MAJ.      TT--
SCH.POM.      CGTT


[Download ClustalW]

#93

Mean pairwise ID: 22.41%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG
YAR.LI_A      CTT---------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


RAT.NOR.      GATCGATTGAGTCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_A      GGTAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC------------


RAT.NOR.      AGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_A      ----TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


RAT.NOR.      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_A      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAA


RAT.NOR.      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-


RAT.NOR.      --CACTG--CACTCCAG-CCTGGGCAACATAGCGAG-ACCC-GTCTCT
YAR.LI_A      ATATGTTAT--------GGAAGAT------ATTTACG--ATCACGATT


[Download ClustalW]

#94

Mean pairwise ID: 22.41%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACT--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


CIN.HYB.      TGAGCTTGGC-------------------------------TTAGCTAGTTGGGTCTGTA
YAR.LI_B      TC--GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGG


CIN.HYB.      --GACACCGCACCTGGCT-TGCCCGTTCCAAGTCG-AGAGTG-GGTTCATGTTTCCTGAG
YAR.LI_B      GCTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTG


CIN.HYB.      CGAAGGCTCGGGTGATGTGAGCT-TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCA
YAR.LI_B      AGTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGATACTTCAGTGGAGCA--A


CIN.HYB.      CAGAGCTGCGAAAACCTCTACCTCT-CGACT-GTGGAA-GGATTACA-AGCCGGAGTGTC
YAR.LI_B      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TG


CIN.HYB.      --TTAGGCTC-ATATAACCAGCCTGG---CTAGCCCAA-CAGGACACCCATTT----
YAR.LI_B      GTATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#95

Mean pairwise ID: 22.47%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_J      TGGGCTTTA-------------------------------CCAGAAGGTTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_J      -GGGCTTAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTT-GGATCACGAGGCCCAAAT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_J      GAAAATATGGGCTTCTTGATTC-CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_J      GAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT


LYC.ES_J      ATCAAGTTC-AGTAACGCCTAATGG--GTTGCTCCAA--TAAACAACCACCTTT--
YAR.LI_B      -ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#96

Mean pairwise ID: 22.50%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
SCH.POM.      ----CGC---------------TGTAA---TG---------GC---TTGGTCG-AAGTGT


CAE.BRI.      AGTGAAGGGAGGA--GTCCTGTGGGTG----TTGTCG-GCAACGGCGACCGAGCGTCCGT
SCH.POM.      TTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTT


CAE.BRI.      GCCAAGCGC-TGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCG-CAT
SCH.POM.      TCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTT


CAE.BRI.      AAGGAGTGGTGCAC-GGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCG-GTGC
SCH.POM.      AAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGGC


CAE.BRI.      A-GTGGCC-GGATAGCGCTTGTGAGTTGTCGCT-----CGCCCACAG-CCTCTCTGATAC
SCH.POM.      AGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT-----


CAE.BRI.      CTTCAG-ACCACTTGTCATT
SCH.POM.      AAACACA-ACGGTCGTT---


[Download ClustalW]

#97

Mean pairwise ID: 22.51%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGGATGC-
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT---GGTAA


ZEA.MA_C      TTGGTACCGT------------------------------GTCTTTGCCTGGGTTCATGG
YAR.LI_A      ATCGTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


ZEA.MA_C      TGTGCCTTTGTTGGCC-TGCCCGTTCCAAGTTG-GTAGT-GGCCGTTGGAAGCTTGGGCG
YAR.LI_A      CCA-------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAG


ZEA.MA_C      TAGGCCCTGGGCTTCC-TTGGACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACA
YAR.LI_A      TAATCG-GCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


ZEA.MA_C      GAGCAGCGATCACTGCCGGCTAT-TAACG-GTGGAA-GGATAACA-GGCCACTGCAGC-A
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTA


ZEA.MA_C      TGGGCTCGCTTAAGGCCTAGAC-TTC-ATACTAAAGCAGACCACCATTTTT
YAR.LI_A      TATGTTAT--------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#98

Mean pairwise ID: 22.51%


TET.THE.      GCCAGGGTAGCA--ATACCTGTGTCTA--TATGTGGC--ATAAACAATGT-AGGTT--GT
YAR.LI_A      CTT--------AGC-----TGTAA---TG-----GCATTTTGTCGGAGT-GGTAAATC--


TET.THE.      GATAGATA------------------------------GGATATGAGAGTTTGATGAGAC
YAR.LI_A      -GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------------TT


TET.THE.      AGTTTGCTAAGAGTGTG-CCCGCTCCAAACAA-TGAGT--TGCTATGGTGGTAACCTAGT
YAR.LI_A      GGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGT


TET.THE.      AATAGGACTCCACCAGGGCA-TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAAC
YAR.LI_A      AATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAATCCAGC


TET.THE.      AGGGAAAACTTGCCGCTTG-TTGTG-GTGGAA-GGATAACATACTC-ATTAACTGTCAA-
YAR.LI_A      AGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-ATATGT


TET.THE.      ---ACTAATCGGTTCTA-CTATCAAAGCCA-GACATT-----
YAR.LI_A      TAT------------GGAAGAT--ATTTACG--ATCACGATT


[Download ClustalW]

#99

Mean pairwise ID: 22.51%


LEP.COL.      GCCGGAGCCTTGCTCTGTAACCT--TCGGGGGCTTTCACCAGCTG--AACAGG-GAGCTG
SCH.POM.      ----CGC--------TGTAA---TG------GC----TTGGTCG-AAGTGTTTA--GTAC


LEP.COL.      TCT---GGACCAGCATAGG---GTGCTTG-C-GGCGTTGACGTGGTGCTC-TGCTTGGCT
SCH.POM.      TCCCAA---TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTTTCG-ATCC


LEP.COL.      G-TGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCG-T-TAA
SCH.POM.      CTCGATCTGCCACG-----TCTGTTCGAAGAGTAGTCT-TCGTG-GCAACTGGCAGTTAA


LEP.COL.      -AGTAGAGGAACTGGGTCAGGCCGGCAACGGAGCAGCCCACCTC-GCGCACGTCTGCC-G
SCH.POM.      ACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCACTACCGG-GTCTTGGGCAGT


LEP.COL.      TTGCA-GAACCACACCGCGGAGCCTGTCATC----ACCTGCGC--CCCAGGCGATCCTGT
SCH.POM.      GCGATAGCGA-TGGGATTC--ACCT---TCGCAGGAT-GTGCATGGAAGTAT---AAACA


LEP.COL.      G-AAGCTTT--
SCH.POM.      CAACGGTCGTT


[Download ClustalW]

#100

Mean pairwise ID: 22.51%


LEP.COL.      GCCGGAGC-CTTGCTCTGTAACCT--TCGGGGGCT--TTCACCAGCTG-AACAGG-GAGC
YAR.LI_A      CTT-----AGC-----TGTAA---TG------GCATTTTGTCGGAGT-GGTAAATC---G


LEP.COL.      TGTCT-------------------------------GGACCAGCATAGGGTGCTTG-C-G
YAR.LI_A      TCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC-------------------TTGGC


LEP.COL.      GCGTTGACGTGGTG-CTC-TGCTTGGCTG-TGTGT--CGGAGGCCTCCGGGTGCCCCCTT
YAR.LI_A      CA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-----TCTCG-GTCTGA


LEP.COL.      GCAGAAGGGGCGCGCCCCCTCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCAACGG
YAR.LI_A      GTAATCG-GCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAATCC


LEP.COL.      AGCAGCCCA-CCTC-GCGCACGTCTGCC-GTTGCA-GAACCACACCGCG-GAGCCTG-TC
YAR.LI_A      AGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-ATA


LEP.COL.      ATC---ACCTGCGC-CCCAGGCGATCCTGTG-AAGCTTT---
YAR.LI_A      TGTTAT--------GGAAGAT----ATTTACG-ATCACGATT


[Download ClustalW]

#101

Mean pairwise ID: 22.54%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_I      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_I      -GGGCTAATTTCTGACT-TGCCCTATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_I      GAAGAAATGGACTACTTGATTC-GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_I      GAGCAACGATAAG-TTTCGCTCT-AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT--
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT


LYC.ES_I      CTGAGTCC-AGTAACGCCTGATGG--GTTGCTCCAA-TTAAACCACCATTTTT--
YAR.LI_B      ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#102

Mean pairwise ID: 22.55%


TRY.BR_B      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
TRI.AE_C      ------------------------------------------------------------


TRY.BR_B      GACAAGCGGGGGTTCTGTTGCGTTGACTTGGTG-TTC-TGCTTGGTTG-CGTGT-CGGTG
TRI.AE_C      ------------------------GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTGGACCG


TRY.BR_B      TT-GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGGGGGGAACGGGTC
TRI.AE_C      C-TTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTGGCAGGCACCGCGTG


TRY.BR_B      AGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAGAAGC-ACACC
TRI.AE_C      AGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC-CAACGGTGGAAGGATAACG-GG


TRY.BR_B      GAG--GA-GCATCTCAGGAC------TTTGCGC----CCCAAG-TGT-CGTCGCG--AGG
TRI.AE_C      CCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG---CCTA---CTCCAGC-GACCA


TRY.BR_B      CGGTTT
TRI.AE_C      CCATC-


[Download ClustalW]

#103

Mean pairwise ID: 22.60%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATG--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_F      TGGGTCCAT-------------------------------CTTGATGGATGGGCTTGAA-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_F      -GGGCTAATGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTT-GGGTCAAGTGGTCTATA
YAR.LI_A      CCA---------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTG


LYC.ES_F      CGAAAGTATAG-CCACTTGGCCT-TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCAC
YAR.LI_A      AGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--AT


LYC.ES_F      AGAGCAACGACTAGTCCCCGCTCT-GTGCA-GTGGAA-GGATCACG-GGCTAGTGCTCT-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGG


LYC.ES_F      -TTGAGTCCTAACAAAAACCTGATAG--GTTGCCTAA-TTAAACCATCACTTTT
YAR.LI_A      TATATGTTAT----------------GGAAGAT--ATTTACG--ATCACGATT-


[Download ClustalW]

#104

Mean pairwise ID: 22.61%


LEP.COL.      GCCGGAGC-CTTGCTCTGTAACCT--TCGGGGGCT--TTCACCAGCTG-AACAGG-GAGC
YAR.LI_B      --------AGC-----TGTAA---TG------GCATTTTGTCGGAGT-GGTAAATC---G


LEP.COL.      TGTCT-------------------------------GGACCAGCATAGGGTGCTTG-C-G
YAR.LI_B      CCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC-------------------TGGGC


LEP.COL.      GCGTTGACGTGGTG-CTC-TGCTTGGCTG-TGTGT--CGGAGGCCTCCGGGTGCCCCCTT
YAR.LI_B      TA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-----TCTCG-GTCTGA


LEP.COL.      GCAGAAGGGGCGCGCCCCCTCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCAACGG
YAR.LI_B      GTAATCG-GCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAATCC


LEP.COL.      AGCAGCCCA-CCTC-GCGCACGTCTGCC-GTTGCA-GAACCACACCGCG-GAGCCTG-TC
YAR.LI_B      AGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-ATA


LEP.COL.      ATC---ACCTGCGC-CCCAGGCGATCCTGTG-AAGCTTT------
YAR.LI_B      TGTTAT--------GGAAGGT----ATTTGCA-ATCACGACTCTC


[Download ClustalW]

#105

Mean pairwise ID: 22.70%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG
YAR.LI_A      CTT---------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


CAN.SPE.      GATCGCTTGAGCCCAGGA------------------------------GTTCTGGGCTGC
YAR.LI_A      GGTAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC------------


CAN.SPE.      AGTGC-GCTATGCCGATCGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_A      ----TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


CAN.SPE.      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_A      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAA


CAN.SPE.      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-


CAN.SPE.      --CACTG--CACTCCAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCT
YAR.LI_A      ATATGTTAT--------GGAAGAT------ATTTACG--ATCACGATT


[Download ClustalW]

#106

Mean pairwise ID: 22.70%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG
YAR.LI_A      CTT---------AGC-------TGTAA----TG----------GCATTTTGTCGGAGT--


HOM.SA_B      GATCGCTTGAGCCCAGGA------------------------------GTTCTGGGCTGT
YAR.LI_A      GGTAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC------------


HOM.SA_B      AGTGC-GCTATGCCGATGGGGTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCT
YAR.LI_A      ----TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GT


HOM.SA_B      CCCGGGAGCGGGGGACCACCAGGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAA
YAR.LI_A      CTGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAA


HOM.SA_B      CGGAGCAGGTCAAAACTCCCGTGCT-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-


HOM.SA_B      --CACTG--CACTCCAG-CCTGAGCAACATAGCGAG-ACCCCGTCTCT
YAR.LI_A      ATATGTTAT--------GGAAGAT------ATTTACG--ATCACGATT


[Download ClustalW]

#107

Mean pairwise ID: 22.73%


SCH.POM.      CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCG
TRI.AE_C      ------------------------------------------------------------


SCH.POM.      GGTTC--GAGTCT--CGCTTTCG-ATCCCTCGATC-TGCCACG-TCTGTTCGAAGAGTAG
TRI.AE_C      -----GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTG-GACCGCTTGGGGCCTATGCGAAA


SCH.POM.      TCTTCGTG-GCAACTGGCAGTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGC
TRI.AE_C      GT-TGGGCCTCA-CGGTC-CATAATGTGGCAGGCACCGCGTGAGGCTGGCTTCACAGAGC


SCH.POM.      ACATCA-CTACCGG-GTCTTGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TC
TRI.AE_C      AGCGACAACTGCCCGCTTC-CAACG-GTGGAA-GGATAACG-GGCCGCTGCACT-CCTAG


SCH.POM.      GCAG--GAT-GTGCAT---GGAAGTAT--AAACACA-ACGGTCGTT
TRI.AE_C      GCCGCTTGGGCC-TCGTAG---CCTA-CTCCAGC-GACCACCATC-


[Download ClustalW]

#108

Mean pairwise ID: 22.75%


TRY.BR_A      AGCCGGAGCGCAT-TGCTCTGTAACCT--TCGGGGGCT---GATCCCGCTT-AGCGGGGA
YAR.LI_A      CTT--------AGC-----TGTAA---TG------GCATTTTGTCGGAGT-GGTAAATC-


TRY.BR_A      CGTCTTGGA------------------------------CAAGCGGGGGTTCTG-T-TGC
YAR.LI_A      --GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------TTGGCCA


TRY.BR_A      GTTGACTTGGTG-TTC-TGCTTGGTTG-CGTGT--CGGTGTTGAGGTCGCCACTGTAGAG
YAR.LI_A      ----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTGAGTAATC


TRY.BR_A      AGGCGTTCTCGCGCCG-T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCC
YAR.LI_A      GGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAG


TRY.BR_A      CA-CCTT-GCGCACGTTCCC--GTTCGA-GAAGCACACCGAG-GAGCATCTCAGGAC--T
YAR.LI_A      ATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-ATATGTTAT-


TRY.BR_A      TTGCGCCCCAAG-TGTCGTCGCG-AGGCGG----
YAR.LI_A      ------GGAAGAT----ATTTACG-ATCACGATT


[Download ClustalW]

#109

Mean pairwise ID: 22.82%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATA--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_O      TGGGCTGTC-------------------------------CCAGATGGCTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_O      -GGGCTAATTTCTGGCC-TGCCCTATCCAAGCAC-AGAGTT-GGATCATGTGGTCCAATT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_O      GAAAGAATGGGCTACTAGATTC-CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_O      GAGCAACGAAAAACTTCCGCTTT-GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT


LYC.ES_O      CCAAGTTCCATTAATGCCTGATGG--GCTGCTCCAA-TTAAACCACCACTTT---
YAR.LI_B      ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#110

Mean pairwise ID: 22.95%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_B      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_B      -GGGCTAATTTCTGACT-TGCCCTATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_B      GAAGAAATGGACTACTTGATTC-GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_B      GAGCAACGATAAGTTTCCGCTCT-AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT-C
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTA


LYC.ES_B      TGAGTCCAGTAATGCCTGATGG--GCTGCTCTAA-TTAAACCACCACTTTT--
YAR.LI_B      TATGTTAT--------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#111

Mean pairwise ID: 22.97%


TET.ROS.      GCCAGGGTAGCA--ATGCCTGTGACCT--CGTGTGGC--ATAAACAATGT--AGTTA-GA
YAR.LI_B      -----------AGC-----TGTAA---TG-----GCATTTTGTCGGAGT-GGTAAATC--


TET.ROS.      ATAGTCA------------------------------GAGTATGAGAGTTTGATGAGACA
YAR.LI_B      GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------------TGG


TET.ROS.      GTTTGCTAAGAGTGTG-CCCGTTCCAAACAG-TGAGT--TGCTATGGTGGAAACCTAGTA
YAR.LI_B      GCTA----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTA


TET.ROS.      ATAGGACTTCACCAGGGCA-TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACA
YAR.LI_B      ATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAATCCAGCA


TET.ROS.      GGGAAAACTTGCCGCTTA-TTGTG-GTGGAA-GGATAACATACTC-ATTAACTGTCAA--
YAR.LI_B      GAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-ATATGTT


TET.ROS.      --GCTAATCGGTTCTG-CTATTCTGATCA-GACACT--------
YAR.LI_B      AT------------GGAAGGT--ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#112

Mean pairwise ID: 22.98%


TRY.BR_B      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
LYC.ES_D      ------------------------------------------------------------


TRY.BR_B      GACAAGCGGGGGTTCTGTTGCGTT---GACTTGGTG-TTC-TGCTTGGTTGCGTGT-CGG
LYC.ES_D      -----------------------TAGTTCTGGCC-TGCCCTGTCCAAGCACAGAGTAGGA


TRY.BR_B      TGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGGGGGGAACGGGT
LYC.ES_D      TCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGCGGGGCGGACCGCAT


TRY.BR_B      CAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAGAAGC-ACAC
LYC.ES_D      GAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCAGTGGAAGGATAATG-G


TRY.BR_B      CGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCAAG-TGT-CGTCGCG--AG
LYC.ES_D      GTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG--GTTGCT--CCAA-CTAAACC


TRY.BR_B      GCGGTTT--
LYC.ES_D      ACCACTTTT


[Download ClustalW]

#113

Mean pairwise ID: 23.05%


XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGC---TTGGGCTGTCGGA
YAR.LI_A      CTT---------AGC-------TGTAA---TG---------GCATTTTGTCGGAGT--GG


XEN.LAE.      TCGCTTGAGTCCAGGA------------------------------GTTCTGGGCTGCAC
YAR.LI_A      TAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------


XEN.LAE.      TGA-GCTATGTCGATCGGGTG-TCCGCACTAAGTTC-GGTAT--CAATATGGTGTTCCTG
YAR.LI_A      --TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCT


XEN.LAE.      GGGGAGCCTCGGATCACCAGGTTG-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAAC
YAR.LI_A      GAGTAATCGGCTTTGAGATTTCCGT-TCTAAGATTAACTGGGAAACTTCAGTGGAGCAAT


XEN.LAE.      GGAGCAGGTCAAAACCCCCGTGCC-GATCA-GTAGTG-GGATCGCGCCTGT-GAATAGC-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-A


XEN.LAE.      -CGGTG--CAGAACAG-CCTGAACAACACAGCGAG-ACACAGTTCT-
YAR.LI_A      TATGTTAT--------GGAAGAT------ATTTACG--ATCACGATT


[Download ClustalW]

#114

Mean pairwise ID: 23.05%


TRY.BR_B      AGCCGGAGCGCAT-TGCTCTGTAACCT--TCGGGGGCT---GATCCCGCTT-AGCGGGGA
YAR.LI_A      CTT--------AGC-----TGTAA---TG------GCATTTTGTCGGAGT-GGTAAATC-


TRY.BR_B      CGTCTTGGA------------------------------CAAGCGGGGGTTCTG-T-TGC
YAR.LI_A      --GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------TTGGCCA


TRY.BR_B      GTTGACTTGGTG-TTC-TGCTTGGTTG-CGTGT--CGGTGTTGAGGTCGCCACTGTAGAG
YAR.LI_A      ----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTGAGTAATC


TRY.BR_B      AGGCGTTCTCGCGCCG-T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCC
YAR.LI_A      GGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAG


TRY.BR_B      CA-CCTT-GCGCACGTTCCC--GTTGCA-GAAGCACACCGAG-GAGCATCTCAGGAC--T
YAR.LI_A      ATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-ATATGTTAT-


TRY.BR_B      TTGCGCCCCAAG-TGTCGTCGCG-AGGCGGTTT-
YAR.LI_A      ------GGAAGAT----ATTTACG-ATCACGATT


[Download ClustalW]

#115

Mean pairwise ID: 23.10%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATG--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_N      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_N      -GGGCTAATTTCTGACT-TGCCCTATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_N      GAAGAAATGGACTACTTGATTC-GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_N      GAGCAACGATAAG-TTTCGCTCT-AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT--
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT


LYC.ES_N      CTGAGTCC-AGTAACGCCTGATGG--GTTGCTCCAA-TTAAACCACCATTTTT--
YAR.LI_B      ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#116

Mean pairwise ID: 23.10%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACAC--
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_E      TGGTTCGGG-------------------------------TCCACGGGCCGGTTCTGTTG
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


ARA.TH_E      TTGGCATGTTTCTGGGC-TGCCCAGTCCAAGCTG-TGAGT--AAGACGTGTGTGTCAAGC
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


ARA.TH_E      GAAGGCTTGGCTCAAACGGCTT-CT-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCAC
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGATACTTCAGTGGAGCA--AT


ARA.TH_E      AGAGCAGCGACTACTTCCCGCTTA-CAGCA-GTGGAC-GGATCACA-GTTTAGCGTCGC-
YAR.LI_B      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGT


ARA.TH_E      TCAGAACCACTATGGCCTGCTGGT--CCGATCTCAT-ATGAACCACCATTTT---
YAR.LI_B      ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#117

Mean pairwise ID: 23.12%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
TRI.AE_C      ------------------------------------------------------------


FUG.RUB.      GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTCGATCGGGTG-TCCGTACTAAG
TRI.AE_C      ---------------------------------------GGTGGTC-TGCCCGTTCCAAG


FUG.RUB.      TTC-GGTAT-CGATAT-GGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGAG
TRI.AE_C      TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTG


FUG.RUB.      GGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTAG
TRI.AE_C      GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG


FUG.RUB.      TGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CCTGAGTAAC
TRI.AE_C      AAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA----


FUG.RUB.      ACAGCGGG-ACTCAGTCTTT
TRI.AE_C      CTCCAGC-GACCACCATC--


[Download ClustalW]

#118

Mean pairwise ID: 23.12%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
SCH.POM.      ----CGC---------------TGTAA---TG---------GC---TTGGTCG-AAGTGT


CAE.EL_C      AGTGAGAGGAGGA--GTCCTGTGTATG----TCGTTG-TCAACGTCGACCGAGCGTCCGT
SCH.POM.      TTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTT


CAE.EL_C      GCCAAGCGC-TGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTG-CAT
SCH.POM.      TCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTT


CAE.EL_C      AAGGAGTGGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCG-GTGC
SCH.POM.      AAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGGC


CAE.EL_C      A-GTGGCC-GGACAGCGCTTGTGAGTTGACACG-----TATACACAG-CCTTCTCAATAC
SCH.POM.      AGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT-----


CAE.EL_C      CTTCAG-ACCACTTGTCACT
SCH.POM.      AAACACA-ACGGTCGTT---


[Download ClustalW]

#119

Mean pairwise ID: 23.12%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
SCH.POM.      ----CGC---------------TGTAA---TG---------GC---TTGGTCG-AAGTGT


CAE.EL_B      AGTGAGAGGAGGA--GTCCTGTGTATG----TCGTTG-TCAACGTCGACCGAGCGTCCGT
SCH.POM.      TTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTT


CAE.EL_B      GCCAAGCGC-TGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTG-CAT
SCH.POM.      TCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTT


CAE.EL_B      AAGGAGTGGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCG-GTGC
SCH.POM.      AAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGGC


CAE.EL_B      A-GTGGCC-GGACTGCGCTTGTGAGTTGACACG-----TATACACAG-CCTTCTCAATAC
SCH.POM.      AGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT-----


CAE.EL_B      CTTCAG-ACCACTTGTTTTT
SCH.POM.      AAACACA-ACGGTCGTT---


[Download ClustalW]

#120

Mean pairwise ID: 23.15%


TRY.BR_B      AGCCGGAGCGCAT-TGCTCTGTAACCT--TCGGGGGCT---GATCCCGCTT-AGCGGGGA
YAR.LI_B      -----------AGC-----TGTAA---TG------GCATTTTGTCGGAGT-GGTAAATC-


TRY.BR_B      CGTCTTGGA------------------------------CAAGCGGGGGTTCTG-T-TGC
YAR.LI_B      --GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------TGGGCTA


TRY.BR_B      GTTGACTTGGTG-TTC-TGCTTGGTTG-CGTGT--CGGTGTTGAGGTCGCCACTGTAGAG
YAR.LI_B      ----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTGAGTAATC


TRY.BR_B      AGGCGTTCTCGCGCCG-T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCC
YAR.LI_B      GGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAG


TRY.BR_B      CA-CCTT-GCGCACGTTCCC--GTTGCA-GAAGCACACCGAG-GAGCATCTCAGGAC--T
YAR.LI_B      ATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-ATATGTTAT-


TRY.BR_B      TTGCGCCCCAAG-TGTCGTCGCG-AGGCGGTTT----
YAR.LI_B      ------GGAAGGT----ATTTGCA-ATCACGACTCTC


[Download ClustalW]

#121

Mean pairwise ID: 23.15%


TRY.BR_A      AGCCGGAGCGCAT-TGCTCTGTAACCT--TCGGGGGCT---GATCCCGCTT-AGCGGGGA
YAR.LI_B      -----------AGC-----TGTAA---TG------GCATTTTGTCGGAGT-GGTAAATC-


TRY.BR_A      CGTCTTGGA------------------------------CAAGCGGGGGTTCTG-T-TGC
YAR.LI_B      --GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC--------------TGGGCTA


TRY.BR_A      GTTGACTTGGTG-TTC-TGCTTGGTTG-CGTGT--CGGTGTTGAGGTCGCCACTGTAGAG
YAR.LI_B      ----CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCG-TCTCG-GTCTGAGTAATC


TRY.BR_A      AGGCGTTCTCGCGCCG-T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCC
YAR.LI_B      GGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAG


TRY.BR_A      CA-CCTT-GCGCACGTTCCC--GTTCGA-GAAGCACACCGAG-GAGCATCTCAGGAC--T
YAR.LI_B      ATCCAGTTGC---CGTGGGTATGGCGGTGGGATAGCAACAAAG--TGGT-ATATGTTAT-


TRY.BR_A      TTGCGCCCCAAG-TGTCGTCGCG-AGGCGG-------
YAR.LI_B      ------GGAAGGT----ATTTGCA-ATCACGACTCTC


[Download ClustalW]

#122

Mean pairwise ID: 23.16%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATA--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_E      TGGGCTGTC-------------------------------CCAGATGGCTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_E      -GGGCTAATTTCTGGCC-TGCCCTATCCAAGTAC-AGAGTT-GGATCATGTGGTCCAATT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_E      GAAAGAATGGGCTACTAGATTC-CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_E      GAGCAACGAAAAACTTCCGCTTT-GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT


LYC.ES_E      CCAAGTTCCATTAATGCCTGATGG--GCTGTTCTAG-TTAAACTACCACATTTT
YAR.LI_A      ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT--


[Download ClustalW]

#123

Mean pairwise ID: 23.28%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG
YAR.LI_A      CTT---------AGC-------TGTAA----TG---------GCATTTTGTCGGAGT--G


FUG.RUB.      ATCGCTTGAGCTCAGGA------------------------------GTTCTGGGCTTCA
YAR.LI_A      GTAAATC---GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC-------------


FUG.RUB.      GCGG-ACTATGTCGATCGGGTG-TCCGTACTAAGTTC-GGTAT--CGATATGGTGCTCCT
YAR.LI_A      ---TTGGCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTC


FUG.RUB.      GGGGGAGCCCGGGATCACCAGGTCG-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAAAC
YAR.LI_A      TGAGTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAAT


FUG.RUB.      GAAGCAGGTCAAAGCCCCCGTGCC-GCTCA-GTAGTG-GGATCGCGCCCGT-GAATAGA-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-A


FUG.RUB.      -CGCT---GTAGTTCAA-CCTGAGTAACACAGCGGG-ACTCAGTCTTT
YAR.LI_A      TATGTTAT---------GGAAGAT------ATTTACG--ATCACGATT


[Download ClustalW]

#124

Mean pairwise ID: 23.28%


LEI.MAJ.      GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
TRI.AE_C      ------------------------------------------------------------


LEI.MAJ.      CAGCGAGGGTGATTTGCTGCGTTGACGTGGTG-CTC-TGCTTGGCTG-TGTGT-CGGTGT
TRI.AE_C      -----------------------GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTGGACCGC


LEI.MAJ.      G-GCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCGAGGGAACCGGGTC
TRI.AE_C      -TTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTC-CATAATGTGGCAGGCACCGCGTG


LEI.MAJ.      AGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCAGAATC-ACACC
TRI.AE_C      AGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC-CAACGGTGGAAGGATAACG-GG


LEI.MAJ.      GCG--GA-GCATGTCC--------GCACTTGAGC----CCCACGCTT-CGTCGCG--AAG
TRI.AE_C      CCGCTG-CACT--CCTAGGCCGCT-TGGGCC-TCGTAG---CCTA--CTCCAGC-GACCA


LEI.MAJ.      CCTT-
TRI.AE_C      CCATC


[Download ClustalW]

#125

Mean pairwise ID: 23.36%


HUM.JA_B      GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--TTAGT
YAR.LI_B      --------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAATC-G


HUM.JA_B      TCGGC-------------------------------CCATTGGATCGGATCCAGTGTTAG
YAR.LI_B      CCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGGCTA-


HUM.JA_B      CTGCTTGCTGGGC-TGCCCATTCCAAGCCG-AGAGTT-GAGCTGTGTGAGCCGGACGAAG
YAR.LI_B      -------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTAA


HUM.JA_B      GTCTGGCTTGGTCAGCTC-CT-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGC
YAR.LI_B      TCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATCCAGC


HUM.JA_B      AGCGACAACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTGC-TTGGA
YAR.LI_B      AGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTATATG


HUM.JA_B      CCCACCATGGTTCACTGAG--CTGACTCTTAA-TAGGACCATTTCTTTT--
YAR.LI_B      TTAT---------------GGAAGGT----ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#126

Mean pairwise ID: 23.58%


HUM.LU_C      GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACT--TTGG
YAR.LI_B      ---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAATC-


HUM.LU_C      GTCAAC-------------------------------CCAGTGGTNCGGGNCCAGTGCTA
YAR.LI_B      GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGGCTA


HUM.LU_C      GCTGCTTACCCGGC-TGCCCATTCCAAGCCG-GGAGGT-GGGCTGAGGGACCTGGGCGAA
YAR.LI_B      --------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTA


HUM.LU_C      GGCTNNNGGNGCGCA-CTC-CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAG
YAR.LI_B      ATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATCCAG


HUM.LU_C      CAGCGACTACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCGCC-TTGA
YAR.LI_B      CAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTATAT


HUM.LU_C      GCCAACACTGTTCAACTGGG--CTGACTCTTAA-TAGGACCATTTCTTTT--
YAR.LI_B      GTTAT---------------GGAAGGT----ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#127

Mean pairwise ID: 23.60%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRI.AE_C      ------------------------------------------------------------


CAE.EL_B      AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCG-TCCGTGCCAAG
TRI.AE_C      ---------------------------------------GGTGGTC-TGCCCGTTCCAAG


CAE.EL_B      CGC-TGCGT-CACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAG
TRI.AE_C      TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTG


CAE.EL_B      TGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGG
TRI.AE_C      GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG


CAE.EL_B      CCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CCTTCTCAAT
TRI.AE_C      AAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA----


CAE.EL_B      ACCTTCAG-ACCACTTGTTTTT
TRI.AE_C      CTCCAGC-GACCACCATC----


[Download ClustalW]

#128

Mean pairwise ID: 23.66%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


HUM.LU_A      TGGGTCAAC-------------------------------CTAGTGGATCGGGTCCAGTG
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


HUM.LU_A      TTAGCTGCTTACTGGTC-TGCCCATTCCAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGC
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


HUM.LU_A      GAAGGGCTGGGTTGCGCACGTC-CT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


HUM.LU_A      GAGCAGCGACTACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTAC-C
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTA


HUM.LU_A      TGGGTCCACCATGCTTCACTAGG--CTGACTCTTAA-TAGGACCATTTCTTTT--
YAR.LI_B      TATGTTAT---------------GGAAGGT----ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#129

Mean pairwise ID: 23.75%


TET.ROS.      GCCAGGGTAGCA--ATGCCTGTGACCT--CGTGTGGC--ATAAACAATGT--AGTTA-GA
YAR.LI_A      CTT--------AGC-----TGTAA---TG-----GCATTTTGTCGGAGT-GGTAAATC--


TET.ROS.      ATAGTCA------------------------------GAGTATGAGAGTTTGATGAGACA
YAR.LI_A      GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC--------------------TTG


TET.ROS.      GTTTGCTAAGAGTGTG-CCCGTTCCAAACAG-TGAGT--TGCTATGGTGGAAACCTAGTA
YAR.LI_A      GCCA----TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTA


TET.ROS.      ATAGGACTTCACCAGGGCA-TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACA
YAR.LI_A      ATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCAATCCAGCA


TET.ROS.      GGGAAAACTTGCCGCTTA-TTGTG-GTGGAA-GGATAACATACTC-ATTAACTGTCAA--
YAR.LI_A      GAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATCGCAACCAAG--TGGT-ATATGTT


TET.ROS.      --GCTAATCGGTTCTG-CTATTCTGATCA-GACACT-----
YAR.LI_A      AT------------GGAAGAT--ATTTACG--ATCACGATT


[Download ClustalW]

#130

Mean pairwise ID: 23.84%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRI.AE_C      ------------------------------------------------------------


CAE.EL_D      AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCG-TCCGTGCCAAG
TRI.AE_C      ---------------------------------------GGTGGTC-TGCCCGTTCCAAG


CAE.EL_D      CGC-TACGT-CACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAG
TRI.AE_C      TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTG


CAE.EL_D      TCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGG
TRI.AE_C      GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG


CAE.EL_D      CCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CCTTCTCGAT
TRI.AE_C      AAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA----


CAE.EL_D      ACCTTCAG-ACCACTTATCATTT
TRI.AE_C      CTCCAGC-GACCACCATC-----


[Download ClustalW]

#131

Mean pairwise ID: 23.86%


HUM.JA_B      ---GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--TT
YAR.LI_A      CTT--------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAAT


HUM.JA_B      AGTTCGGC-------------------------------CCATTGGATCGGATCCAGTGT
YAR.LI_A      C-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGGC


HUM.JA_B      TAGCTGCTTGCTGGGC-TGCCCATTCCAAGCCG-AGAGTT-GAGCTGTGTGAGCCGGACG
YAR.LI_A      CA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAG


HUM.JA_B      AAGGTCTGGCTTGGTCAGCTC-CT-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAG
YAR.LI_A      TAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATCC


HUM.JA_B      AGCAGCGACAACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTGC-TT
YAR.LI_A      AGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTAT


HUM.JA_B      GGACCCACCATGGTTCACTGAG--CTGACTCTTAA-TAGGACCATTTCTTTT
YAR.LI_A      ATGTTAT---------------GGAAGAT----ATTTACG--ATCACGATT-


[Download ClustalW]

#132

Mean pairwise ID: 23.91%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
TRI.AE_C      ------------------------------------------------------------


CAE.EL_C      AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCG-TCCGTGCCAAG
TRI.AE_C      ---------------------------------------GGTGGTC-TGCCCGTTCCAAG


CAE.EL_C      CGC-TGCGT-CACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAG
TRI.AE_C      TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTG


CAE.EL_C      TGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTGG
TRI.AE_C      GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG


CAE.EL_C      CCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CCTTCTCAAT
TRI.AE_C      AAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA----


CAE.EL_C      ACCTTCAG-ACCACTTGTCACT
TRI.AE_C      CTCCAGC-GACCACCATC----


[Download ClustalW]

#133

Mean pairwise ID: 23.93%


HUM.LU_B      GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAAC-A-TTGG
YAR.LI_B      ---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAATC-


HUM.LU_B      GTCAGC-------------------------------CCAGTGGATCGGGTCCAGTGTTA
YAR.LI_B      GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGGCTA


HUM.LU_B      GCTGCTTACTGGTC-TGCCCATTCCAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGCGAA
YAR.LI_B      --------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTA


HUM.LU_B      GGCCTGGGTTGCGCAGCTC-CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAG
YAR.LI_B      ATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATCCAG


HUM.LU_B      CAGCGACTACCTCCCGCTCC-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTAC-TTGG
YAR.LI_B      CAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTATAT


HUM.LU_B      TCCA-CCATGTTCACTGGT-CCTGACTCTTAA-TCGGACCATTTCCTTT--
YAR.LI_B      GTTAT--------------GGAAGGT----ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#134

Mean pairwise ID: 23.94%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATA--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_E      TGGGCTGTC-------------------------------CCAGATGGCTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_E      -GGGCTAATTTCTGGCC-TGCCCTATCCAAGTAC-AGAGTT-GGATCATGTGGTCCAATT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_E      GAAAGAATGGGCTACTAGATTC-CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_E      GAGCAACGAAAAACTTCCGCTTT-GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT


LYC.ES_E      CCAAGTTCCATTAATGCCTGATGG--GCTGTTCTAG-TTAAACTACCACATTTT-
YAR.LI_B      ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#135

Mean pairwise ID: 23.94%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


HUM.LU_D      TGGGTCAAC-------------------------------CTAGTGGATCGGGTCCAGTG
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


HUM.LU_D      TTAGCTGCTTACTGGTC-TGCCCATTCCAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGC
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


HUM.LU_D      GAAGGCT-GGGTTGCGCAGCTC-CT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


HUM.LU_D      GAGCAGCGACTACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTAC-C
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTA


HUM.LU_D      TGGATCCACCATGCTTCACTGGG--CTGACTCTTAA-TAGGACCATTTCTTTT--
YAR.LI_B      TATGTTAT---------------GGAAGGT----ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#136

Mean pairwise ID: 23.94%


COL.BLU.      -CCGAACCTCATTACCTTGGCCTGTTACCCCAAG------TTGGGGGTCTTTAAGGTTAT
MUS.MU_A      GCC-------------------TGTAG-TTCCAGCTACTC-GGGAGGC---TGAGACAGG


COL.BLU.      TTGATK-TTKGG--CCTATGCTACCKGCCKGG-CTCTGGTCCTGCTTA-----TTCTGGC
MUS.MU_A      A-GGATCGCTT-GAGTCCAAGA---GTTCTGGGCTG--TAGTGC-GCTATGCC-GATCGG


COL.BLU.      C-CGCCCGTTCCAAGCCGGGAGTTGGCCCATGTGG-TTTATGCGAAGGTATAGGCTTCGG
MUS.MU_A      GTG-TCCGCACTAAGTTCGGCAA--CAATATGGTGACCTCCCGGGAGCGGGGGACCACCA


COL.BLU.      TGGTTCC-
MUS.MU_A      AGTTG--C


[Download ClustalW]

#137

Mean pairwise ID: 24.01%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAAT-A-T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_H      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_H      -GGGCTAATTTCTGACT-TGCCCTATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATT
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_H      GAAGAAATGGACTACTTGATTC-GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_H      GAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TGGT


LYC.ES_H      ATCAAGTTC-AGTAACGCCTAATGG--GTTGCTCCAA-TAAACAACCACCTTTT
YAR.LI_A      -ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#138

Mean pairwise ID: 24.08%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACT--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


HUM.LU_C      TGGGTCAAC-------------------------------CCAGTGGTNCGGGNCCAGTG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


HUM.LU_C      CTAGCTGCTTACCCGGC-TGCCCATTCCAAGCCG-GGAGGT-GGGCTGAGGGACCTGGGC
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


HUM.LU_C      GAAGGCTNNNGGNGCGCA-CTC-CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


HUM.LU_C      GAGCAGCGACTACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCGCC-T
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTA


HUM.LU_C      TGAGCCAACACTGTTCAACTGGG--CTGACTCTTAA-TAGGACCATTTCTTTT
YAR.LI_A      TATGTTAT---------------GGAAGAT----ATTTACG--ATCACGATT-


[Download ClustalW]

#139

Mean pairwise ID: 24.14%


LEP.COL.      GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGG-GAGCTGTCTG
LYC.ES_L      ---------------------------------------------G-TTG--GGTTGAC-


LEP.COL.      GACCAGCATAGG-GTGCTTG-CGGCGTT-----GACGTGGTG-CTC-TGCTTGGCTGTGT
LYC.ES_L      -CCAGAT-GGTTG-GGTTCGGT-AGGCTTATAGTCTGGCC-TGCCCTCTCCAAGCATGGA


LEP.COL.      GT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGT-TAA-AGTAG
LYC.ES_L      GTTGGATCA-----CGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-AAAGTGGG


LEP.COL.      AGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCACGTCTGCCGTTGC
LYC.ES_L      GTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCT-GTGCAGTGGA


LEP.COL.      AGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGCGC----CCCAGGCGA-
LYC.ES_L      AGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-GCTGCT--C


LEP.COL.      TCCTGTG--AAGCTTT---
LYC.ES_L      CAA-CTAAACCACCACTTT


[Download ClustalW]

#140

Mean pairwise ID: 24.14%


XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
TRI.AE_C      ------------------------------------------------------------


XEN.LAE.      CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTCGATCGGGTG-TCCGCACTAAGT
TRI.AE_C      --------------------------------------GGTGGTC-TGCCCGTTCCAAGT


XEN.LAE.      TC-GGTAT-CAATAT-GGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGAG
TRI.AE_C      TGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTC-CATAATGTG


XEN.LAE.      GGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTAG
TRI.AE_C      GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG


XEN.LAE.      TGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--CCTGAACAAC
TRI.AE_C      AAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA----


XEN.LAE.      ACAGCGAG-ACACAGTTCT
TRI.AE_C      CTCCAGC-GACCACCATC-


[Download ClustalW]

#141

Mean pairwise ID: 24.15%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAAC-A-T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


HUM.LU_B      TGGGTCAGC-------------------------------CCAGTGGATCGGGTCCAGTG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


HUM.LU_B      TTAGCTGCTTACTGGTC-TGCCCATTCCAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGC
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


HUM.LU_B      GAAGGCCTGGGTTGCGCAGCTC-CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


HUM.LU_B      GAGCAGCGACTACCTCCCGCTCC-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTAC-T
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTA


HUM.LU_B      TGGTCCA-CCATGTTCACTGGT-CCTGACTCTTAA-TCGGACCATTTCCTTT
YAR.LI_A      TATGTTAT--------------GGAAGAT----ATTTACG--ATCACGATT-


[Download ClustalW]

#142

Mean pairwise ID: 24.15%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
TRI.AE_C      ------------------------------------------------------------


CAE.EL_A      AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCG-TCCGTGCCAAG
TRI.AE_C      ---------------------------------------GGTGGTC-TGCCCGTTCCAAG


CAE.EL_A      CGC-TACGT-CACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAG
TRI.AE_C      TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTG


CAE.EL_A      TCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTGG
TRI.AE_C      GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG


CAE.EL_A      CCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CCTTCTCGAT
TRI.AE_C      AAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA----


CAE.EL_A      ACCTTCAG-ACCACTTATCATTT
TRI.AE_C      CTCCAGC-GACCACCATC-----


[Download ClustalW]

#143

Mean pairwise ID: 24.15%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACAC--
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


ARA.TH_E      TGGTTCGGG-------------------------------TCCACGGGCCGGTTCTGTTG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


ARA.TH_E      TTGGCATGTTTCTGGGC-TGCCCAGTCCAAGCTG-TGAGT--AAGACGTGTGTGTCAAGC
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


ARA.TH_E      GAAGGCTTGGCTCAAACGGCTT-CT-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCAC
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGAAACTTCAGTGGAGCA--AT


ARA.TH_E      AGAGCAGCGACTACTTCCCGCTTA-CAGCA-GTGGAC-GGATCACA-GTTTAGCGTCGC-
YAR.LI_A      CCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGT


ARA.TH_E      TCAGAACCACTATGGCCTGCTGGT--CCGATCTCAT-ATGAACCACCATTTT
YAR.LI_A      ATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#144

Mean pairwise ID: 24.27%


LEI.MAJ.      GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGAC
LYC.ES_D      ------------------------------------------------------------


LEI.MAJ.      CAGCGAGGGTGATTTGCTGCGTT---GACGTGGTG-CTC-TGCTTGGCTGTGTGT-CGGT
LYC.ES_D      ----------------------TAGTTCTGGCC-TGCCCTGTCCAAGCACAGAGTAGGAT


LEI.MAJ.      GTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCGAGGGAACCGGGT
LYC.ES_D      CA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-AAAGCGGGGCGGACCGCAT


LEI.MAJ.      CAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCAGAATC-ACAC
LYC.ES_D      GAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCAGTGGAAGGATAATG-G


LEI.MAJ.      CGCG--GA-GCATGTCC--------GCACTTGAGC----CCCACGCTT-CGTCGCG--AA
LYC.ES_D      GTCGGTG-TCTT-ATCAAGTTCAGT-AACGCC-TAATGG--GTTGCT-CCAA-CTAAACC


LEI.MAJ.      GCCTT----
LYC.ES_D      ACCACTTTT


[Download ClustalW]

#145

Mean pairwise ID: 24.29%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACT--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


CIN.HYB.      TGAGCTTGGC-------------------------------TTAGCTAGTTGGGTCTGTA
YAR.LI_A      TC--GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTG


CIN.HYB.      --GACACCGCACCTGGCT-TGCCCGTTCCAAGTCG-AGAGTG-GGTTCATGTTTCCTGAG
YAR.LI_A      GCCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTG


CIN.HYB.      CGAAGGCTCGGGTGATGTGAGCT-TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCA
YAR.LI_A      AGTAATCGGCTTTGAGATTTCCGTTCTAAGA-TTAACTGGGAAACTTCAGTGGAGCA--A


CIN.HYB.      CAGAGCTGCGAAAACCTCTACCTCT-CGACT-GTGGAA-GGATTACA-AGCCGGAGTGTC
YAR.LI_A      TCCAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG----TG


CIN.HYB.      --TTAGGCTC-ATATAACCAGCCTGG---CTAGCCCAA-CAGGACACCCATTT-
YAR.LI_A      GTATATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT


[Download ClustalW]

#146

Mean pairwise ID: 24.36%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


HUM.LU_A      TGGGTCAAC-------------------------------CTAGTGGATCGGGTCCAGTG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


HUM.LU_A      TTAGCTGCTTACTGGTC-TGCCCATTCCAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGC
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


HUM.LU_A      GAAGGGCTGGGTTGCGCACGTC-CT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


HUM.LU_A      GAGCAGCGACTACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTAC-C
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTA


HUM.LU_A      TGGGTCCACCATGCTTCACTAGG--CTGACTCTTAA-TAGGACCATTTCTTTT
YAR.LI_A      TATGTTAT---------------GGAAGAT----ATTTACG--ATCACGATT-


[Download ClustalW]

#147

Mean pairwise ID: 24.37%


TRY.BR_A      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
LYC.ES_L      -----------------------------------------------G-TTG--GGTTGA


TRY.BR_A      GA-CAAGCGGGG--GTTCTG-TTGCGTT-----GACTTGGTG-TTC-TGCTTGGTTGCGT
LYC.ES_L      C-CCAGAT-GGTTGGGTTCGGT-AGGCTTATAGTCTGGCC-TGCCCTCTCCAAGCATGGA


TRY.BR_A      GT-CGGTGTTGAGGTCGCCACTGTAGAGA-GGCGTTCTCGCGCCGT-TAA-AGTGGGGGG
LYC.ES_L      GTTGGATCA-CGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-AAAGTGGGGTGG


TRY.BR_A      AACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAGAA
LYC.ES_L      ACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCT-GTGCAGTGGAAGGA


TRY.BR_A      GC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCCAAG-TGT-CGT
LYC.ES_L      TAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG--GCTGCT--CCAA


TRY.BR_A      CGCG--AGGCGG----
LYC.ES_L      -CTAAACCACCACTTT


[Download ClustalW]

#148

Mean pairwise ID: 24.40%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAGCGGGGGCAATAAGGTGGTGTTGGATGC
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG---AAGTG


ORY.SA_B      -CTGGTCGTTTGCG---CTTGG-GGTCT--GCGCCTGTGGTTTGCACTATGCGGCC-CGC
SCH.POM.      TTTA---GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC------GAGTCT--C


ORY.SA_B      CCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCA
SCH.POM.      GCTTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGG


ORY.SA_B      C-CT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCT
SCH.POM.      CAGTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GT


ORY.SA_B      TC-CAACG-GTGGAA-GGATAACG-GGCCGCTGCAGC-CCTGGCCCGCTTCCGGCC-C-A
SCH.POM.      CTTGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT


ORY.SA_B      AGT--GCCTTCCATG-GCAGACCACCACCTTT
SCH.POM.      ---GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#149

Mean pairwise ID: 24.43%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCAGTGTGGTGGAATG--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_C      TGAACATGC-------------------------------CCAGAAGGTAGGGCTTGT--
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


LYC.ES_C      GTGACAATTCTCTGGCC-TGCCCTGTCCAAGCAA-AGAGTT-GGGTCTTGTGGGCCAAGC
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_C      GAAGGCTTGGGCTGCTGGGCTC-CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


LYC.ES_C      GAGCAACGAATAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAACG-AGCCAGTGTCAT-A
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTA


LYC.ES_C      TAAGTTCAACGAATGTCTGATGG--GCTGTTCTAG-TTAAACTACCACATTT
YAR.LI_A      TATGTTAT---------------GGAAGAT---ATTTACG--ATCACGATT-


[Download ClustalW]

#150

Mean pairwise ID: 24.61%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
TRI.AE_C      ------------------------------------------------------------


ORI.CUN.      CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTG-TCCGCACTAA
TRI.AE_C      ----------------------------------------GGTGGTC-TGCCCGTTCCAA


ORI.CUN.      GTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
TRI.AE_C      GTTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGT


ORI.CUN.      GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
TRI.AE_C      GGCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTG


ORI.CUN.      GTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGGGCAA
TRI.AE_C      GAAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA---


ORI.CUN.      CATAGCGAG-ACCCTGTCTCC
TRI.AE_C      -CTCCAGC-GACCACCATC--


[Download ClustalW]

#151

Mean pairwise ID: 24.61%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
TRI.AE_C      ------------------------------------------------------------


RAT.NOR.      CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTG-TCCGCACTAA
TRI.AE_C      ----------------------------------------GGTGGTC-TGCCCGTTCCAA


RAT.NOR.      GTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
TRI.AE_C      GTTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGT


RAT.NOR.      GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
TRI.AE_C      GGCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTG


RAT.NOR.      GTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGGGCAA
TRI.AE_C      GAAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA---


RAT.NOR.      CATAGCGAG-ACCC-GTCTCT
TRI.AE_C      -CTCCAGC-GACCACCATC--


[Download ClustalW]

#152

Mean pairwise ID: 24.62%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGCGCGGATGC-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


ZEA.MA_B      TTTGCGATGGT---TTCTG-GGCCT--GGGCTCGT--TGTGACTCTAGCCGGCT-TGCCC
SCH.POM.      TTA-GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


ZEA.MA_B      ATCCCAAGTTG-GTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-CAGAC
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCT-TCGTG-GCAACTGGCA


ZEA.MA_B      CT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTT
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTA-CCGG-GTC


ZEA.MA_B      C-CAACG-GTGGGA-GGATAACA-AGCCGCTGCACT-TTGAGCCCAACACAGACC-CAGA
SCH.POM.      TTGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT-


ZEA.MA_B      -TCC-TCTCTTA-GCAAACCACCATCTTT
SCH.POM.      GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#153

Mean pairwise ID: 24.65%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--T
YAR.LI_A      CTT---------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


HUM.LU_D      TGGGTCAAC-------------------------------CTAGTGGATCGGGTCCAGTG
YAR.LI_A      TC-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGG


HUM.LU_D      TTAGCTGCTTACTGGTC-TGCCCATTCCAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGC
YAR.LI_A      CCA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


HUM.LU_D      GAAGGCT-GGGTTGCGCAGCTC-CT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACA
YAR.LI_A      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATC


HUM.LU_D      GAGCAGCGACTACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTAC-C
YAR.LI_A      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTA


HUM.LU_D      TGGATCCACCATGCTTCACTGGG--CTGACTCTTAA-TAGGACCATTTCTTTT
YAR.LI_A      TATGTTAT---------------GGAAGAT----ATTTACG--ATCACGATT-


[Download ClustalW]

#154

Mean pairwise ID: 24.72%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAAT-A-T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_H      TGGGCTGTA-------------------------------CCAGATGGTTGGGCTTGGT-
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_H      -GGGCTAATTTCTGACT-TGCCCTATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATT
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_H      GAAGAAATGGACTACTTGATTC-GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_H      GAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG----TGGT


LYC.ES_H      ATCAAGTTC-AGTAACGCCTAATGG--GTTGCTCCAA-TAAACAACCACCTTTT--
YAR.LI_B      -ATATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#155

Mean pairwise ID: 24.84%


XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
LYC.ES_D      ------------------------------------------------------------


XEN.LAE.      CTTGAGTCCAGGAGTTCTGGGCTGCACTGAGCTATGTC---GATCGGGTG-TCCGCACTA
LYC.ES_D      -------------------------------------TAGTTCTGGCC-TGCCCTGTCCA


XEN.LAE.      AGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAAGGA
LYC.ES_D      AGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-AAAGC


XEN.LAE.      GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGATCAGTA
LYC.ES_D      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


XEN.LAE.      GTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--CCTGAACAA
LYC.ES_D      GAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--


XEN.LAE.      CACAGCGAG-ACACAGTTCT--
LYC.ES_D      -CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#156

Mean pairwise ID: 24.84%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
TRI.AE_C      ------------------------------------------------------------


RAT.RAT.      CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTG-TCCGCACTAA
TRI.AE_C      ----------------------------------------GGTGGTC-TGCCCGTTCCAA


RAT.RAT.      GTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
TRI.AE_C      GTTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGT


RAT.RAT.      GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
TRI.AE_C      GGCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTG


RAT.RAT.      GTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGGGCAA
TRI.AE_C      GAAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA---


RAT.RAT.      CATAGCGAG-ACCCCGTCTCTT
TRI.AE_C      -CTCCAGC-GACCACCATC---


[Download ClustalW]

#157

Mean pairwise ID: 24.92%


LEP.COL.      GCCGGAGCCTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGTCTGG
TRI.AE_C      ------------------------------------------------------------


LEP.COL.      ACCAGCATAGGGTGCTTGCGGCGTTGACGTGGTG-CTC-TGCTTGGCTG-TGTGT-CGGA
TRI.AE_C      -------------------------GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTGGACC


LEP.COL.      GGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGT-TAA-AGTAGAGGAACT
TRI.AE_C      GC----TTGGGGCCTATGCGAAAGT--TGGGCCTCA-CGGTCCATAATGTGGCAGGCACC


LEP.COL.      GGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCACGTCTGCCGTTGCAGAACC-
TRI.AE_C      GCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC-CAACGGTGGAAGGATAA


LEP.COL.      ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC----CCCAGGCGA-TCCTGTG-
TRI.AE_C      CG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA---CTCCAGC-G


LEP.COL.      -AAGCTTT-
TRI.AE_C      ACCACCATC


[Download ClustalW]

#158

Mean pairwise ID: 25.00%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
SCH.POM.      ----CGC---------------TGTAA----TG----------GC---TTGGTCG-AAGT


GAL.GAL.      CGCTTGAGCCCAGGA--GTTCTGGGCTG-----CAGTGC-GCTATGCCGAGCGGGCGTCC
SCH.POM.      GTTTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGC


GAL.GAL.      GCGCTAAGGCC-GGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG-C
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


GAL.GAL.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCC-GG
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGG


GAL.GAL.      TCA-GTAACG-GGATCGCGCCTGTGAATAGCCACTG-----CAGCGTAG-CCTGGGCAAC
SCH.POM.      GCAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT---


GAL.GAL.      ATAGCGAG-ACCCTGTCTCC
SCH.POM.      --AAACACA-ACGGTCGTT-


[Download ClustalW]

#159

Mean pairwise ID: 25.14%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCAGTGTGGTGGAATG--T
YAR.LI_B      ------------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAA


LYC.ES_C      TGAACATGC-------------------------------CCAGAAGGTAGGGCTTGT--
YAR.LI_B      TC-GCCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGG


LYC.ES_C      GTGACAATTCTCTGGCC-TGCCCTGTCCAAGCAA-AGAGTT-GGGTCTTGTGGGCCAAGC
YAR.LI_B      CTA--------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGA


LYC.ES_C      GAAGGCTTGGGCTGCTGGGCTC-CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACA
YAR.LI_B      GTAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATC


LYC.ES_C      GAGCAACGAATAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAACG-AGCCAGTGTCAT-A
YAR.LI_B      CAGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTA


LYC.ES_C      TAAGTTCAACGAATGTCTGATGG--GCTGTTCTAG-TTAAACTACCACATTT--
YAR.LI_B      TATGTTAT---------------GGAAGGT---ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#160

Mean pairwise ID: 25.16%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
TRI.AE_C      ------------------------------------------------------------


HOM.SA_A      CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTG-TCCGCACTAA
TRI.AE_C      ----------------------------------------GGTGGTC-TGCCCGTTCCAA


HOM.SA_A      GTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
TRI.AE_C      GTTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGT


HOM.SA_A      GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
TRI.AE_C      GGCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTG


HOM.SA_A      GTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGTGCAA
TRI.AE_C      GAAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA---


HOM.SA_A      CATAGCGAG-ACCCCGTCTCTT
TRI.AE_C      -CTCCAGC-GACCACCATC---


[Download ClustalW]

#161

Mean pairwise ID: 25.23%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
TRI.AE_C      ------------------------------------------------------------


HOM.SA_B      CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTG-TCCGCACTAA
TRI.AE_C      ----------------------------------------GGTGGTC-TGCCCGTTCCAA


HOM.SA_B      GTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
TRI.AE_C      GTTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGT


HOM.SA_B      GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
TRI.AE_C      GGCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTG


HOM.SA_B      GTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGAGCAA
TRI.AE_C      GAAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA---


HOM.SA_B      CATAGCGAG-ACCCCGTCTCT
TRI.AE_C      -CTCCAGC-GACCACCATC--


[Download ClustalW]

#162

Mean pairwise ID: 25.23%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
TRI.AE_C      ------------------------------------------------------------


CAN.SPE.      CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTG-TCCGCACTAA
TRI.AE_C      ----------------------------------------GGTGGTC-TGCCCGTTCCAA


CAN.SPE.      GTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGA
TRI.AE_C      GTTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGT


CAN.SPE.      GGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTA
TRI.AE_C      GGCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTG


CAN.SPE.      GTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGTGCAA
TRI.AE_C      GAAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA---


CAN.SPE.      CATAGCGAG-ACCCCGTCTCT
TRI.AE_C      -CTCCAGC-GACCACCATC--


[Download ClustalW]

#163

Mean pairwise ID: 25.24%


LEI.MAJ.      GCCGGAGCTCTGCTCTGTAACCTTCGGGGGCTAACCAGGCTTAGCGGGGAGGACGTGGA-
LYC.ES_L      --------------------------------------------G-TTG--GGTTGAC-C


LEI.MAJ.      CCAGCGAGGGTGATTTG-CTGCGTT-----GACGTGGTG-CTC-TGCTTGGCTGTGTGT-
LYC.ES_L      CAGAT-GGTTGGGTTCGGT-AGGCTTATAGTCTGGCC-TGCCCTCTCCAAGCATGGAGTT


LEI.MAJ.      CGGTGTGGCTTGCCCCCCTGCAGAGG-GTGGCGCGGGT-CCGCCGTTGAAGCGAGGGAAC
LYC.ES_L      GGATCA-CGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTC-CT-AAAGTGGGGTGGAC


LEI.MAJ.      CGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCAGAATC
LYC.ES_L      TGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCT-GTGCAGTGGAAGGATA


LEI.MAJ.      -ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----CCCACGCTT-CGTCGC
LYC.ES_L      ACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG--GCTGCT-CCAA-CT


LEI.MAJ.      G--AAGCCTT---
LYC.ES_L      AAACCACCACTTT


[Download ClustalW]

#164

Mean pairwise ID: 25.30%


XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
LYC.ES_L      ----------------------------------------------------------G-


XEN.LAE.      CTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC-----GATCGGGTG-TCCG
LYC.ES_L      TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCT


XEN.LAE.      CACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCT-CGGATCACCAGGTTGCTC
LYC.ES_L      CTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTC-CT


XEN.LAE.      TAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCCGA
LYC.ES_L      -AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGT


XEN.LAE.      TCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACAG--CC
LYC.ES_L      GCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-G


XEN.LAE.      TGAACAACACAGCGAG-ACACAGTTCT-
LYC.ES_L      CTGCT---CCAA-CTAAACCACCACTTT


[Download ClustalW]

#165

Mean pairwise ID: 25.31%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
SCH.POM.      ----CGC---------------TGTAA----TG----------GC---TTGGTCG-AAGT


HOM.SA_B      CGCTTGAGCCCAGGA--GTTCTGGGCTG-----TAGTGC-GCTATGCCGATGGGGTGTCC
SCH.POM.      GTTTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGC


HOM.SA_B      GCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG-C
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


HOM.SA_B      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GA
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGG


HOM.SA_B      TCA-GTAGTG-GGATCGCGCCTGTGAATAGCCACTG-----CACTCCAG-CCTGAGCAAC
SCH.POM.      GCAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT---


HOM.SA_B      ATAGCGAG-ACCCCGTCTCT
SCH.POM.      --AAACACA-ACGGTCGTT-


[Download ClustalW]

#166

Mean pairwise ID: 25.31%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_D      ------------------------------------------------------------


CAE.EL_D      AGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTC---GACCGAGCG-TCCGTGCC
LYC.ES_D      --------------------------------------TAGTTCTGGCC-TGCCCTGTCC


CAE.EL_D      AAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
LYC.ES_D      AAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGC


CAE.EL_D      GTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
LYC.ES_D      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


CAE.EL_D      GCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CCTTCTCGA
LYC.ES_D      GAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--


CAE.EL_D      TACCTTCAG-ACCACTTATCATTT
LYC.ES_D      -CCAA-CTAAACCACCACTTTT--


[Download ClustalW]

#167

Mean pairwise ID: 25.31%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
SCH.POM.      ----CGC---------------TGTAA----TG----------GC---TTGGTCG-AAGT


RAT.NOR.      CGATTGAGTCCAGGA--GTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTCC
SCH.POM.      GTTTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGC


RAT.NOR.      GCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG-C
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


RAT.NOR.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GA
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGG


RAT.NOR.      TCA-GTAGTG-GGATCGCGCCTGTGAATAGCCACTG-----CACTCCAG-CCTGGGCAAC
SCH.POM.      GCAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT---


RAT.NOR.      ATAGCGAG-ACCC-GTCTCT
SCH.POM.      --AAACACA-ACGGTCGTT-


[Download ClustalW]

#168

Mean pairwise ID: 25.32%


TRY.BR_B      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCTGATCCCGCTTAGCGGGGACGTCTTG
LYC.ES_L      -----------------------------------------------G-TTG--GGTTGA


TRY.BR_B      GA-CAAGCGGGG--GTTCTG-TTGCGTT-----GACTTGGTG-TTC-TGCTTGGTTGCGT
LYC.ES_L      C-CCAGAT-GGTTGGGTTCGGT-AGGCTTATAGTCTGGCC-TGCCCTCTCCAAGCATGGA


TRY.BR_B      GT-CGGTGTTGAGGTCGCCACTGTAGAGA-GGCGTTCTCGCGCCGT-TAA-AGTGGGGGG
LYC.ES_L      GTTGGATCA-CGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-AAAGTGGGGTGG


TRY.BR_B      AACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAGAA
LYC.ES_L      ACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCT-GTGCAGTGGAAGGA


TRY.BR_B      GC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCCAAG-TGT-CGT
LYC.ES_L      TAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG--GCTGCT--CCAA


TRY.BR_B      CGCG--AGGCGGTTT-
LYC.ES_L      -CTAAACCACCACTTT


[Download ClustalW]

#169

Mean pairwise ID: 25.36%


HUM.JA_A      ---GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACT--TT
YAR.LI_A      CTT--------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAAT


HUM.JA_A      GGGTCAGC-------------------------------CCATTGGATCGGGTCCAGTGT
YAR.LI_A      C-GTCTTCTTGTTGTGCGTTCGAGTCTTGGGCTCTGCAC----------------TTGGC


HUM.JA_A      TAGCTGCTTGCTGGTC-TGCCCATTCCAAGCCG-AGAGTT-GGGCTGTGTGATCTGGGCG
YAR.LI_A      CA--------TTTGGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAG


HUM.JA_A      AAGGCTGGGGTCGCACAGCTC-CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAG
YAR.LI_A      TAATCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGAAACTTCAGTGGAGCA--ATCC


HUM.JA_A      AGCAGCGACCACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGTCGGTGCTAC-TT
YAR.LI_A      AGCAGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATC-GCAACCAAG---TGGTAT


HUM.JA_A      GGGCCA-CCATGGTCACTGCA--TGCACTCTTAA-TCAGACCATCTCTTTT
YAR.LI_A      ATGTTAT--------------GGAAGAT----ATTTACG--ATCACGATT-


[Download ClustalW]

#170

Mean pairwise ID: 25.39%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
LYC.ES_D      ------------------------------------------------------------


GAL.GAL.      CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCC---GAGCGGGCG-TCCGCGC
LYC.ES_D      ---------------------------------------TAGTTCTGGCC-TGCCCTGTC


GAL.GAL.      TAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGG
LYC.ES_D      CAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAG


GAL.GAL.      AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCGGTCAGT
LYC.ES_D      CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT


GAL.GAL.      AACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--CCTGGGCA
LYC.ES_D      GGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT-


GAL.GAL.      ACATAGCGAG-ACCCTGTCTCC-
LYC.ES_D      --CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#171

Mean pairwise ID: 25.43%


HUM.JA_A      GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACT--TTGGG
YAR.LI_B      --------AGC-------TGTAA----TG----GCATTTTGTCGGAGT--GGTAAATC-G


HUM.JA_A      TCAGC-------------------------------CCATTGGATCGGGTCCAGTGTTAG
YAR.LI_B      CCTTCTTGTTGTGCGTTCGAGTTCTGGACTCTGCAC----------------TGGGCTA-


HUM.JA_A      CTGCTTGCTGGTC-TGCCCATTCCAAGCCG-AGAGTT-GGGCTGTGTGATCTGGGCGAAG
YAR.LI_B      -------CTTTGTTGTCCTTTCCGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTAA


HUM.JA_A      GCTGGGGTCGCACAGCTC-CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGC
YAR.LI_B      TCGGCTTTGAGATTTCCGTTCTAAGATTAACTGGGATACTTCAGTGGAGCA--ATCCAGC


HUM.JA_A      AGCGACCACCTCCCGCTCT-CGGCA-GTGGAA-GGATAACG-GGTCGGTGCTAC-TTGGG
YAR.LI_B      AGAGATCCAGTTGC---CGTGGGTATGGCGGTGGGATA-GCAACAAAG---TGGTATATG


HUM.JA_A      CCA-CCATGGTCACTGCA--TGCACTCTTAA-TCAGACCATCTCTTTT--
YAR.LI_B      TTAT--------------GGAAGGT----ATTTGCA--ATCACGACTCTC


[Download ClustalW]

#172

Mean pairwise ID: 25.45%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAGCGGGGGCATTAAGGTGGTGTGGATGT-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


ZEA.MA_F      TTCCTGACGGA---TTCTG-GGCCT--GGGCTTGT-ATGTGCCACTGGCCGGCC-TGCCC
SCH.POM.      TTA-GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


ZEA.MA_F      GTTCCAAGTTG-GTTGTG-GCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTAGAC
SCH.POM.      TTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA


ZEA.MA_F      CT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTT
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTA-CCGG-GTC


ZEA.MA_F      C-CAACG-GTGGGA-GGATAACA-GGCCGCTGCATT-GCAAGCCCAACTCGGTC--CAGA
SCH.POM.      TTGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT-


ZEA.MA_F      G--CC-TCATTAA-ACAGACCACCATCTTT
SCH.POM.      -GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#173

Mean pairwise ID: 25.53%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


ZEA.MA_D      TTTGCGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-TGCCC
SCH.POM.      TTA-GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


ZEA.MA_D      GTCCCAAGTTG-GTAGTG-GCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC
SCH.POM.      TTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA


ZEA.MA_D      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTT
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTA-CCGG-GTC


ZEA.MA_D      C-CAACG-GTGGGA-GGATAACA-GGCCGCTGCACT-TCGAGCCCAACTCAGGCC-CAGA
SCH.POM.      TTGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT-


ZEA.MA_D      G--CC-TCACTAA-GCAGACCACCATCTT
SCH.POM.      -GGAAGTAT--AAACACA-ACGGTCGTT-


[Download ClustalW]

#174

Mean pairwise ID: 25.54%


PER.AME.      ---GATCCGTAACGCGAGCTTATAACTCGAG------CGGGGGCTATAAAGGTGGTGTGG
MUS.MU_A      GCC-----------------TGTAGTTCCAGCTACTCGGGAGGC---TGAGACAGGA-GG


PER.AME.      AA-CGA---GCTGACTCGACCTGCCG-GGTTGGGCCAGG---GAC-TGCGGTGCTGGCT-
MUS.MU_A      ATCGCTTGAGTCCAAGA--GTTCTGGGCTG--TAGTGC-GCTATGCC-----GATCGGGT


PER.AME.      CGCCCGTTCCAAGTCGGGTAGTGGGCCATGTGG-CTTGGGCGAAGGCCTGGGTTTCTTGG
MUS.MU_A      G-TCCGCACTAAGTTCGGCAA-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAAG


PER.AME.      CC--
MUS.MU_A      TTGC


[Download ClustalW]

#175

Mean pairwise ID: 25.55%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
SCH.POM.      ----CGC---------------TGTAA----TG----------GC---TTGGTCG-AAGT


RAT.RAT.      CGCTTGAGTCCAGGA--GTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTCC
SCH.POM.      GTTTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGC


RAT.RAT.      GCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG-C
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


RAT.RAT.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GA
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGG


RAT.RAT.      TCA-GTAGTG-GGATCGCGCCTGTGAATAGCCACTG-----CACTCCAG-CCTGGGCAAC
SCH.POM.      GCAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT---


RAT.RAT.      ATAGCGAG-ACCCCGTCTCTT
SCH.POM.      --AAACACA-ACGGTCGTT--


[Download ClustalW]

#176

Mean pairwise ID: 25.62%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
SCH.POM.      ----CGC---------------TGTAA----TG----------GC---TTGGTCG-AAGT


CAN.SPE.      CGCTTGAGCCCAGGA--GTTCTGGGCTG-----CAGTGC-GCTATGCCGATCGGGTGTCC
SCH.POM.      GTTTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGC


CAN.SPE.      GCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG-C
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


CAN.SPE.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GA
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGG


CAN.SPE.      TCA-GTAGTG-GGATCGCGCCTGTGAATAGCCACTG-----CACTCCAG-CCTGTGCAAC
SCH.POM.      GCAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT---


CAN.SPE.      ATAGCGAG-ACCCCGTCTCT
SCH.POM.      --AAACACA-ACGGTCGTT-


[Download ClustalW]

#177

Mean pairwise ID: 25.62%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_D      ------------------------------------------------------------


CAE.EL_A      AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTC---GACCGAGCG-TCCGTGCC
LYC.ES_D      --------------------------------------TAGTTCTGGCC-TGCCCTGTCC


CAE.EL_A      AAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGA
LYC.ES_D      AAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGC


CAE.EL_A      GTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
LYC.ES_D      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


CAE.EL_A      GCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CCTTCTCGA
LYC.ES_D      GAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--


CAE.EL_A      TACCTTCAG-ACCACTTATCATTT
LYC.ES_D      -CCAA-CTAAACCACCACTTTT--


[Download ClustalW]

#178

Mean pairwise ID: 25.62%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
SCH.POM.      ----CGC---------------TGTAA----TG----------GC---TTGGTCG-AAGT


ORI.CUN.      CGCTTGAGTCCAGGA--GTTCTGGGCTG-----TCGTGC-GCTATGCCGATCGGGTGTCC
SCH.POM.      GTTTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGC


ORI.CUN.      GCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG-C
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


ORI.CUN.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GA
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGG


ORI.CUN.      TCA-GTAGTG-GGATCGCGCCTGTGAATAGCCACTG-----CACTCCAG-CCTGGGCAAC
SCH.POM.      GCAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT---


ORI.CUN.      ATAGCGAG-ACCCTGTCTCC
SCH.POM.      --AAACACA-ACGGTCGTT-


[Download ClustalW]

#179

Mean pairwise ID: 25.68%


SCH.POM.      CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAATAGTGCATGTTCGGTGGTCTCG
LYC.ES_D      ------------------------------------------------------------


SCH.POM.      GGTTC------GAGTCT--CGCTTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAG
LYC.ES_D      -----TAGTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTA-GGATCACGAGGCCCAAATG


SCH.POM.      TAGTCTTCGTG-GCAACTGGCAGTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAA
LYC.ES_D      AAAATATGGGCTTCTTGATTC-CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAG


SCH.POM.      TGCACATCA-CTACCGG-GTCTTGGGCAGTGCGATAGCGA--TGGGATTC----ACCT--
LYC.ES_D      AGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT-AT


SCH.POM.      --TCGCAG--GAT-GTGCAT---GGAAGTAT--AAACACA-ACGGTCGTT--
LYC.ES_D      CAAGTTCAGTAACGCC-TAATGG--GTTGCTCCAA-CTAAACCACCACTTTT


[Download ClustalW]

#180

Mean pairwise ID: 25.71%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
SCH.POM.      ----CGC---------------TGTAA----TG---------GC---TTGGTCG-AAGTG


FUG.RUB.      GCTTGAGCTCAGGA--GTTCTGGGCTT-----CAGCGG-ACTATGTCGATCGGGTGTCCG
SCH.POM.      TTTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCT


FUG.RUB.      TACTAAGTTC-GGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCG-CC
SCH.POM.      TTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGT


FUG.RUB.      TAAGGAGGGGTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCC-GCT
SCH.POM.      TAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGG


FUG.RUB.      CA-GTAGTG-GGATCGCGCCCGTGAATAGACGCT-----GTAGTTCAA-CCTGAGTAACA
SCH.POM.      CAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT----


FUG.RUB.      CAGCGGG-ACTCAGTCTTT
SCH.POM.      -AAACACA-ACGGTCGTT-


[Download ClustalW]

#181

Mean pairwise ID: 25.84%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGAATGC-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


ZEA.MA_A      TTTGCGATGGCT--TTCTG-GGCCCT-GGGCTCGT--TGTGACACTGGCCGGCT-TGCCC
SCH.POM.      TTA-GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


ZEA.MA_A      ATCCCAAGTTG-GTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-CAGAC
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCT-TCGTG-GCAACTGGCA


ZEA.MA_A      CT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTCC
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCT


ZEA.MA_A      -CAACG-GTGGGA-GGATAACGAAGCCGCTGCACT-TTGAGCCTAACTCAGGCT-CAGAA
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT--


ZEA.MA_A      --CC-TCACTAA-GCAAACCACCATCTTT
SCH.POM.      GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#182

Mean pairwise ID: 25.84%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGCCCGCCGGAT
LYC.ES_L      ------------------------------------------------------------


GAL.GAL.      CGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC-----GAGCGGGCG-TC
LYC.ES_L      G-TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCC


GAL.GAL.      CGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCG-AGGCACACCAGGTTGC
LYC.ES_L      CTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCC


GAL.GAL.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCCG
LYC.ES_L      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTG


GAL.GAL.      GTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTAG--C
LYC.ES_L      TGCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-


GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC
LYC.ES_L      GCTGCT---CCAA-CTAAACCACCACTTT


[Download ClustalW]

#183

Mean pairwise ID: 25.84%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


ZEA.MA_G      TTTGCGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-TGCCC
SCH.POM.      TTA-GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


ZEA.MA_G      GTCCCAAGTTG-GTAGTG-GCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC
SCH.POM.      TTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA


ZEA.MA_G      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCT


ZEA.MA_G      -CAACG-GTGGGA-GGATAACG-GGCCGCTGCACT-TCGAGCCCAACTCAGGCC-CAGAG
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT--


ZEA.MA_G      --CC-TCACTAA-GCAGACCACCATCTTT
SCH.POM.      GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#184

Mean pairwise ID: 26.09%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
LYC.ES_D      ------------------------------------------------------------


FUG.RUB.      GCTTGAGCTCAGGAGTTCTGGGCTTCAGCGGACTATGTC---GATCGGGTG-TCCGTACT
LYC.ES_D      --------------------------------------TAGTTCTGGCC-TGCCCTGTCC


FUG.RUB.      AAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTAAGGA
LYC.ES_D      AAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGC


FUG.RUB.      GGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAGTA
LYC.ES_D      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


FUG.RUB.      GTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CCTGAGTAA
LYC.ES_D      GAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--


FUG.RUB.      CACAGCGGG-ACTCAGTCTTT-
LYC.ES_D      -CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#185

Mean pairwise ID: 26.09%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
TRI.AE_C      ------------------------------------------------------------


CAE.BRI.      AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCG-TCCGTGCCAAG
TRI.AE_C      ---------------------------------------GGTGGTC-TGCCCGTTCCAAG


CAE.BRI.      CGC-TGCGT-CGCCAG-GGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAG
TRI.AE_C      TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTG


CAE.BRI.      TGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTGG
TRI.AE_C      GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG


CAE.BRI.      CCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--CCTCTCTGAT
TRI.AE_C      AAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA----


CAE.BRI.      ACCTTCAG-ACCACTTGTCATT
TRI.AE_C      CTCCAGC-GACCACCATC----


[Download ClustalW]

#186

Mean pairwise ID: 26.10%


XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGCTTGGGCTGTCGGATCG
SCH.POM.      ----CGC---------------TGTAA---TG---------GC---TTGGTCG-AAGTGT


XEN.LAE.      CTTGAGTCCAGGA--GTTCTGGGCTG-----CACTGA-GCTATGTCGATCGGGTGTCCGC
SCH.POM.      TTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGCTT


XEN.LAE.      ACTAAGTTC-GGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTG-CTC
SCH.POM.      TCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA-GT


XEN.LAE.      TAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCC-GAT
SCH.POM.      TAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGG


XEN.LAE.      CA-GTAGTG-GGATCGCGCCTGTGAATAGCCGGTG-----CAGAACAG-CCTGAACAACA
SCH.POM.      CAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT----


XEN.LAE.      CAGCGAG-ACACAGTTCT
SCH.POM.      -AAACACA-ACGGTCGTT


[Download ClustalW]

#187

Mean pairwise ID: 26.14%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGCGGATTC-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


ZEA.MA_E      TTTGCGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-TGCCC
SCH.POM.      TTA-GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


ZEA.MA_E      GTCCCAAGTTG-GTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGACC
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


ZEA.MA_E      T-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTTC
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTA-CCGG-GTCT


ZEA.MA_E      -CAACG-GTGGGA-GGATAACG-GGCCGCTGCACT-TCGAGCCCAACTCAGGCC-CAGAG
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT--


ZEA.MA_E      --CC-TCACTAA-GCAGACCACCATCTTT
SCH.POM.      GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#188

Mean pairwise ID: 26.17%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
SCH.POM.      ----CGC---------------TGTAA----TG----------GC---TTGGTCG-AAGT


HOM.SA_A      CGCTTGAGTCCAGGA--GTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTCC
SCH.POM.      GTTTA--GTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC---GAGTCT-CGC


HOM.SA_A      GCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG-C
SCH.POM.      TTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


HOM.SA_A      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GA
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGG


HOM.SA_A      TCA-GTAGTG-GGATCGCGCCTGTGAATAGCCACTG-----CACTCCAG-CCTGTGCAAC
SCH.POM.      GCAGTGCGATAGCGA-TGGGATTC--ACCT--TCGCAGGAT-GTGCAT-GGAAGTAT---


HOM.SA_A      ATAGCGAG-ACCCCGTCTCTT
SCH.POM.      --AAACACA-ACGGTCGTT--


[Download ClustalW]

#189

Mean pairwise ID: 26.28%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACT--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


CIN.HYB.      TGAGCTTGGC---TTAGCT-AGTTG---GGTCTGTA--GACACCGCACCTGGCT-TGCCC
SCH.POM.      TA-GTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


CIN.HYB.      GTTCCAAGTCG-AGAGTG-GGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT-
SCH.POM.      TTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA


CIN.HYB.      TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTC
SCH.POM.      GTTAAAC-CGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTC


CIN.HYB.      T-CGACT-GTGGAA-GGATTACA-AGCCGGAGTGTC--TTAGGCTC-ATATAACCAG--C
SCH.POM.      TTGGGCAGTGCGATAGCGA--TGGGATTC-----ACCT---TCGCAG----GAT-GTGCA


CIN.HYB.      CTGG---CTAGCCCAA-CAGGACACCCATTT
SCH.POM.      T---GGAAGTAT--AAACACA-ACGGTCGTT


[Download ClustalW]

#190

Mean pairwise ID: 26.32%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
LYC.ES_D      ------------------------------------------------------------


CAE.EL_C      AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTC---GACCGAGCG-TCCGTGCC
LYC.ES_D      --------------------------------------TAGTTCTGGCC-TGCCCTGTCC


CAE.EL_C      AAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGA
LYC.ES_D      AAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGC


CAE.EL_C      GTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
LYC.ES_D      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


CAE.EL_C      GCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CCTTCTCAA
LYC.ES_D      GAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--


CAE.EL_C      TACCTTCAG-ACCACTTGTCACT
LYC.ES_D      -CCAA-CTAAACCACCACTTTT-


[Download ClustalW]

#191

Mean pairwise ID: 26.36%


ZEA.MA_C      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGTGGAT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_C      GC-TTG---GTACCGTGTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TGCCCG
TRY.BR_A      GCGGGGACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT---GACTTGGTG-TTC-


ZEA.MA_C      TTCCAAGTTGGTAGTGGCCGTT-GGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGGACC
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGA-GGCGTTCTCGCGCCG-T


ZEA.MA_C      T-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTAT-
TRY.BR_A      -TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGT


ZEA.MA_C      TAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAGAC-
TRY.BR_A      TCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC---C


ZEA.MA_C      TTC-ATA--CTAAAGCAGACCACCATTTTT
TRY.BR_A      CCAAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#192

Mean pairwise ID: 26.40%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
LYC.ES_D      ------------------------------------------------------------


DRO.MEL.      TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTT---GACGGAACG-TCCGCACT
LYC.ES_D      --------------------------------------TAGTTCTGGCC-TGCCCTGTCC


DRO.MEL.      AAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGA
LYC.ES_D      AAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGC


DRO.MEL.      GGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTA
LYC.ES_D      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


DRO.MEL.      GTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG--CCCAACCGA
LYC.ES_D      GAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--


DRO.MEL.      TATGGTTGG-ACCACAATCTTT
LYC.ES_D      -CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#193

Mean pairwise ID: 26.44%


LYC.ES_F      GCC-GAGCTTTGTAACGTGGGCTTGTAACCCGAG--TGGGGGCAACAATGTGGTGGAATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_F      --TTG--GGTCCAT-CTTGAT-GGATGGGCTTGAA-GGGCTAATGTTCTGGCC-TGCCCT
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT-----GACTTGGTG-TTC-


LYC.ES_F      GTCCAAGCACAGAGTTGGGTCA-AGTGGTCTATACGAAAGTATAG-CCACTTGGCCTTT-
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


LYC.ES_F      AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT-GT
TRY.BR_A      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


LYC.ES_F      GCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATAG-
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC--------TTTGCGC----C


LYC.ES_F      -GTTGCC--TAA-TTAAACCATCACTTTT
TRY.BR_A      CCAAG-TGTCGTCGCG--AGGCGG-----


[Download ClustalW]

#194

Mean pairwise ID: 26.48%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
TRI.AE_C      ------------------------------------------------------------


DRO.MEL.      TGAGGCTGGGATCTACTGCGTAGCGGACCAGCTCATGTTGACGGAACG-TCCGCACTAAG
TRI.AE_C      ---------------------------------------GGTGGTC-TGCCCGTTCCAAG


DRO.MEL.      CTT-GCCAT-CAATAT-GGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAG
TRI.AE_C      TTGAGTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTG


DRO.MEL.      GGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAG
TRI.AE_C      GCAGGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGG


DRO.MEL.      TGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG--CCCAACCGAT
TRI.AE_C      AAGGATAACG-GGCCGCTG-CACT--CCTAGGCCGCTTGGGCC-TCGTAG--CCTA----


DRO.MEL.      ATGGTTGG-ACCACAATCTTT
TRI.AE_C      CTCCAGC-GACCACCATC---


[Download ClustalW]

#195

Mean pairwise ID: 26.52%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAGTGGGGACAATAAGGTGGTGGAACAG--
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


ARA.TH_D      TGGTTCAAT---TCCTCG-GGTC---GGACCTGATGCTGACATATATCTGAGC-TGCCCA
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


ARA.TH_D      GTCCAAGCTG-TGAGT-AATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-CT
SCH.POM.      TTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGT


ARA.TH_D      -AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA-
SCH.POM.      TAAAC-CGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


ARA.TH_D      CAGCA-GTGGAT-GGATCATA-GTTCGAAGTCTC-TCAGATCCACTATGGCC-CGCTGGT
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----


ARA.TH_D      --TCGATCTCTC-CTGGACCACCACTTT
SCH.POM.      GGAAGTAT--AAACACA-ACGGTCGTT-


[Download ClustalW]

#196

Mean pairwise ID: 26.67%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_I      TGGGCTGTA---CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_I      ATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC-G
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_I      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_I      AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT--CTGAGTCC-AGTAACGCC-TGATG
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC-----ACCT---TCGCAG---GAT-GTGCAT--


LYC.ES_I      G--GTTGCTCCAA-TTAAACCACCATTTTT
SCH.POM.      -GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#197

Mean pairwise ID: 26.77%


TRI.AE_B      NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGGCATTGAGGCGGTGTGGATGC-T
SCH.POM.      ----CGC--------------TGTAA----TG----GC------TTGGTCG--AAGTGTT


TRI.AE_B      TGGTGCGGT---TTGTT-GGCCT--GGGCTTGTGATGTAACCTTGCTGGCC-TGCCCGTT
SCH.POM.      TAGTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC------GAGTCT--CGCTTT


TRI.AE_B      CCAAGTTG-GTAGT-GGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC--CT-T
SCH.POM.      CG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTA


TRI.AE_B      AAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC-CAA
SCH.POM.      AACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTTGGG


TRI.AE_B      CG-GTGGAA-GGATAACA-GGCCGCTGCAGC-ATGGGCCCGCTCTGGGCCTCCTA--CCC
SCH.POM.      CAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT-GGAAG


TRI.AE_B      CGCCAT-A-GCAGACCACCATCTTT
SCH.POM.      TAT---AAACACA-ACGGTCGTT--


[Download ClustalW]

#198

Mean pairwise ID: 26.85%


SCH.POM.      CGCTGTAATGGCTTGGTCGAAGTGTTTAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCT
LYC.ES_L      -----------------------G-TTGGGTTGAC---CCAGAT-GGTTG---GGTTCGG


SCH.POM.      CGGGTTC--------GAGTCT--CGCTTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGA
LYC.ES_L      T--AGGCTTATAGTCTGGCC-TGCCCTCTCCAAGCAT-GGAGTT-GGATCACGTGGCTTA


SCH.POM.      AGAGTAGTCT-TCGTG-GCAACTGGCAGTTAAACCGTGTAGTACCGATGGAGGTTGGAA-
LYC.ES_L      GTCGAAAGACCTGGGTTGCTTGATTC-CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTT


SCH.POM.      -ACAATGCACATCA-CTACCGG-GTCTTGGGCAGTGCGATAGCGA--TGGGATTC----A
LYC.ES_L      CACAGAGCAACGAACAGCTTCCGCTCT-GTGCA-GTGGAA-GGATAACG-GGTCAGTGCT


SCH.POM.      CCT----TCGCAG----GAT-GTGCAT---GGAAGTAT--AAACACA-ACGGTCGTT-
LYC.ES_L      C--AGCGAGTCC-AGTTAACGCCCTGATGG--GCTGCTCCAA-CTAAACCACCACTTT


[Download ClustalW]

#199

Mean pairwise ID: 26.89%


TET.THE.      GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
TRI.AE_C      ------------------------------------------------------------


TET.THE.      GATATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTG-CCCGCTCCAAACAA-TGAGT-
TRI.AE_C      -----------------------------GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTG


TET.THE.      TGCTAT-GGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAGGAAACG
TRI.AE_C      GACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTGGCAGGCACCG


TET.THE.      CCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGATA-AC
TRI.AE_C      CGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAACG


TET.THE.      ATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTACTATCA--AAGCCA-GACA
TRI.AE_C      -GGCCGCTGCACT--CCTAGGCCGCTTGGGCCTCGTAG---CCTA--CTCCAGC-GACCA


TET.THE.      TT---
TRI.AE_C      CCATC


[Download ClustalW]

#200

Mean pairwise ID: 26.91%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAGCGGGGGCATTAAGGTGGTGTGGATGC-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


ZEA.MA_C      TTG-GTACCGT--GTCTT-TGCCT--GGGTTCATGGTGTGCCTTTGTTGGCC-TGCCCGT
SCH.POM.      TTAGTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC------GAGTCT--CGCTT


ZEA.MA_C      TCCAAGTTG-GTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGGACCT
SCH.POM.      TCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCT-TCGTG-GCAACTGGCAGT


ZEA.MA_C      -ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTAT-T
SCH.POM.      TAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTTG


ZEA.MA_C      AACG-GTGGAA-GGATAACA-GGCCACTGCAGC-ATGGGCTCGCTTAAGGCC-TAGAC-T
SCH.POM.      GGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT--GG


ZEA.MA_C      TC-ATACTAAAGCAGACCACCATTTTT
SCH.POM.      AAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#201

Mean pairwise ID: 26.93%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_D      ------------------------------------------------------------


CAE.EL_B      AGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTC---GACCGAGCG-TCCGTGCC
LYC.ES_D      --------------------------------------TAGTTCTGGCC-TGCCCTGTCC


CAE.EL_B      AAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGA
LYC.ES_D      AAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGC


CAE.EL_B      GTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
LYC.ES_D      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


CAE.EL_B      GCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CCTTCTCAA
LYC.ES_D      GAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--


CAE.EL_B      TACCTTCAG-ACCACTTGTTTTT
LYC.ES_D      -CCAA-CTAAACCACCACTTTT-


[Download ClustalW]

#202

Mean pairwise ID: 26.93%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
LYC.ES_D      ------------------------------------------------------------


ORI.CUN.      CGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCC---GATCGGGTG-TCCGCAC
LYC.ES_D      ---------------------------------------TAGTTCTGGCC-TGCCCTGTC


ORI.CUN.      TAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LYC.ES_D      CAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAG


ORI.CUN.      AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
LYC.ES_D      CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT


ORI.CUN.      AGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGGGCA
LYC.ES_D      GGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT-


ORI.CUN.      ACATAGCGAG-ACCCTGTCTCC-
LYC.ES_D      --CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#203

Mean pairwise ID: 26.97%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAATGTGGTGGAATG--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_N      TGGGCTGTA---CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_N      ATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC-G
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_N      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_N      AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT--CTGAGTCC-AGTAACGCC-TGATG
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC-----ACCT---TCGCAG---GAT-GTGCAT--


LYC.ES_N      G--GTTGCTCCAA-TTAAACCACCATTTTT
SCH.POM.      -GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#204

Mean pairwise ID: 27.08%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAGCGGGGGCACTAAAGGTGGCTGCGGATG
SCH.POM.      ----CGC---------------TGTAA----TG----GC-------TTGGTCG---AAGT


ORY.SA_A      T-TTGGTGTGGATTCTG--ATCCTG-GGCCC--CATGTTGTTGTAATCTTGCTGGCT-TG
SCH.POM.      GTTTA----GTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC----GAGTCT--


ORY.SA_A      CCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCT
SCH.POM.      CGCTTTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGG


ORY.SA_A      CCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCC
SCH.POM.      CA----GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCG


ORY.SA_A      CGCTTC-CATCG-GTGGAA-GGATAACA-GGCTGCTGCACC-TTGGGCCCGCTTCTGGCC
SCH.POM.      G-GTCTTGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GT


ORY.SA_A      -CAGAGT--CCCTCTACAA--CAGACCACCATCTTT
SCH.POM.      GCAT---GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#205

Mean pairwise ID: 27.13%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGCTGAGGCTGGCGGATC
LYC.ES_L      -----------------------------------------------------------G


FUG.RUB.      GCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC-----GATCGGGTG-TCC
LYC.ES_L      -TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCC


FUG.RUB.      GTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCC-GGGATCACCAGGTCGCC
LYC.ES_L      TCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT


FUG.RUB.      TAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCGC
LYC.ES_L      -AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGT


FUG.RUB.      TCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCAA--CC
LYC.ES_L      GCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-G


FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT
LYC.ES_L      CTGCT---CCAA-CTAAACCACCACTTT


[Download ClustalW]

#206

Mean pairwise ID: 27.18%


TET.ROS.      GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAGTCAGA
LYC.ES_D      ------------------------------------------------------------


TET.ROS.      GTATGAGAGTTTGATGAGACAGTTTGCT---AAGAGTGTG-CCCGTTCCAAACAGTGAGT
LYC.ES_D      ---------------------------TAGTTCTGGCC-TGCCCTGTCCAAGCACAGAGT


TET.ROS.      -TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAGGAACCG
LYC.ES_D      AGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGCGGGGCGGACCG


TET.ROS.      CCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATA-AC
LYC.ES_D      CATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAATG


TET.ROS.      ATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-CTATTC--TGATCA-GAC
LYC.ES_D      -GGTCGGTGTCTT-ATCAAGTTCAGTAACGCCTAATGG---GTTGCT-CCAA-CTAAACC


TET.ROS.      ACT------
LYC.ES_D      ACCACTTTT


[Download ClustalW]

#207

Mean pairwise ID: 27.24%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
LYC.ES_D      ------------------------------------------------------------


CAN.SPE.      CGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCC---GATCGGGTG-TCCGCAC
LYC.ES_D      ---------------------------------------TAGTTCTGGCC-TGCCCTGTC


CAN.SPE.      TAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LYC.ES_D      CAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAG


CAN.SPE.      AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
LYC.ES_D      CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT


CAN.SPE.      AGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGTGCA
LYC.ES_D      GGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT-


CAN.SPE.      ACATAGCGAG-ACCCCGTCTCT-
LYC.ES_D      --CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#208

Mean pairwise ID: 27.24%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
LYC.ES_D      ------------------------------------------------------------


RAT.NOR.      CGATTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCC---GATCGGGTG-TCCGCAC
LYC.ES_D      ---------------------------------------TAGTTCTGGCC-TGCCCTGTC


RAT.NOR.      TAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LYC.ES_D      CAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAG


RAT.NOR.      AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
LYC.ES_D      CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT


RAT.NOR.      AGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGGGCA
LYC.ES_D      GGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT-


RAT.NOR.      ACATAGCGAG-ACCC-GTCTCT-
LYC.ES_D      --CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#209

Mean pairwise ID: 27.27%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAGTGGAGACAATAAGGGGATGGGACG--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


ARA.TH_C      TGGGTCGAT---CTCATTG-GGCC---GGGTTCGGGTTGGGCTATATTCTGGCC-CGCCC
SCH.POM.      TAGTACTCCCAA--TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGC


ARA.TH_C      ATTCCAAGTTG-GGAGTT-GAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT-
SCH.POM.      TTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCT


ARA.TH_C      -TGACG-GTGGAA-GGATTACG-GGCCATTGCCT--TCCGAGCCCACTATGACC-CAATA
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT--


ARA.TH_C      AG---CCGCTCCGA-TTGGACCATCACTTT
SCH.POM.      --GGAAGTAT--AAACACA-ACGGTCGTT-


[Download ClustalW]

#210

Mean pairwise ID: 27.30%


TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A
ZEA.MA_H      NCC-GAGCTCTGTAGCGAGTGCTTGTAACCCGAG--CGGGGGCAATAAGGTAGTGTGGAT


TRY.BR_A      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTGT-TGCGTT----GACTTGGTG-TTC
ZEA.MA_H      GT-CAAT--TGT-GGT-GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-CACCC


TRY.BR_A      -TGCTTGGTTG-CGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT
ZEA.MA_H      ATTCCAAGTTGCGTAGTGGGTTTC-GGATGCCTTGGCGAAAGCTTTG-CATCC-CAACAC


TRY.BR_A      -TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGT
ZEA.MA_H      T-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCAC-


TRY.BR_A      TCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC----TTTGCGCCCCAAGT
ZEA.MA_H      CAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT--------------


TRY.BR_A      GTCGTCGCGAGGCGG
ZEA.MA_H      ---------------


[Download ClustalW]

#211

Mean pairwise ID: 27.33%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG--TGGAGACAATAAGGGGATGGGACG-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


ARA.TH_C      -TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


ARA.TH_C      TTCCAAGTTGGGAGTTGAGGCA-----TGGGCTTCGAGCGAAGGCT-CGGGTCTCATGTC
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


ARA.TH_C      TTCT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


ARA.TH_C      CT-TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAA
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGCGC-


ARA.TH_C      TAAG--CCGCT--CCGA-TTGGACCATCACTTT
LEP.COL.      ----CCCAGGCGA-TCCTGTG--AAGCTTT---


[Download ClustalW]

#212

Mean pairwise ID: 27.36%


TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A
ZEA.MA_H      NCC-GAGCTCTGTAGCGAGTGCTTGTAACCCGAG--CGGGGGCAATAAGGTAGTGTGGAT


TRY.BR_B      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTGT-TGCGTT----GACTTGGTG-TTC
ZEA.MA_H      GT-CAAT--TGT-GGT-GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-CACCC


TRY.BR_B      -TGCTTGGTTG-CGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT
ZEA.MA_H      ATTCCAAGTTGCGTAGTGGGTTTC-GGATGCCTTGGCGAAAGCTTTG-CATCC-CAACAC


TRY.BR_B      -TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGT
ZEA.MA_H      T-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCAC-


TRY.BR_B      TCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC----TTTGCGCCCCAAGT
ZEA.MA_H      CAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT--------------


TRY.BR_B      GTCGTCGCGAGGCGGTTT
ZEA.MA_H      ------------------


[Download ClustalW]

#213

Mean pairwise ID: 27.36%


LYC.ES_F      GCC-GAGCTTTGTAACGTGGGCTTGTAACCCGAG--TGGGGGCAACAATGTGGTGGAATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_F      --TTG--GGTCCAT-CTTGAT-GGATGGGCTTGAA-GGGCTAATGTTCTGGCC-TGCCCT
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT-----GACTTGGTG-TTC-


LYC.ES_F      GTCCAAGCACAGAGTTGGGTCA-AGTGGTCTATACGAAAGTATAG-CCACTTGGCCTTT-
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


LYC.ES_F      AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT-GT
TRY.BR_B      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


LYC.ES_F      GCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATAG-
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC--------TTTGCGC----C


LYC.ES_F      -GTTGCC--TAA-TTAAACCATCACTTTT
TRY.BR_B      CCAAG-TGTCGTCGCG--AGGCGGTTT--


[Download ClustalW]

#214

Mean pairwise ID: 27.36%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCGGAGGAT
LYC.ES_L      ------------------------------------------------------------


ORI.CUN.      CGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC-----GATCGGGTG-TC
LYC.ES_L      G-TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCC


ORI.CUN.      CGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGTTGC
LYC.ES_L      CTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCC


ORI.CUN.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTG
LYC.ES_L      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTG


ORI.CUN.      ATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--C
LYC.ES_L      TGCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-


ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC
LYC.ES_L      GCTGCT---CCAA-CTAAACCACCACTTT


[Download ClustalW]

#215

Mean pairwise ID: 27.38%


LEP.COL.      GCCGGAGCCTTGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AACAGG-GAG
LYC.ES_M      ----------------------CAAG--TGGGGATGTTAAGGTGGTGGAATA--TTG--G


LEP.COL.      CTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-TGCTTGG
LYC.ES_M      GCTGTC--CCAGAT-GGCTG-GGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTGTCCAAG


LEP.COL.      CTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGT-TAA
LYC.ES_M      CACAGAGTTGGATCA-----CGAGGCCCAAATGAAAATA-TGGGCTTCTTGATTCCT-AA


LEP.COL.      -AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCACGTCTGC
LYC.ES_M      AGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGC


LEP.COL.      CGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC----CCCAG
LYC.ES_M      AGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-GTTG


LEP.COL.      GCGA-TCCTGTG--AAGCTTT----
LYC.ES_M      CT--CCAA--TAAACAACCACCTTT


[Download ClustalW]

#216

Mean pairwise ID: 27.42%


TET.THE.      GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTTGTGATAGATAG
LYC.ES_D      ------------------------------------------------------------


TET.THE.      GATATGAGAGTTTGATGAGACAGTTTGCT---AAGAGTGTG-CCCGCTCCAAACAATGAG
LYC.ES_D      ----------------------------TAGTTCTGGCC-TGCCCTGTCCAAGCACAGAG


TET.THE.      T-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAGGAAAC
LYC.ES_D      TAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGCGGGGCGGACC


TET.THE.      GCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAGGATA-A
LYC.ES_D      GCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGATAAT


TET.THE.      CATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-CTATCA--AAGCCA-GA
LYC.ES_D      G-GGTCGGTGTCTT-ATCAAGTTCAGTAACGCCTAATGG---GTTGCT-CCAA-CTAAAC


TET.THE.      CATT------
LYC.ES_D      CACCACTTTT


[Download ClustalW]

#217

Mean pairwise ID: 27.42%


TET.THE.      GCCAGGGTAGCAATACCTGTGTCTA--TATGTGGCATAAACAATGT--AGGTT--GTGAT
SCH.POM.      -----CGC---------TGTAA---TG-----GC----TTGGTCG-AAGTGTTTA--GTA


TET.THE.      AGATA--GGATATGAGAGTTT-GATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACA
SCH.POM.      CTCCCAA--TAGTGCATGTT-CGGTGGTCTCGGGTTC---GAGTCT-CGCTTTCG-ATCC


TET.THE.      A-TGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCA-TTAAAGAGCTA
SCH.POM.      CTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTAAACCGTG


TET.THE.      AGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTG-TTGTG-GTGGAA
SCH.POM.      TAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGGCAGTGCGAT


TET.THE.      -GGATAACATACTCATTAACTGTCAA----ACTAAT-CG-GTTCTA-CTATCAAAGCCA-
SCH.POM.      AGCGA-TGGGATTC--ACCT----TCGCAGGAT-GTGCAT----GGAAGTAT-AAACACA


TET.THE.      GACATT----
SCH.POM.      -ACGGTCGTT


[Download ClustalW]

#218

Mean pairwise ID: 27.44%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACAC-T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


ARA.TH_A      G-GTTCGGT---TCCTCG-GATC---GGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


ARA.TH_A      GTCCAAGCTG-TGAGT-AATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT-C
SCH.POM.      TTCG-ATCCCTCGATCTGCCACG-TCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


ARA.TH_A      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
SCH.POM.      TTAAAC-CGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCT


ARA.TH_A      -CAGCA-GTGGAC-GGATCACG-GTTTAGCGTCGC-TCAGAACCACTATGGCC-TGCTGG
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT---


ARA.TH_A      --TCCGATCTCATATGAACCACCATTTT
SCH.POM.      GGAAGTAT--AAACACA-ACGGTCGTT-


[Download ClustalW]

#219

Mean pairwise ID: 27.55%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
LYC.ES_D      ------------------------------------------------------------


HOM.SA_B      CGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCC---GATGGGGTG-TCCGCAC
LYC.ES_D      ---------------------------------------TAGTTCTGGCC-TGCCCTGTC


HOM.SA_B      TAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LYC.ES_D      CAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAG


HOM.SA_B      AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
LYC.ES_D      CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT


HOM.SA_B      AGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGAGCA
LYC.ES_D      GGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT-


HOM.SA_B      ACATAGCGAG-ACCCCGTCTCT-
LYC.ES_D      --CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#220

Mean pairwise ID: 27.55%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
LYC.ES_D      ------------------------------------------------------------


HOM.SA_A      CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCC---GATCGGGTG-TCCGCAC
LYC.ES_D      ---------------------------------------TAGTTCTGGCC-TGCCCTGTC


HOM.SA_A      TAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LYC.ES_D      CAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAG


HOM.SA_A      AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
LYC.ES_D      CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT


HOM.SA_A      AGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGTGCA
LYC.ES_D      GGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT-


HOM.SA_A      ACATAGCGAG-ACCCCGTCTCTT
LYC.ES_D      --CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#221

Mean pairwise ID: 27.58%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGAT
LYC.ES_L      ------------------------------------------------------------


HOM.SA_A      CGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC-----GATCGGGTG-TC
LYC.ES_L      G-TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCC


HOM.SA_A      CGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGTTGC
LYC.ES_L      CTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCC


HOM.SA_A      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTG
LYC.ES_L      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTG


HOM.SA_A      ATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--C
LYC.ES_L      TGCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-


HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT
LYC.ES_L      GCTGCT---CCAA-CTAAACCACCACTTT-


[Download ClustalW]

#222

Mean pairwise ID: 27.58%


ZEA.MA_C      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGTGGAT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_C      GC-TTG---GTACCGTGTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TGCCCG
TRY.BR_B      GCGGGGACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT---GACTTGGTG-TTC-


ZEA.MA_C      TTCCAAGTTGGTAGTGGCCGTT-GGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGGACC
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGA-GGCGTTCTCGCGCCG-T


ZEA.MA_C      T-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTAT-
TRY.BR_B      -TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGT


ZEA.MA_C      TAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAGAC-
TRY.BR_B      TCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC---C


ZEA.MA_C      TTC-ATA--CTAAAGCAGACCACCATTTTT
TRY.BR_B      CCAAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#223

Mean pairwise ID: 27.61%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG------CGGGGGCAATAAGGTAGTGTG


GAL.GAL.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGCGCTATGCC----GAGCGGGC
ZEA.MA_H      GATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-


GAL.GAL.      G-TCCGCGCTAAGGCC-GGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGG
ZEA.MA_H      CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CA


GAL.GAL.      TTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT
ZEA.MA_H      ACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC


GAL.GAL.      GCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG----CAGCGTAGCCT
ZEA.MA_H      CACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT-----------


GAL.GAL.      GGGCAACATAGCGAGACCCTGTCTCC
ZEA.MA_H      --------------------------


[Download ClustalW]

#224

Mean pairwise ID: 27.64%


LYC.ES_M      -------------------------CAAG--TGGGGATGTTAAGGTGGTGGAATA--TTG
TRY.BR_A      AGCCGGAGCGCATTGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AGCGGGG


LYC.ES_M      --GGCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTGTCCAA
TRY.BR_A      ACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-TGCTTG


LYC.ES_M      GCACAGAGTTGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGTG
TRY.BR_A      GTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT


LYC.ES_M      GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCAGTG
TRY.BR_A      GGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTT


LYC.ES_M      GAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GTTGCT-
TRY.BR_A      CGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCAAG-TG


LYC.ES_M      -CCAA--TAAACAACCACCTTT
TRY.BR_A      T-CGTCGCG--AGGCGG-----


[Download ClustalW]

#225

Mean pairwise ID: 27.66%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGAT
LYC.ES_L      ------------------------------------------------------------


RAT.NOR.      CGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC-----GATCGGGTG-TC
LYC.ES_L      G-TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCC


RAT.NOR.      CGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGTTGC
LYC.ES_L      CTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCC


RAT.NOR.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTG
LYC.ES_L      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTG


RAT.NOR.      ATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--C
LYC.ES_L      TGCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-


RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT
LYC.ES_L      GCTGCT---CCAA-CTAAACCACCACTTT


[Download ClustalW]

#226

Mean pairwise ID: 27.66%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGAT
LYC.ES_L      ------------------------------------------------------------


CAN.SPE.      CGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC-----GATCGGGTG-TC
LYC.ES_L      G-TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCC


CAN.SPE.      CGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGTTGC
LYC.ES_L      CTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCC


CAN.SPE.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTG
LYC.ES_L      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTG


CAN.SPE.      ATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--C
LYC.ES_L      TGCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-


CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT
LYC.ES_L      GCTGCT---CCAA-CTAAACCACCACTTT


[Download ClustalW]

#227

Mean pairwise ID: 27.74%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_B      TGGGCTGTA---CCAGAT-GGTT---GGGCTTGGT--GGGCTAATTTCTGACT-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_B      ATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC-G
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_B      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_B      AAGCG-GTGGAA-GGATAACG-AGTCGGTGTTCT-CTGAGTCCAGTAATGCC-TGATGG-
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT---G


LYC.ES_B      -GCTGCTCTAA-TTAAACCACCACTTTT
SCH.POM.      GAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#228

Mean pairwise ID: 27.74%


ARA.TH_D      GTC-GAGCTAAGTAACGAGAGCTTGTGACCCGAG--TGGGGACAATAAGGTGGTGGAACA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_D      G--TG--GTTCAAT-TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_D      GTCCAAGCTGTGAGTAATCTG-TGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT-A
TRY.BR_A      TGCTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


ARA.TH_D      AAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA-CA
TRY.BR_A      A-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


ARA.TH_D      GCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT--
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


ARA.TH_D      TCGATC--TCTC-CTGGACCACCACTTT
TRY.BR_A      CAAG-TGT-CGTCGCG--AGGCGG----


[Download ClustalW]

#229

Mean pairwise ID: 27.79%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATA--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_E      TGGGCTGTC---CCAGAT-GGCTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_E      ATCCAAGTAC-AGAGTT-GGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_E      T-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_E      GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--CCAAGTTCCATTAATGCC-TGATG
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC-----ACCT---TCGCAG---GAT-GTGCAT--


LYC.ES_E      G--GCTGTTCTAG-TTAAACTACCACATTTT
SCH.POM.      -GGAAGTAT--AAACACA-ACGGTCGTT---


[Download ClustalW]

#230

Mean pairwise ID: 27.86%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
LYC.ES_D      ------------------------------------------------------------


RAT.RAT.      CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCC---GATCGGGTG-TCCGCAC
LYC.ES_D      ---------------------------------------TAGTTCTGGCC-TGCCCTGTC


RAT.RAT.      TAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGG
LYC.ES_D      CAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAG


RAT.RAT.      AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTGATCAGT
LYC.ES_D      CGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT


RAT.RAT.      AGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--CCTGGGCA
LYC.ES_D      GGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT-


RAT.RAT.      ACATAGCGAG-ACCCCGTCTCTT
LYC.ES_D      --CCAA-CTAAACCACCACTTTT


[Download ClustalW]

#231

Mean pairwise ID: 27.88%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_L      ----------------------------------------------------------G-


CAE.EL_A      AGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC-----GACCGAGCG-TCCG
LYC.ES_L      TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCT


CAE.EL_A      TGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGC-GGTTAGTCCCGGGTGCAT
LYC.ES_L      CTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-


CAE.EL_A      AAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGGTG
LYC.ES_L      AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTG


CAE.EL_A      CAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAG--CCT
LYC.ES_L      CAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-GC


CAE.EL_A      TCTCGATACCTTCAG-ACCACTTATCATTT
LYC.ES_L      TGCT---CCAA-CTAAACCACCACTTT---


[Download ClustalW]

#232

Mean pairwise ID: 27.88%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGACAGAGGAT
LYC.ES_L      ------------------------------------------------------------


RAT.RAT.      CGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC-----GATCGGGTG-TC
LYC.ES_L      G-TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCC


RAT.RAT.      CGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGTTGC
LYC.ES_L      CTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCC


RAT.RAT.      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTG
LYC.ES_L      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTG


RAT.RAT.      ATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--C
LYC.ES_L      TGCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-


RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT
LYC.ES_L      GCTGCT---CCAA-CTAAACCACCACTTT-


[Download ClustalW]

#233

Mean pairwise ID: 27.88%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_L      ----------------------------------------------------------G-


CAE.EL_D      AGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC-----GACCGAGCG-TCCG
LYC.ES_L      TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCT


CAE.EL_D      TGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGC-GGTTAGTCCCGGGTGCAT
LYC.ES_L      CTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-


CAE.EL_D      AAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGGTG
LYC.ES_L      AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTG


CAE.EL_D      CAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAG--CCT
LYC.ES_L      CAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-GC


CAE.EL_D      TCTCGATACCTTCAG-ACCACTTATCATTT
LYC.ES_L      TGCT---CCAA-CTAAACCACCACTTT---


[Download ClustalW]

#234

Mean pairwise ID: 27.91%


TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAGTGGGGGCATTAAAGTGATGTGAACGC-
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG--AAGTGT


TRI.AE_A      TGTTGTA-GCG---CTGCG-GGCCT--GGTCTGGG--TGTGCTACTGCTGGCC-CGCCCG
SCH.POM.      TTA-GTACTCCCAATAGTGCAT-GTTCGGTGGTCTCGGGTTC------GAGTCT--CGCT


TRI.AE_A      TTCCAAGTTGCGTAGTG-GACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CGGTC-
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACG-TCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA


TRI.AE_A      CATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCT


TRI.AE_A      -CAACG-GTGGAA-GGATAATG-GGCCGCTGCACT-CCTAGGCCAATTGGGCCTCGCAG-
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT--G


TRI.AE_A      --CCTACTCCA-GCAGACCACC----
SCH.POM.      GAAGTAT--AAACACA-ACGGTCGTT


[Download ClustalW]

#235

Mean pairwise ID: 27.96%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATGTGGGGACATTAAGATGGTGGGACAC--
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


ARA.TH_F      TGGTTCGGT---TCCTCG-GATC---GGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


ARA.TH_F      GTCCAAGCTG-TGAGT-AATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT-C
SCH.POM.      TTCG-ATCCCTCGATCTGCCACG-TCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


ARA.TH_F      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
SCH.POM.      TTAAAC-CGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCT


ARA.TH_F      -CAGCA-GTGGAC-GGATCACG-GTTTAGCGTCGC-TCAGAACCACTATGGCC-TGCTGG
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT---


ARA.TH_F      T--CCGATCTCAT-ATGAACCACCATTTT
SCH.POM.      -GGAAGTAT--AAACACA-ACGGTCGTT-


[Download ClustalW]

#236

Mean pairwise ID: 27.96%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT
LYC.ES_L      ------------------------------------------------------------


HOM.SA_B      CGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC-----GATGGGGTG-TC
LYC.ES_L      G-TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCC


HOM.SA_B      CGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGTTGC
LYC.ES_L      CTCTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCC


HOM.SA_B      CTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCTG
LYC.ES_L      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTG


HOM.SA_B      ATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--C
LYC.ES_L      TGCAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-


HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT
LYC.ES_L      GCTGCT---CCAA-CTAAACCACCACTTT


[Download ClustalW]

#237

Mean pairwise ID: 28.01%


ZEA.MA_E      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGAT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_E      TC-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCC
TRY.BR_A      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT----GACTTGGTG-TT


ZEA.MA_E      CGTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC
TRY.BR_A      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-


ZEA.MA_E      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTT
TRY.BR_A      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCT-T-GCGCAC


ZEA.MA_E      C-CAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAGA
TRY.BR_A      GTTCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_E      G--CC-TCA--CTAA-GCAGACCACCATCTTT
TRY.BR_A      -CCCAAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#238

Mean pairwise ID: 28.06%


LYC.ES_M      --------CAAGTGGGGATGTTAAGGTGGTGGAATA--TTGGGCTGTC---CCAGAT-GG
SCH.POM.      CGCTGTAA--TG----GC------TTGGTCG-AAGTGTTTAGTACTCCCAA-TAGTGCAT


LYC.ES_M      CTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGCCCTGTCCAAGCAC-AGAGTT-GGA
SCH.POM.      -GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCTTTCG-ATCCCTCGATC-TGCC


LYC.ES_M      TCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-AAAGTGGGGCGGACCGCAT
SCH.POM.      ACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTAAACCGTGTAGTACCGATG


LYC.ES_M      GAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCA-GTGGAA-GGATAATG
SCH.POM.      GAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTTGGGCAGTGCGATAGCGA--TG


LYC.ES_M      -GGTCGGTGTCTT--ATCAAGTTC-AGTAACGCC-TAATGG--GTTGCTCCAA--TAAAC
SCH.POM.      GGATTC-----ACCT----TCGCAG---GAT-GTGCAT---GGAAGTAT--AAACACA-A


LYC.ES_M      AACCACCTTT
SCH.POM.      CGGTCGTT--


[Download ClustalW]

#239

Mean pairwise ID: 28.10%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAGTGGGGGCAACAATGTGGTGGAATG--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_F      TGGGTCCAT---CTTGAT-GGATG---GGCTTGAA--GGGCTAATGTTCTGGCC-TGCCC
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC--------GAGTCT--CGC


LYC.ES_F      TGTCCAAGCAC-AGAGTT-GGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCT-
SCH.POM.      TTTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCA


LYC.ES_F      TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT
SCH.POM.      GTTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCT


LYC.ES_F      -GTGCA-GTGGAA-GGATCACG-GGCTAGTGCTCT--TTGAGTCCTAACAAAAACC-TGA
SCH.POM.      TGGGCAGTGCGATAGCGA--TGGGATTC-----ACCT---TCGCAG----GAT-GTGCAT


LYC.ES_F      TAG--GTTGCCTAA-TTAAACCATCACTTTT
SCH.POM.      ---GGAAGTAT-AAACACA-ACGGTCGTT--


[Download ClustalW]

#240

Mean pairwise ID: 28.10%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_J      TGGGCTTTA---CCAGAA-GGTTG---GGCTTGGT--GGGCTTAGTTCTGGCC-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_J      GTCCAAGCAC-AGAGTT-GGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_J      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_J      GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--ATCAAGTTC-AGTAACGCC-TAAT
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC-----ACCT----TCGCAG---GAT-GTGCAT-


LYC.ES_J      GG--GTTGCTCCAA--TAAACAACCACCTTT
SCH.POM.      --GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#241

Mean pairwise ID: 28.16%


YAR.LI_B      ---AGCTGTAATGGCATTTTGTCGGAGT-GGTAAATC-GCCTTCTTGTTGTGCGTTCGAG
SCH.POM.      CGC---TGTAATGGC------TTGGTCGAAGTGTTTAGTACTCCCAA-------------


YAR.LI_B      TTCTGGACTCTGCAC------------------TGGGCTA--CTTTGTTGTCCTTTCCGA
SCH.POM.      ---------------TAGTGCATGTTCGGTGGTCTCGGGTTC-GAGTCT--CGCTTTCG-


YAR.LI_B      ATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTAATCGGCTTTGAGATTTCCGTTCTAAG
SCH.POM.      ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTAAA


YAR.LI_B      ATTAACTGGGATACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGC--CGTGGGTATGG
SCH.POM.      CCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGGGTCTTGGGCAGTG


YAR.LI_B      CGGTGGGATAGCAACAAAGTGGTATATGTTAT---------GGAAGGT-ATTTGCA-ATC
SCH.POM.      CGATAGCGA-TGGGATTC-ACCT---TCGCAGGATGTGCATGGAAGTATAAACACAACGG


YAR.LI_B      ACGACTCTC
SCH.POM.      TCGTT----


[Download ClustalW]

#242

Mean pairwise ID: 28.18%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG
LYC.ES_M      -----------------------------CAAG------TGGGGATGTTAAGGTGGTGGA


GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-
LYC.ES_M      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG


GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG
LYC.ES_M      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC


GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#243

Mean pairwise ID: 28.26%


TRY.BR_B      AGCCGGAGCGCATTGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AGCGGGG
LYC.ES_M      -------------------------CAAG--TGGGGATGTTAAGGTGGTGGAATA--TTG


TRY.BR_B      ACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-TGCTTG
LYC.ES_M      --GGCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTGTCCAA


TRY.BR_B      GTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT
LYC.ES_M      GCACAGAGTTGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGTG


TRY.BR_B      GGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTT
LYC.ES_M      GGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCAGTG


TRY.BR_B      GCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCAAG-TG
LYC.ES_M      GAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GTTGCT-


TRY.BR_B      T-CGTCGCG--AGGCGGTTT--
LYC.ES_M      -CCAA--TAAACAACCACCTTT


[Download ClustalW]

#244

Mean pairwise ID: 28.29%


TET.ROS.      GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTAGAATAGTCAGA
TRI.AE_C      ------------------------------------------------------------


TET.ROS.      GTATGAGAGTTTGATGAGACAGTTTGCTAAGAGTGTG-CCCGTTCCAAACAG-TGAGT-T
TRI.AE_C      ----------------------------GGTGGTC-TGCCCGTTCCAAGTTGAGTAGTGG


TET.ROS.      GCTAT-GGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAGGAACCGC
TRI.AE_C      ACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTGGCAGGCACCGC


TET.ROS.      CTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGATA-ACA
TRI.AE_C      GTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGATAACG-


TET.ROS.      TACTC--ATTAACTGTCAA------GCTAATCG-GTTCTGCTATTC--TGATCA-GACAC
TRI.AE_C      GGCCGCTGCACT--CCTAGGCCGCTTGGGCCTCGTAG---CCTA--CTCCAGC-GACCAC


TET.ROS.      T---
TRI.AE_C      CATC


[Download ClustalW]

#245

Mean pairwise ID: 28.35%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
LYC.ES_L      --------------------------------------------------------G-TT


DRO.MEL.      TGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT-----GACGGAACG-TCCG
LYC.ES_L      G--GGTTGAC---CCAGAT-GGTTG-GGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCT


DRO.MEL.      CACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCC-GTGGCATTCAGGTTGGCT
LYC.ES_L      CTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-


DRO.MEL.      AAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTGGTAGG
LYC.ES_L      AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTG


DRO.MEL.      CAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT-CAG--CCC
LYC.ES_L      CAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-GC


DRO.MEL.      AACCGATATGGTTGG-ACCACAATCTTT
LYC.ES_L      TGCT---CCAA-CTAAACCACCACTTT-


[Download ClustalW]

#246

Mean pairwise ID: 28.40%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGATT
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA


ZEA.MA_E      C-TTTG--CGATGGCT---TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TG
LEP.COL.      CAGG--GAGCTGTCT-GGACCAGCATAGG-GTGCTTG-C-GGCGTT----GACGTGGTG-


ZEA.MA_E      CCCGTCCCAAGTTGGTAGTGGCTGGC-----GGAGGCTTTAGCGGAAGCT-TTGGTCTCT
LEP.COL.      CTC-TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCC


ZEA.MA_E      -CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCG
LEP.COL.      CCTCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCT-C


ZEA.MA_E      CCGGCTTC-CAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGG
LEP.COL.      -GCGCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACC


ZEA.MA_E      CC-CAGAG-CC-TCA--CTAA-GCAGACCACCATCTTT
LEP.COL.      TGCGC---CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#247

Mean pairwise ID: 28.40%


ZEA.MA_G      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGAT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_G      TC-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCC
TRY.BR_A      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT----GACTTGGTG-TT


ZEA.MA_G      CGTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC
TRY.BR_A      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-


ZEA.MA_G      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
TRY.BR_A      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACG


ZEA.MA_G      -CAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAGAG
TRY.BR_A      TTCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC---


ZEA.MA_G      --CC-TCA--CTAA-GCAGACCACCATCTTT
TRY.BR_A      CCCAAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#248

Mean pairwise ID: 28.40%


ZEA.MA_D      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGAT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_D      TC-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCC
TRY.BR_A      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT----GACTTGGTG-TT


ZEA.MA_D      CGTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC
TRY.BR_A      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-


ZEA.MA_D      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTT
TRY.BR_A      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCT-T-GCGCAC


ZEA.MA_D      C-CAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAGA
TRY.BR_A      GTTCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_D      G--CC-TCA--CTAA-GCAGACCACCATCTT
TRY.BR_A      -CCCAAG-TGT-CGTCGCG--AGGCGG----


[Download ClustalW]

#249

Mean pairwise ID: 28.40%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_K      TGGGCTTTA---CCAGAA-GGTTG---GGCTTGGT--GGGCTTAGTTCTGGCC-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_K      GTCCAAGCAC-AGAGTA-GGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_K      T-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_K      GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--ATCAAGTTC-AGTAACGCC-TAAT
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC-----ACCT----TCGCAG---GAT-GTGCAT-


LYC.ES_K      GG--GTTGCTCCAA--TAAACAACCACCTTT
SCH.POM.      --GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#250

Mean pairwise ID: 28.61%


ZEA.MA_E      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGAT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_E      TC-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCC
TRY.BR_B      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT----GACTTGGTG-TT


ZEA.MA_E      CGTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC
TRY.BR_B      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-


ZEA.MA_E      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTT
TRY.BR_B      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCT-T-GCGCAC


ZEA.MA_E      C-CAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAGA
TRY.BR_B      GTTCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_E      G--CC-TCA--CTAA-GCAGACCACCATCTTT
TRY.BR_B      -CCCAAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#251

Mean pairwise ID: 28.61%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG--TGGGGACAATAAGGTGGTGGAACAG
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


ARA.TH_D      --TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


ARA.TH_D      GTCCAAGCTGTGAGTAATCTG-----TGTGGGTCAGGCGAAGGCT-TGACTCAGGCGGAT
LEP.COL.      TGCTTGGCTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


ARA.TH_D      TCT-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCT
LEP.COL.      GT-TAA-A-GTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


ARA.TH_D      TA-CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


ARA.TH_D      GGT-TCGATC--TCTC-CTGGACCACCACTTT
LEP.COL.      ---CCCAGGCGA-TCCTGTG--AAGCTTT---


[Download ClustalW]

#252

Mean pairwise ID: 28.66%


ARA.TH_D      GTC-GAGCTAAGTAACGAGAGCTTGTGACCCGAG--TGGGGACAATAAGGTGGTGGAACA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_D      G--TG--GTTCAAT-TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_D      GTCCAAGCTGTGAGTAATCTG-TGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT-A
TRY.BR_B      TGCTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


ARA.TH_D      AAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA-CA
TRY.BR_B      A-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


ARA.TH_D      GCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT--
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


ARA.TH_D      TCGATC--TCTC-CTGGACCACCACTTT
TRY.BR_B      CAAG-TGT-CGTCGCG--AGGCGGTTT-


[Download ClustalW]

#253

Mean pairwise ID: 28.66%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGTGGATG
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA


ZEA.MA_C      C-TTG---GTACCGT---GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TGCC
LEP.COL.      CAGG-GAGCTGTCT-GGACCAGCATAGG-GTGCTTG-C-GGCGTT---GACGTGGTG-CT


ZEA.MA_C      CGTTCCAAGTTGGTAGTGGCCGTT-----GGAAGCTTGGGCGTAGGCCCTGGGCTTCC-T
LEP.COL.      C-TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCC


ZEA.MA_C      TGGACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCG
LEP.COL.      TCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GC


ZEA.MA_C      GCTAT-TAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-
LEP.COL.      GCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGC


ZEA.MA_C      TAGACTTC-ATA--CTAAAGCAGACCACCATTTTT
LEP.COL.      GC---CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#254

Mean pairwise ID: 28.70%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAAT-A-T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_H      TGGGCTGTA---CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_H      ATCCAAGCTT-AGAGTT-GGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC-G
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_H      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_H      GTGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT--ATCAAGTTC-AGTAACGCC-TAAT
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC-----ACCT----TCGCAG---GAT-GTGCAT-


LYC.ES_H      GG--GTTGCTCCAA-TAAACAACCACCTTTT
SCH.POM.      --GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#255

Mean pairwise ID: 28.75%


TRI.AE_B      NCC-GAGCT-AGTTGCGGGAGCTTGTCACCCATG--TGGGGGCATTGAGGCGGTGTGGAT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


TRI.AE_B      GC-TTG--GTGCGGT-TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TGCCCG
TRY.BR_A      GCGGGGACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT---GACTTGGTG-TTC-


TRI.AE_B      TTCCAAGTTGGTAGTGGGCTG-GGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-CT-T
TRY.BR_A      TGCTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


TRI.AE_B      AAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC-CAA
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


TRI.AE_B      CGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA--CCC
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--CCCAA


TRI.AE_B      CGC--CAT-A-GCAGACCACCATCTTT
TRY.BR_A      G-TGT--CGTCGCG--AGGCGG-----


[Download ClustalW]

#256

Mean pairwise ID: 28.78%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGATT
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA


ZEA.MA_G      C-TTTG--CGATGGCT---TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TG
LEP.COL.      CAGG--GAGCTGTCT-GGACCAGCATAGG-GTGCTTG-C-GGCGTT----GACGTGGTG-


ZEA.MA_G      CCCGTCCCAAGTTGGTAGTGGCTGGC-----GGAGGCTTTAGCGGAAGCT-TTGGTCTCT
LEP.COL.      CTC-TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCC


ZEA.MA_G      -CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGC
LEP.COL.      CCTCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-


ZEA.MA_G      CCGCTTC-CAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGC
LEP.COL.      GCGCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCT


ZEA.MA_G      C-CAGAG-CC-TCA--CTAA-GCAGACCACCATCTTT
LEP.COL.      GCGC---CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#257

Mean pairwise ID: 28.78%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGATT
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA


ZEA.MA_D      C-TTTG--CGATGGCT---TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TG
LEP.COL.      CAGG--GAGCTGTCT-GGACCAGCATAGG-GTGCTTG-C-GGCGTT----GACGTGGTG-


ZEA.MA_D      CCCGTCCCAAGTTGGTAGTGGCTGGC-----GGAGGCTTTAGCGGAAGCT-TTGGTCTCT
LEP.COL.      CTC-TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCC


ZEA.MA_D      -CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCG
LEP.COL.      CCTCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCT-C


ZEA.MA_D      CCCGCTTC-CAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGG
LEP.COL.      -GCGCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACC


ZEA.MA_D      CC-CAGAG-CC-TCA--CTAA-GCAGACCACCATCTT
LEP.COL.      TGCGC---CCCAGGCGA-TCCTGTG--AAGCTTT---


[Download ClustalW]

#258

Mean pairwise ID: 28.79%


HUM.LU_D      GAC-GGGCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.LU_D      --TTG--GGTCAAC-CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.LU_D      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTCCT-
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.LU_D      AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CG
TRY.BR_A      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.LU_D      GCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACTGGG--
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


HUM.LU_D      CTGACT--CTTAA-TAGGACCATTTCTTTT
TRY.BR_A      CAAG-TGT--CGTCGCG--AGGCGG-----


[Download ClustalW]

#259

Mean pairwise ID: 28.79%


HUM.LU_C      ----GGTCTTAGCAACTTGGTCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGAACT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.LU_C      --TTG--GGTCAAC-CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.LU_C      TTCCAAGCCGGGAGGTGGGCTG-AGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCCT-
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.LU_C      AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CG
TRY.BR_A      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.LU_C      GCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG--
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


HUM.LU_C      CTGACT--CTTAA-TAGGACCATTTCTTTT
TRY.BR_A      CAAG-TGT--CGTCGCG--AGGCGG-----


[Download ClustalW]

#260

Mean pairwise ID: 28.79%


LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG--CGGGGGCAATAAGGTAGTGTGGATG


LEP.COL.      CAGG--GAGCTGTCTGGACCAGCATAGG-GTGCTTGC-GGCGTT----GACGTGGTG-CT
ZEA.MA_H      T-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-CACC


LEP.COL.      C-TGCTTGGCTG-TGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCC
ZEA.MA_H      CATTCCAAGTTGCGTAGTGGGTTTC-----GGATGCCTTGGCGAAAGCT-TTG-CATCC-


LEP.COL.      CTCCGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GC
ZEA.MA_H      CAACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCC


LEP.COL.      GCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-----ACCTGCGC
ZEA.MA_H      GCCAC-CAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT--------


LEP.COL.      CCCAGGCGATCCTGTGAAGCTTT
ZEA.MA_H      -----------------------


[Download ClustalW]

#261

Mean pairwise ID: 28.79%


HUM.LU_A      GCC-GGTCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.LU_A      --TTG--GGTCAAC-CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.LU_A      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCCT-
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.LU_A      AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CG
TRY.BR_A      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.LU_A      GCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACTAGG--
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


HUM.LU_A      CTGACT--CTTAA-TAGGACCATTTCTTTT
TRY.BR_A      CAAG-TGT--CGTCGCG--AGGCGG-----


[Download ClustalW]

#262

Mean pairwise ID: 28.80%


TET.ROS.      GCCAGGGTAGCAATGCCTGTGACCT--CGTGTGGCATAAACAATGT---AGTTA-GAATA
SCH.POM.      -----CGC---------TGTAA---TG-----GC----TTGGTCG-AAGTGTTTA-GTAC


TET.ROS.      GTCA--GAGTATGAGAGTTT-GATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAG
SCH.POM.      TCCCAA--TAGTGCATGTT-CGGTGGTCTCGGGTTC---GAGTCT-CGCTTTCG-ATCCC


TET.ROS.      -TGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCA-TTAAAGAGCTGA
SCH.POM.      TCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTAAACCGTGT


TET.ROS.      GGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTA-TTGTG-GTGGAA-
SCH.POM.      AGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGG-GTCTTGGGCAGTGCGATA


TET.ROS.      GGATAACATACTCATTAACTGTCAA----GCTAAT-CG-GTTCTG-CTATTCTGATCA-G
SCH.POM.      GCGA-TGGGATTC--ACCT----TCGCAGGAT-GTGCAT----GGAAGTAT-AAACACA-


TET.ROS.      ACACT----
SCH.POM.      ACGGTCGTT


[Download ClustalW]

#263

Mean pairwise ID: 28.88%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG--TGGGGACAATAAGGTGGTGGAACAG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


ARA.TH_D      --TG--GTTCAAT-TCCTCG-GGTC-GGACCTGATGCTGACATATATCTGAGC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


ARA.TH_D      GTCCAAGCTGTGAGTAATCTG-TGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-CT-
LEI.MAJ.      TGCTTGGCTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


ARA.TH_D      AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA-C
LEI.MAJ.      TGAA-GCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTC


ARA.TH_D      AGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACT-ATGGCC-CGCTGGT
LEI.MAJ.      CGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC-----


ARA.TH_D      --TCGATC-TCTC-CTGGACCACCACTTT
LEI.MAJ.      CCCACGCTT-CGTCGCG--AAGCCTT---


[Download ClustalW]

#264

Mean pairwise ID: 28.88%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
LYC.ES_L      ----------------------------------------------------------G-


CAE.EL_C      AGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC-----GACCGAGCG-TCCG
LYC.ES_L      TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCT


CAE.EL_C      TGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGAT-GGTCAGTCCCGGGTGCAT
LYC.ES_L      CTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-


CAE.EL_C      AAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGGTG
LYC.ES_L      AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTG


CAE.EL_C      CAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--CCT
LYC.ES_L      CAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-GC


CAE.EL_C      TCTCAATACCTTCAG-ACCACTTGTCACT
LYC.ES_L      TGCT---CCAA-CTAAACCACCACTTT--


[Download ClustalW]

#265

Mean pairwise ID: 28.96%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATGTGGGGACATTTAGATGGTGGAACAC--
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


ARA.TH_E      TGGTTCGGG---TCCACG-GGCC---GGTTCTGTTGTTGGCATGTTTCTGGGC-TGCCCA
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


ARA.TH_E      GTCCAAGCTG-TGAGT-AAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTT-CT
SCH.POM.      TTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGT


ARA.TH_E      -AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA-
SCH.POM.      TAAAC-CGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


ARA.TH_E      CAGCA-GTGGAC-GGATCACA-GTTTAGCGTCGC-TCAGAACCACTATGGCC-TGCTGGT
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----


ARA.TH_E      --CCGATCTCAT-ATGAACCACCATTTT
SCH.POM.      GGAAGTAT--AAACACA-ACGGTCGTT-


[Download ClustalW]

#266

Mean pairwise ID: 28.96%


LYC.ES_C      GCC-GAGCTCAGTAGCGTGGGCTTGTAACTCAAG--TGAGGGCATCAGTGTGGTGGAATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_C      --TTG--AACATGC-CCAGAA-GGTAGGGCTTGT-GTGACAATTCTCTGGCC-TGCCCTG
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_C      TCCAAGCAAAGAGTTGGGTCT-TGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCCT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_C      AAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT-GTG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_C      CAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG--G
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCC


LYC.ES_C      CTGTT--CTAG-TTAAACTACCACATTT
TRY.BR_A      AAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#267

Mean pairwise ID: 28.96%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATA--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_A      TGGGCTTTA---CCAGAA-GGTT---GGGCTTGGT--GGGCTTAGTTCTGGCC-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_A      GTCCAAGCAC-AGAGTT-GGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_A      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCT-G
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCACTACCGG-GTCTTG


LYC.ES_A      TGCA-GTGGAA-GGATAATG-GGTCGGTGTCTT-ATCAAGTTCAGTAACGCC-TAATGG-
SCH.POM.      GGCAGTGCGATAGCGA--TGGGATTC----ACCT----TCGCAG--GAT-GTGCAT---G


LYC.ES_A      -GTTGCTCCAA--TAAACAACCACCTTT
SCH.POM.      GAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#268

Mean pairwise ID: 29.00%


ZEA.MA_D      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGAT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_D      TC-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCC
TRY.BR_B      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT----GACTTGGTG-TT


ZEA.MA_D      CGTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC
TRY.BR_B      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-


ZEA.MA_D      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTT
TRY.BR_B      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCT-T-GCGCAC


ZEA.MA_D      C-CAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAGA
TRY.BR_B      GTTCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_D      G--CC-TCA--CTAA-GCAGACCACCATCTT
TRY.BR_B      -CCCAAG-TGT-CGTCGCG--AGGCGGTTT-


[Download ClustalW]

#269

Mean pairwise ID: 29.00%


ZEA.MA_G      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGAT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_G      TC-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCC
TRY.BR_B      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT----GACTTGGTG-TT


ZEA.MA_G      CGTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC
TRY.BR_B      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-


ZEA.MA_G      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
TRY.BR_B      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACG


ZEA.MA_G      -CAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAGAG
TRY.BR_B      TTCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC---


ZEA.MA_G      --CC-TCA--CTAA-GCAGACCACCATCTTT
TRY.BR_B      CCCAAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#270

Mean pairwise ID: 29.00%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG
LYC.ES_M      -----------------------------CAAG-----TGGGGATGTTAAGGTGGTGGAA


CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T
LYC.ES_M      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC


CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC
LYC.ES_M      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC


CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG
LYC.ES_M      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG


CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CC
LYC.ES_M      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G


CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT
LYC.ES_M      TTGCT---CCAA--TAAACAACCACCTTT--


[Download ClustalW]

#271

Mean pairwise ID: 29.00%


ZEA.MA_B      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGCGCGGAT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_B      GC-TTTG--CGATGGT-TTCTG-GGCCTGGGCTCGT-TGTGACTCTAGCCGGCT-TGCCC
TRY.BR_A      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-TTGCGTT----GACTTGGTG-TTC


ZEA.MA_B      ATCCCAAGTTGGTAGTGTCTGAC-GGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-CAGAC
TRY.BR_A      -TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGA-GGCGTTCTCGCGCCG-


ZEA.MA_B      CT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTT
TRY.BR_A      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCT-T-GCGCAC


ZEA.MA_B      C-CAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-CAGA
TRY.BR_A      GTTCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_B      -TCC-TCT--CTTA-GCAAACCACCATCTTT
TRY.BR_A      CCCAAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#272

Mean pairwise ID: 29.04%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAAGGTGGTGGAATA-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_E      -TTG--GGCTGTC--CCAGAT-GGCTG-GGCTTGGT-GGGCTAATTTCTGGCC-TGCCCT
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-


LYC.ES_E      ATCCAAGTACAGAGTTGGATCA-----TGTGGTCCAATTGAAAGAA-TGGGCTACTAGAT
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


LYC.ES_E      TCCT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


LYC.ES_E      TT-GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGA
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGCGC-


LYC.ES_E      TGG-GCTGTT--CTAG-TTAAACTACCACATTTT
LEP.COL.      ---CCCAGGCGA-TCCTGTG--AAGCTTT-----


[Download ClustalW]

#273

Mean pairwise ID: 29.09%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAATGGGGGCATTAATGTGGTGGAATG--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_G      TGGGCTGTA---CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_G      ATCCAAGCAC-AGAGTT-GGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_G      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_G      GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--CCAAGTTCCATTAATGCC-TGATG
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC-----ACCT---TCGCAG---GAT-GTGCAT--


LYC.ES_G      G--GCTGCTCCAA-TTAAACCACCACTTTT
SCH.POM.      -GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#274

Mean pairwise ID: 29.10%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
LYC.ES_D      ------------------------------------------------------------


CAE.BRI.      AGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGC---GACCGAGCG-TCCGTGCC
LYC.ES_D      --------------------------------------TAGTTCTGGCC-TGCCCTGTCC


CAE.BRI.      AAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGA
LYC.ES_D      AAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGC


CAE.BRI.      GTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTG
LYC.ES_D      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


CAE.BRI.      GCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--CCTCTCTGA
LYC.ES_D      GAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-GTTGCT--


CAE.BRI.      TACCTTCAG-ACCACTTGTCATT
LYC.ES_D      -CCAA-CTAAACCACCACTTTT-


[Download ClustalW]

#275

Mean pairwise ID: 29.13%


YAR.LI_A      CTT---AGCTGTAATGGCATTTTGTCGGAGT-GGTAAATC-GTCTTCTTGTTGTGCGTTC
SCH.POM.      ---CGC---TGTAATGGC------TTGGTCGAAGTGTTTAGTACTCCCAA----------


YAR.LI_A      GAGTCTTGGGCTCTGCAC------------------TTGGCCA--TTTGGTTGTCCTTTC
SCH.POM.      ------------------TAGTGCATGTTCGGTGGTCTCGGGTTC-GAGTCT--CGCTTT


YAR.LI_A      CGAATTCTGCGGTTGATGGGCGTCTCG-GTCTGAGTAATCGGCTTTGAGATTTCCGTTCT
SCH.POM.      CG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTT


YAR.LI_A      AAGATTAACTGGGAAACTTCAGTGGAGCAATCCAGCAGAGATCCAGTTGC--CGTGGGTA
SCH.POM.      AAACCGTGTAGTACCGATGGAGGTTGGAAACAATGCACATCA-CTACCGGGTCTTGGGCA


YAR.LI_A      TGGCGGTGGGATCGCAACCAAGTGGTATATGTTAT---------GGAAGAT-ATTTACG-
SCH.POM.      GTGCGATAGCGA-TGGGATTC-ACCT---TCGCAGGATGTGCATGGAAGTATAAACACAA


YAR.LI_A      ATCACGATT
SCH.POM.      CGGTCGTT-


[Download ClustalW]

#276

Mean pairwise ID: 29.18%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG
LYC.ES_M      -----------------------------CAAG-----TGGGGATGTTAAGGTGGTGGAA


FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T
LYC.ES_M      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC


FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC
LYC.ES_M      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC


FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG
LYC.ES_M      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG


FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CC
LYC.ES_M      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G


FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT-
LYC.ES_M      TTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#277

Mean pairwise ID: 29.18%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LYC.ES_L      ----------------------------------------------------------G-


CAE.EL_B      AGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC-----GACCGAGCG-TCCG
LYC.ES_L      TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCT


CAE.EL_B      TGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGAT-GGTCAGTCCCGGGTGCAT
LYC.ES_L      CTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-


CAE.EL_B      AAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGGTG
LYC.ES_L      AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTG


CAE.EL_B      CAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--CCT
LYC.ES_L      CAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-GC


CAE.EL_B      TCTCAATACCTTCAG-ACCACTTGTTTTT
LYC.ES_L      TGCT---CCAA-CTAAACCACCACTTT--


[Download ClustalW]

#278

Mean pairwise ID: 29.18%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAGTGGGGACTATAAGATGGTGGAACAC--
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


ARA.TH_G      TGGATCGGC---CCA-CG-GGTC---GGATTTGTTGTTGGCATAGGTCTGGAC-TGCCCA
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


ARA.TH_G      ATCCAAGCTG-TGAGT-GAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTG-CT
SCH.POM.      TTCG-ATCCCTCGATCTGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGT


ARA.TH_G      -AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-
SCH.POM.      TAAAC-CGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


ARA.TH_G      CAGCA-GTGGAC-GGACAACG-GTTCGACGCCAC-ACAAATCCACTATGGTC-CGCTGGC
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----


ARA.TH_G      --TCGTAACCCGC-TTGAACCACCATTTT
SCH.POM.      GGAAGTAT---AAACACA-ACGGTCGTT-


[Download ClustalW]

#279

Mean pairwise ID: 29.19%


TET.THE.      GCCAGGGTAGCAATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGGTT--GT
LYC.ES_M      ------------------------CAAG-TGGGGATGTTAAGGTGGTGGAATA--TTG--


TET.THE.      GATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CCCGCTC
LYC.ES_M      GGCTGTC--CCAGAT-GGCTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGCCCTGTC


TET.THE.      CAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGA
LYC.ES_M      CAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAG


TET.THE.      GCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGT
LYC.ES_M      TGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGT


TET.THE.      GGAAGGATA-ACATACTC--A-TTAACTGTCAA------ACTAATCG-GTTCTA-CTATC
LYC.ES_M      GGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCCTAATGG---GTTGCT


TET.THE.      A--AAGCCA-GACATT------
LYC.ES_M      -CCAA--TAAACAACCACCTTT


[Download ClustalW]

#280

Mean pairwise ID: 29.22%


ZEA.MA_F      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCTAAG--CGGGGGCATTAAGGTGGTGTGGAT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_F      GT-TTCC--TGACGGA-TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-TGCC
TRY.BR_A      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT----GACTTGGTG-TT


ZEA.MA_F      CGTTCCAAGTTGGTTGTGGCTGGT-GGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTAGAC
TRY.BR_A      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-


ZEA.MA_F      CT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTT
TRY.BR_A      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCT-T-GCGCAC


ZEA.MA_F      C-CAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--CAGA
TRY.BR_A      GTTCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_F      G--CC-TCA--TTAA-ACAGACCACCATCTTT
TRY.BR_A      -CCCAAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#281

Mean pairwise ID: 29.22%


ZEA.MA_A      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGTGAAT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_A      GC-TTTG--CGATGGCTTTCTG-GGCCCTGGGCTCGT-TGTGACACTGGCCGGCT-TGCC
TRY.BR_A      GCGGGG-ACGTCTTGGACAAGCGGGG----GTTCTG-TTGCGTT----GACTTGGTG-TT


ZEA.MA_A      CATCCCAAGTTGGTAGTGTCTGGT-GGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-CAGA
TRY.BR_A      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGA-GGCGTTCTCGCGCCG


ZEA.MA_A      CCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTC
TRY.BR_A      -T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCAC


ZEA.MA_A      C-CAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-CAGA
TRY.BR_A      GTTCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_A      A--CC-TCA--CTAA-GCAAACCACCATCTTT
TRY.BR_A      -CCCAAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#282

Mean pairwise ID: 29.22%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG--TGAGGGCATCAGTGTGGTGGAATG-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_C      -TTG--AACATGC--CCAGAA-GGTAGGGCTTGT-GTGACAATTCTCTGGCC-TGCCCTG
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-CGGCGTT----GACGTGGTG-CTC-T


LYC.ES_C      TCCAAGCAAAGAGTTGGGTCT-----TGTGGGCCAAGCGAAGGCT-TGGGCTGCTGGGCT
LEP.COL.      GCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


LYC.ES_C      CCT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTC
LEP.COL.      GT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCAC


LYC.ES_C      T-GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGAT
LEP.COL.      GTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGCGC--


LYC.ES_C      GG-GCTGTT--CTAG-TTAAACTACCACATTT
LEP.COL.      --CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#283

Mean pairwise ID: 29.22%


HUM.JA_A      ---GGCCTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAGATGGGACT--
LEP.COL.      GCCGGAGC----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AACA


HUM.JA_A      TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGCCCAT
LEP.COL.      GG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-T


HUM.JA_A      TCCAAGCCGAGAGTTGGGCTG-----TGTGATCTGGGCGAAGGCT-GGGGTCGCACAGCT
LEP.COL.      GCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


HUM.JA_A      CCT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTC
LEP.COL.      GT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCAC


HUM.JA_A      T-CGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGC
LEP.COL.      GTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-----ACCTGCGC----


HUM.JA_A      A-TGCACT--CTTAA-TCAGACCATCTCTTTT
LEP.COL.      -CCCAGGCGA--TCCTGTG--AAGCTTT----


[Download ClustalW]

#284

Mean pairwise ID: 29.23%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG------CGGGGGCAATAAGGTAGTGTG


RAT.NOR.      GGATCGATT-GAGTCCAGGAGTTCTGGGCTG---TAGTGCGCTATGCC----GATCGGGT
ZEA.MA_H      GATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-


RAT.NOR.      G-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG
ZEA.MA_H      CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CA


RAT.NOR.      TTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT
ZEA.MA_H      ACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC


RAT.NOR.      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG----CACTCCAGCCT
ZEA.MA_H      CACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT-----------


RAT.NOR.      GGGCAACATAGCGAGACCCGTCTCT
ZEA.MA_H      -------------------------


[Download ClustalW]

#285

Mean pairwise ID: 29.27%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG--TGGGGGCAACAATGTGGTGGAATG-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_F      -TTG--GGTCCAT-CTTGAT-GGATGGGCTTGAA-GGGCTAATGTTCTGGCC-TGCCCTG
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT-----GACGTGGTG-CTC-T


LYC.ES_F      TCCAAGCACAGAGTTGGGTCA-AGTGGTCTATACGAAAGTATAG-CCACTTGGCCT-TT-
LEI.MAJ.      GCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


LYC.ES_F      AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT-GT
LEI.MAJ.      TGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCC


LYC.ES_F      GCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATAG-
LEI.MAJ.      GCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC----C


LYC.ES_F      -GTTGCC-TAA-TTAAACCATCACTTTT
LEI.MAJ.      CCACGCTTCGTCGCG--AAGCCTT----


[Download ClustalW]

#286

Mean pairwise ID: 29.34%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG--TGGGGGCAACAATGTGGTGGAATG-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_F      -TTG--GGTCCAT--CTTGAT-GGATG-GGCTTGAA-GGGCTAATGTTCTGGCC-TGCCC
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT-----GACGTGGTG-CTC


LYC.ES_F      TGTCCAAGCACAGAGTTGGGTCA-----AGTGGTCTATACGAAAGTA-TAG-CCACTTGG
LEP.COL.      -TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCT


LYC.ES_F      CCTTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGC
LEP.COL.      CCGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGC


LYC.ES_F      TCT-GTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-T
LEP.COL.      ACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC--------ACCTGCG


LYC.ES_F      GATAG-GTTGCC--TAA-TTAAACCATCACTTTT
LEP.COL.      C----CCCAGGCGATCCTGTG--AAGCTTT----


[Download ClustalW]

#287

Mean pairwise ID: 29.38%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG--CGGGGGCATTAAGGTGGTGTGGATG
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA


ZEA.MA_F      T-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-TGC
LEP.COL.      CAGG--GAGCTGTCTGGACCAGCATAGG-GTGCTTG-C-GGCGTT----GACGTGGTG-C


ZEA.MA_F      CCGTTCCAAGTTGGTTGTGGCTGGT-----GGGG-CTCGGGCGAAGGCC-TGGGCCTCT-
LEP.COL.      TC-TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCC


ZEA.MA_F      TTAGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGC
LEP.COL.      CTCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCT-C-


ZEA.MA_F      CCGCTTC-CAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC
LEP.COL.      GCGCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCT


ZEA.MA_F      --CAGAG-CC-TCA--TTAA-ACAGACCACCATCTTT
LEP.COL.      GCGC---CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#288

Mean pairwise ID: 29.38%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGTGAATG
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA


ZEA.MA_A      C-TTTG--CGATGGCT---TTCTG-GGCCCTGGGCTCGT-TGTGACACTGGCCGGCT-TG
LEP.COL.      CAGG--GAGCTGTCT-GGACCAGCATAGG--GTGCTTG-CGGCGTT----GACGTGGTG-


ZEA.MA_A      CCCATCCCAAGTTGGTAGTGTCTGGT-----GGGGGCTCTAGCGAAAGCTTTGGGTCTCT
LEP.COL.      CTC-TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCC


ZEA.MA_A      G-CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGC
LEP.COL.      CCTCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-


ZEA.MA_A      CGACTCC-CAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGC
LEP.COL.      GCGCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCT


ZEA.MA_A      T-CAGAA-CC-TCA--CTAA-GCAAACCACCATCTTT
LEP.COL.      GCGC---CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#289

Mean pairwise ID: 29.39%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGTGGATG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG


ZEA.MA_C      C-TTG---GTACCGTGTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TGCCCGT
LEI.MAJ.      CGGGGAGGACGTGGACCAGCGAGGGT-GATTTG-C-TGCGTT---GACGTGGTG-CTC-T


ZEA.MA_C      TCCAAGTTGGTAGTGGCCGTT-GGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGGAC-C
LEI.MAJ.      GCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGG-GTGGCGCGGGT-CCG-CC


ZEA.MA_C      T-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTAT-
LEI.MAJ.      GTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGT


ZEA.MA_C      TAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTT-AAGGCC-TAGAC
LEI.MAJ.      CCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC---


ZEA.MA_C      -TTC-ATA-CTAAAGCAGACCACCATTTTT
LEI.MAJ.      CCCACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#290

Mean pairwise ID: 29.39%


XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG
LYC.ES_M      -----------------------------CAAG-----TGGGGATGTTAAGGTGGTGGAA


XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T
LYC.ES_M      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC


XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC
LYC.ES_M      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-


XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#291

Mean pairwise ID: 29.43%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_G      -TTG--GGCTGTA--CCAGAT-GGTTG-GGCTTGGT-GGGCTAATTTCTGGCC-TGCCCT
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-


LYC.ES_G      ATCCAAGCACAGAGTTGGATCA-----TGTGGTCCAATTGAAAGAA-TGGGCTACTAGAT
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


LYC.ES_G      TCCT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


LYC.ES_G      TT-GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGA
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGCGC-


LYC.ES_G      TGG-GCTGCT--CCAA-TTAAACCACCACTTTT
LEP.COL.      ---CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#292

Mean pairwise ID: 29.48%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAGTGGGGATGTTAAGGTGGTGGAATA--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_O      TGGGCTGTC---CCAGAT-GGCTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_O      ATCCAAGCAC-AGAGTT-GGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_O      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_O      GTGCA-GTGGAA-GGATAACG-GACCGGTGCCTT--CCAAGTTCCATTAATGCC-TGATG
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC-----ACCT---TCGCAG---GAT-GTGCAT--


LYC.ES_O      G--GCTGCTCCAA-TTAAACCACCACTTT
SCH.POM.      -GGAAGTAT--AAACACA-ACGGTCGTT-


[Download ClustalW]

#293

Mean pairwise ID: 29.48%


ARA.TH_G      GTC-GAGCTATGTAACGAGAGCTTGTAACCCAAG--TGGGGACTATAAGATGGTGGAACA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_G      C--TG--GATCGGC-CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_G      ATCCAAGCTGTGAGTGAACCG-TATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT-A
TRY.BR_A      TGCTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


ARA.TH_G      AAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CA
TRY.BR_A      A-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


ARA.TH_G      GCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC--
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


ARA.TH_G      TCGTAA--CCCGC-TTGAACCACCATTTT
TRY.BR_A      CAAG-TGT--CGTCGCG--AGGCGG----


[Download ClustalW]

#294

Mean pairwise ID: 29.50%


ORY.SA_A      GCC-GAGCTCAGTAGCGAGAGCCTGTAACCCAAG--CGGGGGCACTAAAGGTGGCTGCGG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT----GATCCCGCTT---


ORY.SA_A      ATGT-TTGGTGTGGATTCTGATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT-TG
TRY.BR_A      -AGCGGGG--ACGTCTTGGA-CAAGCGGGG---GTTCTG-T-TGCGTT--GACTTGGTG-


ORY.SA_A      CCCGTTCCAAGTTGCGTAGTGGGCCGG-AGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTC
TRY.BR_A      TTC-TGCTTGGTTG-CGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGC


ORY.SA_A      TCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGC
TRY.BR_A      CG-----T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-


ORY.SA_A      CCGCTTC-CATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGGC
TRY.BR_A      GCGCACGTTCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTT


ORY.SA_A      C-CAGAGT--CCCTCT--ACAA--CAGACCACCATCTTT
TRY.BR_A      GCGC----CCCAAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#295

Mean pairwise ID: 29.52%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG--TGGGGACATTAAGATGGTGGGACAC
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


ARA.TH_F      --TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


ARA.TH_F      GTCCAAGCTGTGAGTAATTAG----TGTTGAGTTGAGCGAAGGCT-TGGCTTGCA--GGT
LEP.COL.      TGCTTGGCTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


ARA.TH_F      TCT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCT
LEP.COL.      GT-TAA-A-GTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


ARA.TH_F      TA-CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


ARA.TH_F      GGT-CCGATC--TCAT-ATGAACCACCATTTT
LEP.COL.      ---CCCAGGCGA-TCCTGTG--AAGCTTT---


[Download ClustalW]

#296

Mean pairwise ID: 29.52%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_K      -TTG--GGCTTTA--CCAGAA-GGTTG-GGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCT
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-


LYC.ES_K      GTCCAAGCACAGAGTAGGATCA-----CGAGGCCCAAATGAAAATA-TGGGCTTCTTGAT
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


LYC.ES_K      TCCT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


LYC.ES_K      CT-GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAAT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


LYC.ES_K      GG-GTTGCT--CCAA--TAAACAACCACCTTT
LEP.COL.      --CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#297

Mean pairwise ID: 29.55%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGCGCGGATG
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA


ZEA.MA_B      C-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT-TGTGACTCTAGCCGGCT-TGCC
LEP.COL.      CAGG--GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CT


ZEA.MA_B      CATCCCAAGTTGGTAGTGTCTGAC-----GGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-
LEP.COL.      C-TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCC


ZEA.MA_B      CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
LEP.COL.      TCCG-T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCT-C-G


ZEA.MA_B      CACTTC-CAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC
LEP.COL.      CGCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTG


ZEA.MA_B      -CAGATCC-TCT--CTTA-GCAAACCACCATCTTT
LEP.COL.      CGC--CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#298

Mean pairwise ID: 29.57%


LYC.ES_C      GCC-GAGCTCAGTAGCGTGGGCTTGTAACTCAAG--TGAGGGCATCAGTGTGGTGGAATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_C      --TTG--AACATGC-CCAGAA-GGTAGGGCTTGT-GTGACAATTCTCTGGCC-TGCCCTG
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_C      TCCAAGCAAAGAGTTGGGTCT-TGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCCT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_C      AAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT-GTG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_C      CAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG--G
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCC


LYC.ES_C      CTGTT--CTAG-TTAAACTACCACATTT
TRY.BR_B      AAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#299

Mean pairwise ID: 29.61%


ZEA.MA_B      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGCGCGGAT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_B      GC-TTTG--CGATGGT-TTCTG-GGCCTGGGCTCGT-TGTGACTCTAGCCGGCT-TGCCC
TRY.BR_B      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-TTGCGTT----GACTTGGTG-TTC


ZEA.MA_B      ATCCCAAGTTGGTAGTGTCTGAC-GGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-CAGAC
TRY.BR_B      -TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGA-GGCGTTCTCGCGCCG-


ZEA.MA_B      CT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTT
TRY.BR_B      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCT-T-GCGCAC


ZEA.MA_B      C-CAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-CAGA
TRY.BR_B      GTTCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_B      -TCC-TCT--CTTA-GCAAACCACCATCTTT
TRY.BR_B      CCCAAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#300

Mean pairwise ID: 29.61%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG
LYC.ES_M      -----------------------------CAAG-----TGGGGATGTTAAGGTGGTGGAA


CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T
LYC.ES_M      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC


CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC
LYC.ES_M      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC


CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG
LYC.ES_M      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG


CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CC
LYC.ES_M      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G


CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT
LYC.ES_M      TTGCT---CCAA--TAAACAACCACCTTT--


[Download ClustalW]

#301

Mean pairwise ID: 29.66%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG------CGGGGGCAATAAGGTAGTGTG


RAT.RAT.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGCGCTATGCC----GATCGGGT
ZEA.MA_H      GATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-


RAT.RAT.      G-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG
ZEA.MA_H      CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CA


RAT.RAT.      TTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT
ZEA.MA_H      ACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC


RAT.RAT.      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG----CACTCCAGCCT
ZEA.MA_H      CACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT-----------


RAT.RAT.      GGGCAACATAGCGAGACCCCGTCTCTT
ZEA.MA_H      ---------------------------


[Download ClustalW]

#302

Mean pairwise ID: 29.66%


HUM.LU_B      GGCCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAAC-A-TTGG
SCH.POM.      -CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTTTAG


HUM.LU_B      GTCAGC---CCAGTG-GATC---GGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCATTC
SCH.POM.      TACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCTTTC


HUM.LU_B      CAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC-CT-A
SCH.POM.      G-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTA


HUM.LU_B      GAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC-CGG
SCH.POM.      AACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTTGGG


HUM.LU_B      CA-GTGGAA-GGATAACG-GGCCGGTGCTAC-TTGGTCCA-CCATGT-T-CACTGGT-CC
SCH.POM.      CAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----GGA


HUM.LU_B      TGACTCTTAA-TCGGACCATTTCCTTT
SCH.POM.      AGTAT---AAACACA-ACGGTCGTT--


[Download ClustalW]

#303

Mean pairwise ID: 29.66%


TRI.AE_B      NCC-GAGCT-AGTTGCGGGAGCTTGTCACCCATG--TGGGGGCATTGAGGCGGTGTGGAT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


TRI.AE_B      GC-TTG--GTGCGGT-TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TGCCCG
TRY.BR_B      GCGGGGACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT---GACTTGGTG-TTC-


TRI.AE_B      TTCCAAGTTGGTAGTGGGCTG-GGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-CT-T
TRY.BR_B      TGCTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


TRI.AE_B      AAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC-CAA
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


TRI.AE_B      CGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA--CCC
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--CCCAA


TRI.AE_B      CGC--CAT-A-GCAGACCACCATCTTT
TRY.BR_B      G-TGT--CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#304

Mean pairwise ID: 29.70%


HUM.LU_C      ----GGTCTTAGCAACTTGGTCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGAACT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.LU_C      --TTG--GGTCAAC-CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.LU_C      TTCCAAGCCGGGAGGTGGGCTG-AGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCCT-
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.LU_C      AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CG
TRY.BR_B      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.LU_C      GCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG--
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


HUM.LU_C      CTGACT--CTTAA-TAGGACCATTTCTTTT
TRY.BR_B      CAAG-TGT--CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#305

Mean pairwise ID: 29.70%


HUM.LU_D      GAC-GGGCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.LU_D      --TTG--GGTCAAC-CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.LU_D      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTCCT-
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.LU_D      AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CG
TRY.BR_B      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.LU_D      GCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACTGGG--
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


HUM.LU_D      CTGACT--CTTAA-TAGGACCATTTCTTTT
TRY.BR_B      CAAG-TGT--CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#306

Mean pairwise ID: 29.70%


HUM.LU_A      GCC-GGTCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.LU_A      --TTG--GGTCAAC-CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.LU_A      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCCT-
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.LU_A      AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CG
TRY.BR_B      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.LU_A      GCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACTAGG--
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


HUM.LU_A      CTGACT--CTTAA-TAGGACCATTTCTTTT
TRY.BR_B      CAAG-TGT--CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#307

Mean pairwise ID: 29.73%


HUM.JA_B      ---GGCCTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT--
LEP.COL.      GCCGGAGC----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AACA


HUM.JA_B      TTA--GTTCGGC--CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TGCCCAT
LEP.COL.      GG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-T


HUM.JA_B      TCCAAGCCGAGAGTTGAGCTG-----TGTGAGCCGGACGAAGGTC-TGGCTTGGTCAGCT
LEP.COL.      GCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


HUM.JA_B      CCT-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTC
LEP.COL.      GT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCAC


HUM.JA_B      T-CGGCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTG
LEP.COL.      GTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC---


HUM.JA_B      AG-CTGACT--CTTAA-TAGGACCATTTCTTTT
LEP.COL.      --CCCAGGCGA--TCCTGTG--AAGCTTT----


[Download ClustalW]

#308

Mean pairwise ID: 29.75%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG------CGGGGGCAATAAGGTAGTGTG


ORI.CUN.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TCGTGCGCTATGCC----GATCGGGT
ZEA.MA_H      GATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-


ORI.CUN.      G-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG
ZEA.MA_H      CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CA


ORI.CUN.      TTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT
ZEA.MA_H      ACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC


ORI.CUN.      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG----CACTCCAGCCT
ZEA.MA_H      CACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT-----------


ORI.CUN.      GGGCAACATAGCGAGACCCTGTCTCC
ZEA.MA_H      --------------------------


[Download ClustalW]

#309

Mean pairwise ID: 29.75%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG------CGGGGGCAATAAGGTAGTGTG


CAN.SPE.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGCGCTATGCC----GATCGGGT
ZEA.MA_H      GATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-


CAN.SPE.      G-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG
ZEA.MA_H      CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CA


CAN.SPE.      TTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT
ZEA.MA_H      ACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC


CAN.SPE.      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG----CACTCCAGCCT
ZEA.MA_H      CACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT-----------


CAN.SPE.      GTGCAACATAGCGAGACCCCGTCTCT
ZEA.MA_H      --------------------------


[Download ClustalW]

#310

Mean pairwise ID: 29.78%


LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG--CGGGGGCAATAAGGTAGTGTGGATG


LEI.MAJ.      CGGGG-AGGACGTGGACCAGCGAGGGT-GATTTGC-TGCGTT----GACGTGGTG-CTC-
ZEA.MA_H      T-CAAT--TGT-GGT-GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-CACCCA


LEI.MAJ.      TGCTTGGCTG-TGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCC
ZEA.MA_H      TTCCAAGTTGCGTAGTGGGTTTC-GGATGCCTTGGCGAAAGCTTTG-CATCC-CAACA-C


LEI.MAJ.      GTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGT
ZEA.MA_H      T-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCAC-


LEI.MAJ.      CCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGCCCCA
ZEA.MA_H      CAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT--------------


LEI.MAJ.      CGCTTCGTCGCGAAGCCTT
ZEA.MA_H      -------------------


[Download ClustalW]

#311

Mean pairwise ID: 29.79%


LYC.ES_E      GTC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAAGGTGGTGGAATA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_E      --TTG--GGCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_E      TCCAAGTACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_E      AAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_E      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCC


LYC.ES_E      CTGTT--CTAG-TTAAACTACCACATTTT
TRY.BR_A      AAG-TGT-CGTCGCG--AGGCGG------


[Download ClustalW]

#312

Mean pairwise ID: 29.79%


HUM.JA_A      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAGATGGGACT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.JA_A      --TTG--GGTCAGC-CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.JA_A      TTCCAAGCCGAGAGTTGGGCTG-TGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCCT-
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.JA_A      AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT-CG
TRY.BR_A      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.JA_A      GCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA--T
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-----TTTGCGC-----CCC


HUM.JA_A      GCACT--CTTAA-TCAGACCATCTCTTTT
TRY.BR_A      AAG-TGT--CGTCGCG--AGGCGG-----


[Download ClustalW]

#313

Mean pairwise ID: 29.79%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAGTGAGGGCATCAGTGTGGTGGAATG--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


LYC.ES_C      TGAACATGC---CCAGAA-GGTA---GGGCTTGT--GTGACAATTCTCTGGCC-TGCCCT
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


LYC.ES_C      GTCCAAGCAA-AGAGTT-GGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


LYC.ES_C      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


LYC.ES_C      GTGCA-GTGGAA-GGATAACG-AGCCAGTGTCAT-ATAAGTTCAACGAATGTC-TGATGG
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG---GAT-GTGCAT---


LYC.ES_C      --GCTGTTCTAG-TTAAACTACCACATTT
SCH.POM.      GGAAGTAT--AAACACA-ACGGTCGTT--


[Download ClustalW]

#314

Mean pairwise ID: 29.82%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAAGGTGGTGGAATA-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_O      -TTG--GGCTGTC--CCAGAT-GGCTG-GGCTTGGT-GGGCTAATTTCTGGCC-TGCCCT
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-


LYC.ES_O      ATCCAAGCACAGAGTTGGATCA-----TGTGGTCCAATTGAAAGAA-TGGGCTACTAGAT
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


LYC.ES_O      TCCT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


LYC.ES_O      TT-GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGA
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGCGC-


LYC.ES_O      TGG-GCTGCT--CCAA-TTAAACCACCACTTT
LEP.COL.      ---CCCAGGCGA-TCCTGTG--AAGCTTT---


[Download ClustalW]

#315

Mean pairwise ID: 29.82%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_J      -TTG--GGCTTTA--CCAGAA-GGTTG-GGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCT
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-


LYC.ES_J      GTCCAAGCACAGAGTTGGATCA-----CGAGGCCCAAATGAAAATA-TGGGCTTCTTGAT
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


LYC.ES_J      TCCT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


LYC.ES_J      CT-GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAAT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


LYC.ES_J      GG-GTTGCT--CCAA--TAAACAACCACCTTT
LEP.COL.      --CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#316

Mean pairwise ID: 29.82%


ZEA.MA_F      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCTAAG--CGGGGGCATTAAGGTGGTGTGGAT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_F      GT-TTCC--TGACGGA-TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-TGCC
TRY.BR_B      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT----GACTTGGTG-TT


ZEA.MA_F      CGTTCCAAGTTGGTTGTGGCTGGT-GGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTAGAC
TRY.BR_B      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCG-


ZEA.MA_F      CT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTT
TRY.BR_B      T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCT-T-GCGCAC


ZEA.MA_F      C-CAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--CAGA
TRY.BR_B      GTTCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_F      G--CC-TCA--TTAA-ACAGACCACCATCTTT
TRY.BR_B      -CCCAAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#317

Mean pairwise ID: 29.82%


ZEA.MA_A      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGTGAAT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


ZEA.MA_A      GC-TTTG--CGATGGCTTTCTG-GGCCCTGGGCTCGT-TGTGACACTGGCCGGCT-TGCC
TRY.BR_B      GCGGGG-ACGTCTTGGACAAGCGGGG----GTTCTG-TTGCGTT----GACTTGGTG-TT


ZEA.MA_A      CATCCCAAGTTGGTAGTGTCTGGT-GGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-CAGA
TRY.BR_B      C-TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGA-GGCGTTCTCGCGCCG


ZEA.MA_A      CCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTC
TRY.BR_B      -T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCAC


ZEA.MA_A      C-CAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-CAGA
TRY.BR_B      GTTCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC--


ZEA.MA_A      A--CC-TCA--CTAA-GCAAACCACCATCTTT
TRY.BR_B      -CCCAAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#318

Mean pairwise ID: 29.82%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAAT-A
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_H      -TTG--GGCTGTA--CCAGAT-GGTTG-GGCTTGGT-GGGCTAATTTCTGACT-TGCCCT
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-


LYC.ES_H      ATCCAAGCTTAGAGTTGGATCA-----TGTGGCCCAATTGAAGAAA-TGGACTACTTGAT
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


LYC.ES_H      TCGT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


LYC.ES_H      CT-GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAAT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


LYC.ES_H      GG-GTTGCT--CCAA-TAAACAACCACCTTTT
LEP.COL.      --CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#319

Mean pairwise ID: 29.91%


TET.ROS.      GCCAGGGTAGCAATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AGTTA-GA
LYC.ES_M      ------------------------CAAG-TGGGGATGTTAAGGTGGTGGAATA--TTG-G


TET.ROS.      ATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CCCGTTCC
LYC.ES_M      GCTGTC--CCAGAT-GGCTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGCCCTGTCC


TET.ROS.      AAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAG
LYC.ES_M      AAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-AAAGT


TET.ROS.      CTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTG
LYC.ES_M      GGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTG


TET.ROS.      GAAGGATA-ACATACTC--A-TTAACTGTCAA------GCTAATCG-GTTCTG-CTATTC
LYC.ES_M      GAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCCTAATGG---GTTGCT-


TET.ROS.      --TGATCA-GACACT------
LYC.ES_M      CCAA--TAAACAACCACCTTT


[Download ClustalW]

#320

Mean pairwise ID: 29.94%


CIN.HYB.      ACC-GGGCTTGGTAACGCTAGTCTATAACTCAAG-----TGAGGGTATCAAAGTGGTTGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


CIN.HYB.      ACT--TTGA--GCTTGGC---TTAGCT-AGTTG-GGTCTGTA--GACACCGCACCTGGCT
DRO.MEL.      GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAA


CIN.HYB.      -TGCCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGA
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


CIN.HYB.      GCTTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTAC
DRO.MEL.      TTGGCTAAGG-AGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCG


CIN.HYB.      CTCTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG-CC
DRO.MEL.      TGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTATCA


CIN.HYB.      TGG--CTAGC---CCAA-CAGGACACCCATTT--
DRO.MEL.      G--CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#321

Mean pairwise ID: 29.97%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG------CGGGGGCAATAAGGTAGTGTG


HOM.SA_A      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGCGCTATGCC----GATCGGGT
ZEA.MA_H      GATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-


HOM.SA_A      G-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG
ZEA.MA_H      CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CA


HOM.SA_A      TTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT
ZEA.MA_H      ACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC


HOM.SA_A      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG----CACTCCAGCCT
ZEA.MA_H      CACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT-----------


HOM.SA_A      GTGCAACATAGCGAGACCCCGTCTCTT
ZEA.MA_H      ---------------------------


[Download ClustalW]

#322

Mean pairwise ID: 29.97%


LYC.ES_K      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_K      --TTG--GGCTTTA-CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTG
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_K      TCCAAGCACAGAGTAGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_K      AAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_K      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_K      TGCT--CCAA--TAAACAACCACCTTT
TRY.BR_A      AG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#323

Mean pairwise ID: 30.00%


DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-
ZEA.MA_H      NCC-GAGCTCTGTAGCGAGTGCTTGTAACCCGAG-----CGGGGGCAATAAGGTAGTGTG


DRO.MEL.      -GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGG-ACCAG-CTCATGTT----GACGGA
ZEA.MA_H      GATGT-CAAT--TGT-GGT----GCATG-TGCCT-GGGTCTA-GTGCTACAAACTGTGGA


DRO.MEL.      ACG-TCCGCACTAAGCTT-GCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCA
ZEA.MA_H      C-CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-


DRO.MEL.      GGTTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCC
ZEA.MA_H      CAACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCC


DRO.MEL.      GTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-----CGTTATCAG
ZEA.MA_H      GCCACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT---------


DRO.MEL.      CCCAACCGATATGGTTGGACCACAATCTTT
ZEA.MA_H      ------------------------------


[Download ClustalW]

#324

Mean pairwise ID: 30.00%


HUM.JA_B      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.JA_B      --TTA--GTTCGGC-CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.JA_B      TTCCAAGCCGAGAGTTGAGCTG-TGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCT-
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.JA_B      AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCT-CG
TRY.BR_A      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.JA_B      GCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTGAG--
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


HUM.JA_B      CTGACT--CTTAA-TAGGACCATTTCTTTT
TRY.BR_A      CAAG-TGT--CGTCGCG--AGGCGG-----


[Download ClustalW]

#325

Mean pairwise ID: 30.00%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG
LYC.ES_M      -----------------------------CAAG------TGGGGATGTTAAGGTGGTGGA


ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-
LYC.ES_M      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG


ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG
LYC.ES_M      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC


ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#326

Mean pairwise ID: 30.09%


LEI.MAJ.      GCCGGAGCTCTGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGCGGGGAGG
LYC.ES_M      ----------------------CAAG--TGGGGATGTTAAGGTGGTGGAATA--TTG--G


LEI.MAJ.      ACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TGCTTGGCT
LYC.ES_M      GCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTGTCCAAGCA


LEI.MAJ.      GTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCGA
LYC.ES_M      CAGAGTTGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-AAAGTGGG


LEI.MAJ.      GGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGC
LYC.ES_M      GCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTGCAGTGGA


LEI.MAJ.      AGAATC-ACACCGCG--GA-GCATGTCC-------GCACTTGAGC----CCCACGCTT-C
LYC.ES_M      AGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GTTGCT-CC


LEI.MAJ.      GTCGCG--AAGCCTT----
LYC.ES_M      AA--TAAACAACCACCTTT


[Download ClustalW]

#327

Mean pairwise ID: 30.12%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAATGTGGTGGAATG-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_N      -TTG--GGCTGTA--CCAGAT-GGTTG-GGCTTGGT-GGGCTAATTTCTGACT-TGCCCT
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-


LYC.ES_N      ATCCAAGCTTAGAGTTGGATCA-----TGTGGCCCAATTGAAGAAA-TGGACTACTTGAT
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


LYC.ES_N      TCGT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


LYC.ES_N      CT-AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGAT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


LYC.ES_N      GG-GTTGCT--CCAA-TTAAACCACCATTTTT
LEP.COL.      --CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#328

Mean pairwise ID: 30.12%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG--TGGGGACATTTAGATGGTGGAACAC
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


ARA.TH_E      --TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


ARA.TH_E      GTCCAAGCTGTGAGTAAGACG-----TGTGTGTCAAGCGAAGGCT-TGGCTCAAACGGCT
LEP.COL.      TGCTTGGCTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


ARA.TH_E      TCT-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCT
LEP.COL.      GT-TAA-A-GTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


ARA.TH_E      TA-CAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


ARA.TH_E      GGT-CCGATC--TCAT-ATGAACCACCATTTT
LEP.COL.      ---CCCAGGCGA-TCCTGTG--AAGCTTT---


[Download ClustalW]

#329

Mean pairwise ID: 30.12%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGATT
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG


ZEA.MA_E      C-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCCC
LEI.MAJ.      CGGGG-AGGACGTGGACCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC


ZEA.MA_E      GTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC-
LEI.MAJ.      -TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCG-C


ZEA.MA_E      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCTT
LEI.MAJ.      CGTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCC-C-ACGCAC


ZEA.MA_E      C-CAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACT-CAGGCC-CAG
LEI.MAJ.      GTCCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC-


ZEA.MA_E      AG--CC-TCA-CTAA-GCAGACCACCATCTTT
LEI.MAJ.      --CCCACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#330

Mean pairwise ID: 30.18%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAAGGTGGTGGAATA-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_E      -TTG--GGCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTAT
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TG


LYC.ES_E      CCAAGTACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-CT-A
LEI.MAJ.      CTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTT


LYC.ES_E      AAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
LEI.MAJ.      GAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCG


LYC.ES_E      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----CCC


LYC.ES_E      CTGTT-CTAG-TTAAACTACCACATTTT
LEI.MAJ.      ACGCTT-CGTCGCG--AAGCCTT-----


[Download ClustalW]

#331

Mean pairwise ID: 30.21%


TRI.AE_B      NCCGAGCTAGTTGCGGGAGCTTGTCACCCATG--TGGGGGCATTGAGGCGGTGTGGATGC
LEP.COL.      GCCGGAGC----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AAC


TRI.AE_B      -TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TGCCCG
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-C-GGCGTT---GACGTGGTG-CTC-


TRI.AE_B      TTCCAAGTTGGTAGTGGGCTG-----GGTGGCTGGGGCGAAAGCT-TCGCCTTCTCAGGC
LEP.COL.      TGCTTGGCTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


TRI.AE_B      -CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTT
LEP.COL.      GT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCAC


TRI.AE_B      C-CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA
LEP.COL.      GTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGCGC--


TRI.AE_B      -CCCCGC--CAT-A-GCAGACCACCATCTTT
LEP.COL.      CCCAGGCGA--TCCTGTG--AAGCTTT----


[Download ClustalW]

#332

Mean pairwise ID: 30.21%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


HUM.LU_D      -TTG--GGTCAAC-CTAGTG-GATC-GGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


HUM.LU_D      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTC-CT
LEI.MAJ.      TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCG


HUM.LU_D      -AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-C
LEI.MAJ.      TTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTC


HUM.LU_D      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACC-ATGCTT-CACTGGG
LEI.MAJ.      CGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC-----


HUM.LU_D      --CTGACT-CTTAA-TAGGACCATTTCTTTT
LEI.MAJ.      CCCACGCTT--CGTCGCG--AAGCCTT----


[Download ClustalW]

#333

Mean pairwise ID: 30.24%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG-----TGAGGGTATCAAAGTGGTTGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


CIN.HYB.      CT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-TG
CAE.EL_D      ATGGAGT-GAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-


CIN.HYB.      CCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT
CAE.EL_D      TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG


CIN.HYB.      TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTC
CAE.EL_D      CATAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGT


CIN.HYB.      TCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTG
CAE.EL_D      GGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAG-


CIN.HYB.      G--CTAGC---CCAA-CAGGACACCCATTT----
CAE.EL_D      -CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#334

Mean pairwise ID: 30.28%


LYC.ES_O      GCC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAAGGTGGTGGAATA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_O      --TTG--GGCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_O      TCCAAGCACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_O      AAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_O      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCC


LYC.ES_O      CTGCT--CCAA-TTAAACCACCACTTT
TRY.BR_A      AAG-TGT-CGTCGCG--AGGCGG----


[Download ClustalW]

#335

Mean pairwise ID: 30.28%


LYC.ES_J      GTC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_J      --TTG--GGCTTTA-CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTG
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_J      TCCAAGCACAGAGTTGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_J      AAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_J      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_J      TGCT--CCAA--TAAACAACCACCTTT
TRY.BR_A      AG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#336

Mean pairwise ID: 30.30%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG
LYC.ES_M      -----------------------------CAAG-----TGGGGATGTTAAGGTGGTGGAA


CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T
LYC.ES_M      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC


CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC
LYC.ES_M      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC


CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG
LYC.ES_M      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG


CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC
LYC.ES_M      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G


CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT
LYC.ES_M      TTGCT---CCAA--TAAACAACCACCTTT-


[Download ClustalW]

#337

Mean pairwise ID: 30.30%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGAACT-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


HUM.LU_C      -TTG--GGTCAAC-CCAGTG-GTNC-GGGNCCAGTGCTAGCTGCTTACCCGGC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


HUM.LU_C      TTCCAAGCCGGGAGGTGGGCTG-AGGGACCTGGGCGAAGGCTNNNGGNGCGCACTC-CT-
LEI.MAJ.      TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGTCCGCCGT


HUM.LU_C      AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CG
LEI.MAJ.      TGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCC


HUM.LU_C      GCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACA-CTGTTC-AACTGGG-
LEI.MAJ.      GCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC-----C


HUM.LU_C      -CTGACT-CTTAA-TAGGACCATTTCTTTT
LEI.MAJ.      CCACGCTT--CGTCGCG--AAGCCTT----


[Download ClustalW]

#338

Mean pairwise ID: 30.30%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG
LYC.ES_M      -----------------------------CAAG------TGGGGATGTTAAGGTGGTGGA


RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-
LYC.ES_M      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG


RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG
LYC.ES_M      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC


RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#339

Mean pairwise ID: 30.30%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG
LYC.ES_M      -----------------------------CAAG------TGGGGATGTTAAGGTGGTGGA


CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-
LYC.ES_M      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG


CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG
LYC.ES_M      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC


CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#340

Mean pairwise ID: 30.30%


HUM.JA_B      ---GGCCTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT--
LEI.MAJ.      GCCGGAGC---TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGCG


HUM.JA_B      TTA--GTTCGGC-CCATTG-GATC-GGATCCAGTGTTAGCTGCTTGCTGGGC-TGCCCAT
LEI.MAJ.      GGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-T


HUM.JA_B      TCCAAGCCGAGAGTTGAGCTG-TGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTC-CT-
LEI.MAJ.      GCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


HUM.JA_B      AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCT-CG
LEI.MAJ.      TGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCC


HUM.JA_B      GCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACC-ATGGTT-CACTGAG-
LEI.MAJ.      GCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC-----C


HUM.JA_B      -CTGACT-CTTAA-TAGGACCATTTCTTTT
LEI.MAJ.      CCACGCTT--CGTCGCG--AAGCCTT----


[Download ClustalW]

#341

Mean pairwise ID: 30.30%


ARA.TH_C      GTC-GAACTCAGTAACGCGGGCTTGTGATCCAAG--TGGAGACAATAAGGGGATGGGACG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_C      --TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGCCC
TRY.BR_A      CGGGGACGTCTTGGA--CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC


ARA.TH_C      ATTCCAAGTTGGGAGTTGAGGCA-TGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCT
TRY.BR_A      -TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-


ARA.TH_C      -AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT-T
TRY.BR_A      TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


ARA.TH_C      GACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAAG
TRY.BR_A      CCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC-----


ARA.TH_C      ---CCGCT--CCGA-TTGGACCATCACTTT
TRY.BR_A      CCCAAG-TGT-CGTCGCG--AGGCGG----


[Download ClustalW]

#342

Mean pairwise ID: 30.30%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


HUM.LU_A      TGGGTCAAC---CTAGTG-GATC---GGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


HUM.LU_A      TTCCAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


HUM.LU_A      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


HUM.LU_A      CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTAC-CTGGGTCCACCATGCTT-CACTAGG
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----


HUM.LU_A      --CTGACTCTTAA-TAGGACCATTTCTTTT
SCH.POM.      GGAAGTAT---AAACACA-ACGGTCGTT--


[Download ClustalW]

#343

Mean pairwise ID: 30.33%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG--TGGGGACTATAAGATGGTGGAACAC
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


ARA.TH_G      --TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


ARA.TH_G      ATCCAAGCTGTGAGTGAACCG-----TATGAACCAAGCGAAGGTT-TGATCCGTACGGTT
LEP.COL.      TGCTTGGCTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


ARA.TH_G      GCT-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCT
LEP.COL.      GT-TAA-A-GTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


ARA.TH_G      CT-CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


ARA.TH_G      GGC-TCGTAA--CCCGC-TTGAACCACCATTTT
LEP.COL.      ---CCCAGGCGA--TCCTGTG--AAGCTTT---


[Download ClustalW]

#344

Mean pairwise ID: 30.33%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGAAC-A
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


HUM.LU_B      -TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


HUM.LU_B      TTCCAAGCCGGGAGTTGGGCTG-----AGTGACCTGGGCGAAGGCC-TGGGTTGCGCAGC
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


HUM.LU_B      TCCT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


HUM.LU_B      CC-CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTG
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-----ACCTGCGC---


HUM.LU_B      GTCCTGACT--CTTAA-TCGGACCATTTCCTTT
LEP.COL.      --CCCAGGCGA--TCCTGTG--AAGCTTT----


[Download ClustalW]

#345

Mean pairwise ID: 30.34%


TRI.AE_A      NCC-GAGCTCAGTTGCGAGAGCTTGTAACCCGAG--TGGGGGCATTAAAGTGATGTGAAC
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


TRI.AE_A      GC-TGTT--GTA-GCG-CTGCG-GGCCTGGTCTGGG-TGTGCTACTGCTGGCC-CGCCCG
TRY.BR_A      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-TTGCGTT---GACTTGGTG-TTC-


TRI.AE_A      TTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CGGTCCA
TRY.BR_A      TGCTTGGTTG-CGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-


TRI.AE_A      TAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC-C
TRY.BR_A      TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


TRI.AE_A      AACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGCAG---
TRY.BR_A      CCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC---CCC


TRI.AE_A      CCTAC--TCCA-GCAGACCACC-
TRY.BR_A      AAG-TGT-CGTCGCG--AGGCGG


[Download ClustalW]

#346

Mean pairwise ID: 30.37%


HUM.JA_B      GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--TTAGT
SCH.POM.      -CGC--------------TGTAA----TG----GC------TTGGTCG-AAGTGTTTAGT


HUM.JA_B      TCGGC---CCATTG-GATC---GGATCCAGTGTTAGCTGCTTGCTGGGC-TGCCCATTCC
SCH.POM.      ACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCTTTCG


HUM.JA_B      AAGCCG-AGAGTT-GAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTC-CT-AA
SCH.POM.      -ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTAA


HUM.JA_B      AGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCT-CGGC
SCH.POM.      ACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTTGGGC


HUM.JA_B      A-GTGGAA-GGATAACG-GGCCGGTGCTGC-TTGGACCCACCATGGTT-CACTGAG--CT
SCH.POM.      AGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----GGAA


HUM.JA_B      GACTCTTAA-TAGGACCATTTCTTTT
SCH.POM.      GTAT---AAACACA-ACGGTCGTT--


[Download ClustalW]

#347

Mean pairwise ID: 30.37%


TRI.AE_A      NCC-GAGCTCAGTTGCGAGAGCTTGTAACCCGAG--TGGGGGCATTAAAGTGATGTGAAC
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT---A


TRI.AE_A      GC-TGTT--GTA-GCG-CTGCG-GGCCTGGTCTGGG-TGTGCTACTGCTGGCC-CGCCCG
TRY.BR_B      GCGGGG-ACGTCTTGGACAAGCGGGG---GTTCTG-TTGCGTT---GACTTGGTG-TTC-


TRI.AE_A      TTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CGGTCCA
TRY.BR_B      TGCTTGGTTG-CGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-


TRI.AE_A      TAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC-C
TRY.BR_B      TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


TRI.AE_A      AACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGCAG---
TRY.BR_B      CCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC---CCC


TRI.AE_A      CCTAC--TCCA-GCAGACCACC----
TRY.BR_B      AAG-TGT-CGTCGCG--AGGCGGTTT


[Download ClustalW]

#348

Mean pairwise ID: 30.38%


ORY.SA_A      GCC-GAGCTCAGTAGCGAGAGCCTGTAACCCAAG--CGGGGGCACTAAAGGTGGCTGCGG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT----GATCCCGCTT---


ORY.SA_A      ATGT-TTGGTGTGGATTCTGATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT-TG
TRY.BR_B      -AGCGGGG--ACGTCTTGGA-CAAGCGGGG---GTTCTG-T-TGCGTT--GACTTGGTG-


ORY.SA_A      CCCGTTCCAAGTTGCGTAGTGGGCCGG-AGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTC
TRY.BR_B      TTC-TGCTTGGTTG-CGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGC


ORY.SA_A      TCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGC
TRY.BR_B      CG-----T-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-


ORY.SA_A      CCGCTTC-CATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGGC
TRY.BR_B      GCGCACGTTCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTT


ORY.SA_A      C-CAGAGT--CCCTCT--ACAA--CAGACCACCATCTTT
TRY.BR_B      GCGC----CCCAAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#349

Mean pairwise ID: 30.40%


LYC.ES_E      GTC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAAGGTGGTGGAATA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_E      --TTG--GGCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_E      TCCAAGTACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_E      AAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_E      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCC


LYC.ES_E      CTGTT--CTAG-TTAAACTACCACATTTT
TRY.BR_B      AAG-TGT-CGTCGCG--AGGCGGTTT---


[Download ClustalW]

#350

Mean pairwise ID: 30.40%


HUM.LU_B      ----GGCCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGAAC-
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.LU_B      A-TTG--GGTCAGC-CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.LU_B      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCT-
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.LU_B      AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC-CG
TRY.BR_A      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.LU_B      GCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGT-CC
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-----TTTGCGC-----CCC


HUM.LU_B      TGACT--CTTAA-TCGGACCATTTCCTTT
TRY.BR_A      AAG-TGT--CGTCGCG--AGGCGG-----


[Download ClustalW]

#351

Mean pairwise ID: 30.48%


TET.ROS.      GCCAGGGTAGCAATGCCTGTGACCTCGTGTGGCATAAACAATGTAGTTA-GAATAGTCAG
LYC.ES_L      ---------------------------------------------G-TTG-GGTTGAC--


TET.ROS.      AGTATGAGA-GTTTGATGAGACAGTTTGCT-----AAGAGTGTG-CCCGTTCCAAACAGT
LYC.ES_L      CCAGAT-GGTTG---GGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCTCTCCAAGCATG


TET.ROS.      GAGT-TGCTATGGTGGAAACCTAGTAATAG-GACTTCACCAGGGCATTAAAGAGCTGAGG
LYC.ES_L      GAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-AAAGTGGGGTG


TET.ROS.      AACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGAAGGA
LYC.ES_L      GACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAGGA


TET.ROS.      TA-ACATACTC--ATTAACTGTCAA-------GCTAAT-CG-GTTCTG-CTATTC--TGA
LYC.ES_L      TAACG-GGTCAGTGCTC--AGCGAGTCCAGTTAACGCCCTGATGG---GCTGCT-CCAA-


TET.ROS.      TCA-GACACT-----
LYC.ES_L      CTAAACCACCACTTT


[Download ClustalW]

#352

Mean pairwise ID: 30.49%


LYC.ES_G      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_G      --TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_G      TCCAAGCACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_G      AAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_G      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCC


LYC.ES_G      CTGCT--CCAA-TTAAACCACCACTTTT
TRY.BR_A      AAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#353

Mean pairwise ID: 30.51%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGATT
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG


ZEA.MA_D      C-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCCC
LEI.MAJ.      CGGGG-AGGACGTGGACCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC


ZEA.MA_D      GTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC-
LEI.MAJ.      -TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCG-C


ZEA.MA_D      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTT
LEI.MAJ.      CGTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCC-C-ACGCAC


ZEA.MA_D      C-CAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACT-CAGGCC-CAG
LEI.MAJ.      GTCCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC-


ZEA.MA_D      AG--CC-TCA-CTAA-GCAGACCACCATCTT
LEI.MAJ.      --CCCACGCTT-CGTCGCG--AAGCCTT---


[Download ClustalW]

#354

Mean pairwise ID: 30.51%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGCGGATT
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG


ZEA.MA_G      C-TTTG--CGATGGCTTTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-TGCCC
LEI.MAJ.      CGGGG-AGGACGTGGACCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC


ZEA.MA_G      GTCCCAAGTTGGTAGTGGCTGGC-GGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGAC-
LEI.MAJ.      -TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCG-C


ZEA.MA_G      CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTTC
LEI.MAJ.      CGTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACG


ZEA.MA_G      -CAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACT-CAGGCC-CAGA
LEI.MAJ.      TCCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC--


ZEA.MA_G      G--CC-TCA-CTAA-GCAGACCACCATCTTT
LEI.MAJ.      -CCCACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#355

Mean pairwise ID: 30.51%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


HUM.LU_A      -TTG--GGTCAAC-CTAGTG-GATC-GGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


HUM.LU_A      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTC-CT
LEI.MAJ.      TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCG


HUM.LU_A      -AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-C
LEI.MAJ.      TTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTC


HUM.LU_A      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACC-ATGCTT-CACTAGG
LEI.MAJ.      CGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC-----


HUM.LU_A      --CTGACT-CTTAA-TAGGACCATTTCTTTT
LEI.MAJ.      CCCACGCTT--CGTCGCG--AAGCCTT----


[Download ClustalW]

#356

Mean pairwise ID: 30.52%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG--CGGGGGCACTAAAGGTGGCTGCGGA
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT---TTCACCAGCTG----


ORY.SA_A      TGT-TTGGTGTGGATTCTG--ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT-T
LEP.COL.      AACAGG---GAGCTGTCT-GGACCAGCATAGG-GTGCTTG-C-GGCGTT--GACGTGGTG


ORY.SA_A      GCCCGTTCCAAGTTGCGTAGTGGGCCGG-----AGGGGCTTTGGCGAAGGCC-TTTGCTT
LEP.COL.      -CTC-TGCTTGGCTG-TGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGC


ORY.SA_A      TGCTTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGAT
LEP.COL.      CCCCTCCG-----T-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA


ORY.SA_A      CACTGCCCGCTTC-CATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCT
LEP.COL.      -CCTC-GCGCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-----


ORY.SA_A      TCTGGCC-CAGAGT-CCCTCT--ACAA--CAGACCACCATCTTT
LEP.COL.      --ACCTGCGC----CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#357

Mean pairwise ID: 30.54%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


HUM.LU_A      -TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


HUM.LU_A      TTCCAAGCCGGGAGTTGGGCTG-----AGTGACCTGGGCGAAGGGC-TGGGTTGCGCACG
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


HUM.LU_A      TCCT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


HUM.LU_A      CT-CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


HUM.LU_A      AGG-CTGACT--CTTAA-TAGGACCATTTCTTTT
LEP.COL.      ---CCCAGGCGA--TCCTGTG--AAGCTTT----


[Download ClustalW]

#358

Mean pairwise ID: 30.54%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


HUM.LU_D      -TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


HUM.LU_D      TTCCAAGCCGGGAGTTGGGCTG-----AGTGACCTGGGCGAAGGCT--GGGTTGCGCAGC
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


HUM.LU_D      TCCT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


HUM.LU_D      CT-CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


HUM.LU_D      GGG-CTGACT--CTTAA-TAGGACCATTTCTTTT
LEP.COL.      ---CCCAGGCGA--TCCTGTG--AAGCTTT----


[Download ClustalW]

#359

Mean pairwise ID: 30.54%


ORY.SA_B      GCC-GAGCCAGGTAGCGTTGGCTTGTCACCCGAG--CGGGGGCAATAAGGTGGTGTTGGA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT----


ORY.SA_B      TGC-CTGGTC-GTTTGCG-CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC-CGC
TRY.BR_A      AGCGGGG--ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT---GACTTGGTG-T


ORY.SA_B      CCGTTCCAAGTTGCGTAGCGTGTGTG--GGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGC
TRY.BR_A      TC-TGCTTGGTTG-CGTGT--CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGC


ORY.SA_B      ACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCT
TRY.BR_A      CGT-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCA


ORY.SA_B      TC-CAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-C-A
TRY.BR_A      CGTTCCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC-


ORY.SA_B      AGT--GCCTTC--CATG-GCAGACCACCACCTTT
TRY.BR_A      ---CCCAAG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#360

Mean pairwise ID: 30.58%


HUM.LU_C      GGTCTTAGCAACTTGGTCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGAACT--TTGG
SCH.POM.      -CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTTTAG


HUM.LU_C      GTCAAC---CCAGTG-GTNC---GGGNCCAGTGCTAGCTGCTTACCCGGC-TGCCCATTC
SCH.POM.      TACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCTTTC


HUM.LU_C      CAAGCCG-GGAGGT-GGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC-CT-A
SCH.POM.      G-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTA


HUM.LU_C      GACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CGG
SCH.POM.      AACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTTGGG


HUM.LU_C      CA-GTGGAA-GGATAACG-GGCCGGTGCGCC-TTGAGCCAACACTGTTC-AACTGGG--C
SCH.POM.      CAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----GGA


HUM.LU_C      TGACTCTTAA-TAGGACCATTTCTTTT
SCH.POM.      AGTAT---AAACACA-ACGGTCGTT--


[Download ClustalW]

#361

Mean pairwise ID: 30.58%


LYC.ES_K      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_K      --TTG--GGCTTTA-CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTG
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_K      TCCAAGCACAGAGTAGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_K      AAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_K      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_K      TGCT--CCAA--TAAACAACCACCTTT
TRY.BR_B      AG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#362

Mean pairwise ID: 30.60%


TET.THE.      GCCAGGGTAGCAATACCTGTGTCTATATGTGGCATAAACAATGTAGGTT--GTGATAGAT
LYC.ES_L      ----------------------------------------------G-TTG--GGTTGAC


TET.THE.      AGGATATGAGA-GTTTGATGAGACAGTTTGCT-----AAGAGTGTG-CCCGCTCCAAACA
LYC.ES_L      --CCAGAT-GGTTG---GGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCTCTCCAAGCA


TET.THE.      ATGAGT-TGCTATGGTGGTAACCTAGTAATAG-GACTCCACCAGGGCATTAAAGAGCTAA
LYC.ES_L      TGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-AAAGTGGGG


TET.THE.      GGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGAAG
LYC.ES_L      TGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTGGAAG


TET.THE.      GATA-ACATACTC--ATTAACTGTCAA-------ACTAAT-CG-GTTCTA-CTATCA--A
LYC.ES_L      GATAACG-GGTCAGTGCTC--AGCGAGTCCAGTTAACGCCCTGATGG---GCTGCT-CCA


TET.THE.      AGCCA-GACATT-----
LYC.ES_L      A-CTAAACCACCACTTT


[Download ClustalW]

#363

Mean pairwise ID: 30.61%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG
LYC.ES_M      -----------------------------CAAG------TGGGGATGTTAAGGTGGTGGA


HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-
LYC.ES_M      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG


HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG
LYC.ES_M      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC


HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#364

Mean pairwise ID: 30.61%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAAATGGGACT--T
SCH.POM.      ----CGC---------------TGTAA----TG----GC------TTGGTCG-AAGTGTT


HUM.LU_D      TGGGTCAAC---CTAGTG-GATC---GGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
SCH.POM.      TAGTACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCT


HUM.LU_D      TTCCAAGCCG-GGAGTT-GGGCTGAGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTC-C
SCH.POM.      TTCG-ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAG


HUM.LU_D      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-
SCH.POM.      TTAAACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTT


HUM.LU_D      CGGCA-GTGGAA-GGATAACG-GGCCGGTGCTAC-CTGGATCCACCATGCTT-CACTGGG
SCH.POM.      GGGCAGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----


HUM.LU_D      --CTGACTCTTAA-TAGGACCATTTCTTTT
SCH.POM.      GGAAGTAT---AAACACA-ACGGTCGTT--


[Download ClustalW]

#365

Mean pairwise ID: 30.61%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAATGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_N      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_N      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_N      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_N      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--C


LYC.ES_N      GTTGCT---CCAA-TTAAACCACCATTTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#366

Mean pairwise ID: 30.61%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG--TGGGGACATTAAGATGGTGGGACAC
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


ARA.TH_A      -TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCAG
LEP.COL.      AGGGAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-T


ARA.TH_A      TCCAAGCTGTGAGTAATTAG----TGTTGAGTTGAGCGAAGGCT-TGGCTCATGCAGGTT
LEP.COL.      GCTTGGCTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCG


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
LEP.COL.      T-TAA-A-GTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCAC


ARA.TH_A      A-CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTG
LEP.COL.      GTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC---


ARA.TH_A      G-TCCGAT--CTCATATGAACCACCATTTT
LEP.COL.      -CCCAGGCGA-TCCTGTG--AAGCTTT---


[Download ClustalW]

#367

Mean pairwise ID: 30.61%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_A      -TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTG
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-CGGCGTT----GACGTGGTG-CTC-T


LYC.ES_A      TCCAAGCACAGAGTTGGATCT-----CGAGGCCCAAATGAAAATA-TGGGCTTCTTGATT
LEP.COL.      GCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


LYC.ES_A      CCT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCT
LEP.COL.      GT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCACCTC-GCGCACG


LYC.ES_A      -GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG
LEP.COL.      TCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC----


LYC.ES_A      -GTTGCT--CCAA--TAAACAACCACCTTT
LEP.COL.      CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#368

Mean pairwise ID: 30.67%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG------CGGGGGCAATAAGGTAGTGTG


HOM.SA_B      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---TAGTGCGCTATGCC----GATGGGGT
ZEA.MA_H      GATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-


HOM.SA_B      G-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG
ZEA.MA_H      CACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CA


HOM.SA_B      TTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT
ZEA.MA_H      ACACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC


HOM.SA_B      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG----CACTCCAGCCT
ZEA.MA_H      CACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT-----------


HOM.SA_B      GAGCAACATAGCGAGACCCCGTCTCT
ZEA.MA_H      --------------------------


[Download ClustalW]

#369

Mean pairwise ID: 30.68%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG--CGGGGGCAATAAGGTGGTGTTGGAT
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG----A


ORY.SA_B      GC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC-CG
LEP.COL.      ACAGG---GAGCTGTCTGGACCAGCATAGG-GTGCTTG-C-GGCGTT---GACGTGGTG-


ORY.SA_B      CCCGTTCCAAGTTGCGTAGCGTGTGTG------GGGCGCCTGGGCGAAGGCT-CGAGCGT
LEP.COL.      CTC-TGCTTGGCTG-TGTGT--CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGC


ORY.SA_B      CCCTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCG
LEP.COL.      CCCCTCCGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC


ORY.SA_B      CCCGCTTC-CAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGG
LEP.COL.      -GCGCACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACC


ORY.SA_B      CC-C-AAGT-GCCTTC--CATG-GCAGACCACCACCTTT
LEP.COL.      TGCGC----CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#370

Mean pairwise ID: 30.70%


ARA.TH_G      GTC-GAGCTATGTAACGAGAGCTTGTAACCCAAG--TGGGGACTATAAGATGGTGGAACA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_G      C--TG--GATCGGC-CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_G      ATCCAAGCTGTGAGTGAACCG-TATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT-A
TRY.BR_B      TGCTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


ARA.TH_G      AAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-CA
TRY.BR_B      A-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


ARA.TH_G      GCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC--
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


ARA.TH_G      TCGTAA--CCCGC-TTGAACCACCATTTT
TRY.BR_B      CAAG-TGT--CGTCGCG--AGGCGGTTT-


[Download ClustalW]

#371

Mean pairwise ID: 30.70%


HUM.JA_A      ---GGCCTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAGATGGGACT--
LEI.MAJ.      GCCGGAGC---TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGCG


HUM.JA_A      TTG--GGTCAGC-CCATTG-GATC-GGGTCCAGTGTTAGCTGCTTGCTGGTC-TGCCCAT
LEI.MAJ.      GGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-T


HUM.JA_A      TCCAAGCCGAGAGTTGGGCTG-TGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC-CT-
LEI.MAJ.      GCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


HUM.JA_A      AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT-CG
LEI.MAJ.      TGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCC


HUM.JA_A      GCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACC-ATGG-T-CACTGCA--
LEI.MAJ.      GCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC-------GCACTTGAGC-----CC


HUM.JA_A      TGCACT-CTTAA-TCAGACCATCTCTTTT
LEI.MAJ.      CACGCTT--CGTCGCG--AAGCCTT----


[Download ClustalW]

#372

Mean pairwise ID: 30.70%


HUM.JA_A      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAGATGGGACT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.JA_A      --TTG--GGTCAGC-CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.JA_A      TTCCAAGCCGAGAGTTGGGCTG-TGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCCT-
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.JA_A      AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT-CG
TRY.BR_B      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.JA_A      GCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA--T
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-----TTTGCGC-----CCC


HUM.JA_A      GCACT--CTTAA-TCAGACCATCTCTTTT
TRY.BR_B      AAG-TGT--CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#373

Mean pairwise ID: 30.70%


TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG--TGGGGGCATTAAAGTGATGTGAACG
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG---AA


TRI.AE_A      C-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG-TGTGCTACTGCTGGCC-CGCCC
LEP.COL.      CAGG--GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT---GACGTGGTG-CTC


TRI.AE_A      GTTCCAAGTTGCGTAGTGGACCGCC----TGGGGCTTATGCGAAAGC--TGGGTCTCA-C
LEP.COL.      -TGCTTGGCTG-TGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCC


TRI.AE_A      GGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG
LEP.COL.      TCCGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCG


TRI.AE_A      CTTC-CAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCG
LEP.COL.      CACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC


TRI.AE_A      CAG--CCTAC--TCCA-GCAGACCACC--
LEP.COL.      ---CCCAGGCGA-TCCTGTG--AAGCTTT


[Download ClustalW]

#374

Mean pairwise ID: 30.72%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_I      -TTG--GGCTGTA--CCAGAT-GGTTG-GGCTTGGT-GGGCTAATTTCTGACT-TGCCCT
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC-


LYC.ES_I      ATCCAAGCTTAGAGTTGGATCA-----TGTGGCCCAATTGAAGAAA-TGGACTACTTGAT
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


LYC.ES_I      TCGT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


LYC.ES_I      CT-AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGAT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


LYC.ES_I      GG-GTTGCT--CCAA-TTAAACCACCATTTTT
LEP.COL.      --CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#375

Mean pairwise ID: 30.79%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG------CGGGGGCACTAAAGGTGGCTG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC----TGAGCCCGCC


ORY.SA_A      CGGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGC
GAL.GAL.      --GGATCGCTT--GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC--GAGCGG


ORY.SA_A      T-TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGC
GAL.GAL.      GCG-TCCGCGCTAAGGCC-GGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCA


ORY.SA_A      TTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCAC
GAL.GAL.      GGTTG-----CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAA


ORY.SA_A      TGCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTG
GAL.GAL.      CTCCCGTGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------


ORY.SA_A      GCC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
GAL.GAL.      CAGCGTAG--CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#376

Mean pairwise ID: 30.79%


CIN.HYB.      ACC-GGGCTTGGTAACGCTAGTCTATAACTCAAG-TGAGGGTATCAAAGTGGTTGAACT-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


CIN.HYB.      -TTGA--GCTTGGC--TTAGCT-AGTTG---GGTCTGTA--GACACCGCACCTGGCT-TG
TET.THE.      TT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-


CIN.HYB.      CCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT
TET.THE.      CCCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCA


CIN.HYB.      TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTC
TET.THE.      TTAAAGA-GCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTT


CIN.HYB.      TCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG-CCTGG
TET.THE.      GTTGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA-------ACTAATCG-GTT


CIN.HYB.      ---CTAGC-CCAA-CAGGACACCCATTT
TET.THE.      CTACTATCA--AAGCCA-GACATT----


[Download ClustalW]

#377

Mean pairwise ID: 30.79%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_B      -TTG--GGCTGTA-CCAGAT-GGTT-GGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-CTGCGTT----GACGTGGTG-CTC-T


LYC.ES_B      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTC-GT-
LEI.MAJ.      GCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


LYC.ES_B      AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT-AA
LEI.MAJ.      TGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCC


LYC.ES_B      GCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGT-AATGCC-TGATGG--
LEI.MAJ.      GCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----CC


LYC.ES_B      GCTGCT-CTAA-TTAAACCACCACTTTT
LEI.MAJ.      CACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#378

Mean pairwise ID: 30.82%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGCGCGGATG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG


ZEA.MA_B      C-TTTG--CGATGGT-TTCTG-GGCCTGGGCTCGT-TGTGACTCTAGCCGGCT-TGCCCA
LEI.MAJ.      CGGGG-AGGACGTGGACCAGCGAGGGT-GATTTG-CTGCGTT----GACGTGGTG-CTC-


ZEA.MA_B      TCCCAAGTTGGTAGTGTCTGAC-GGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-CAGAC-
LEI.MAJ.      TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGG-GTGGCGCGGGT-CCG-C


ZEA.MA_B      CT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCACTT
LEI.MAJ.      CGTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCC-C-ACGCAC


ZEA.MA_B      C-CAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACA-CAGACC-CAG
LEI.MAJ.      GTCCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC-


ZEA.MA_B      A-TCC-TCT-CTTA-GCAAACCACCATCTTT
LEI.MAJ.      -CCCACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#379

Mean pairwise ID: 30.82%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_B      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_B      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_B      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTA
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_B      AGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-G
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CC


LYC.ES_B      CTGCT---CTAA-TTAAACCACCACTTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#380

Mean pairwise ID: 30.82%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG--TGGAGACAATAAGGGGATGGGACG-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


ARA.TH_C      -TTG--GGTCGAT-CTCATTG-GGCC-GGGTTCGGGTTGGGCTATATTCTGGCC-CGCCC
LEI.MAJ.      GGGGAGGACGTGGA--CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC


ARA.TH_C      ATTCCAAGTTGGGAGTTGAGGCA-TGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT-C
LEI.MAJ.      -TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCC


ARA.TH_C      T-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT-
LEI.MAJ.      GTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGT


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACT-ATGACC-CAATA
LEI.MAJ.      CCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC---


ARA.TH_C      AG---CCGCT-CCGA-TTGGACCATCACTTT
LEI.MAJ.      --CCCACGCTT-CGTCGCG--AAGCCTT---


[Download ClustalW]

#381

Mean pairwise ID: 30.84%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG-----TGAGGGTATCAAAGTGGTTGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


CIN.HYB.      CT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-TG
CAE.EL_A      ATGGAGT-GAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-


CIN.HYB.      CCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT
CAE.EL_A      TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG


CIN.HYB.      TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTC
CAE.EL_A      CATAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGT


CIN.HYB.      TCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTG
CAE.EL_A      GGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAG-


CIN.HYB.      G--CTAGC---CCAA-CAGGACACCCATTT----
CAE.EL_A      -CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#382

Mean pairwise ID: 30.84%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGAACT-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


HUM.LU_C      -TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGCCCA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-C-GGCGTT----GACGTGGTG-CTC-


HUM.LU_C      TTCCAAGCCGGGAGGTGGGCTG-----AGGGACCTGGGCGAAGGCT-NNNGGNGCGCA-C
LEP.COL.      TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTC


HUM.LU_C      TCCT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCT
LEP.COL.      CGT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCA


HUM.LU_C      CT-CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACT
LEP.COL.      CGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC--


HUM.LU_C      GGG-CTGACT--CTTAA-TAGGACCATTTCTTTT
LEP.COL.      ---CCCAGGCGA--TCCTGTG--AAGCTTT----


[Download ClustalW]

#383

Mean pairwise ID: 30.89%


LYC.ES_I      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_I      --TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_I      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_I      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT-AAG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_I      CGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG--GT
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_I      TGCT--CCAA-TTAAACCACCATTTTT
TRY.BR_A      AG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#384

Mean pairwise ID: 30.89%


LYC.ES_N      GTT-GAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAATGTGGTGGAATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_N      --TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_N      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_N      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT-AAG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_N      CGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG--GT
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_N      TGCT--CCAA-TTAAACCACCATTTTT
TRY.BR_A      AG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#385

Mean pairwise ID: 30.89%


CIN.HYB.      ACC-GGGCTTGGTAACGCTAGTCTATAACTCAAG-TGAGGGTATCAAAGTGGTTGAACT-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


CIN.HYB.      -TTGA-GCTTGGC--TTAGCT-AGTTG---GGTCTGTA--GACACCGCACCTGGCT-TGC
TET.ROS.      TTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


CIN.HYB.      CCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTT
TET.ROS.      CCGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCAT


CIN.HYB.      T-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCT
TET.ROS.      TAAAGA-GCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTA


CIN.HYB.      CGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG-CCTGG-
TET.ROS.      TTGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA-------GCTAATCG-GTTC


CIN.HYB.      --CTAGC-CCAA-CAGGACACCCATTT
TET.ROS.      TGCTATTC--TGATCA-GACACT----


[Download ClustalW]

#386

Mean pairwise ID: 30.89%


LYC.ES_J      GTC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_J      --TTG--GGCTTTA-CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTG
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_J      TCCAAGCACAGAGTTGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_J      AAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_J      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_J      TGCT--CCAA--TAAACAACCACCTTT
TRY.BR_B      AG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#387

Mean pairwise ID: 30.89%


LYC.ES_H      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAAT-
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_H      A-TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_H      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_H      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_H      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_H      TGCT--CCAA-TAAACAACCACCTTTT
TRY.BR_A      AG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#388

Mean pairwise ID: 30.91%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG
LYC.ES_M      -----------------------------CAAG------TGGGGATGTTAAGGTGGTGGA


HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-
LYC.ES_M      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG


HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG
LYC.ES_M      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC


HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#389

Mean pairwise ID: 30.91%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG
LYC.ES_M      -----------------------------CAAG-----TGGGGATGTTAAGGTGGTGGAA


CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T
LYC.ES_M      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC


CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC
LYC.ES_M      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC


CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG
LYC.ES_M      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG


CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC
LYC.ES_M      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G


CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT
LYC.ES_M      TTGCT---CCAA--TAAACAACCACCTTT-


[Download ClustalW]

#390

Mean pairwise ID: 30.91%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG
LYC.ES_M      -----------------------------CAAG------TGGGGATGTTAAGGTGGTGGA


RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-
LYC.ES_M      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG


RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG
LYC.ES_M      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC


RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#391

Mean pairwise ID: 30.91%


HUM.JA_B      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGGACT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.JA_B      --TTA--GTTCGGC-CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.JA_B      TTCCAAGCCGAGAGTTGAGCTG-TGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCT-
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.JA_B      AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCT-CG
TRY.BR_B      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.JA_B      GCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTGAG--
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


HUM.JA_B      CTGACT--CTTAA-TAGGACCATTTCTTTT
TRY.BR_B      CAAG-TGT--CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#392

Mean pairwise ID: 30.93%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


ZEA.MA_C      GATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-T
GAL.GAL.      GGATCGCTTGAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC---GAGCGGGCG


ZEA.MA_C      GCCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTG
GAL.GAL.      -TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCG-AGGCACACCAGGT


ZEA.MA_C      GACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGC
GAL.GAL.      TG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT


ZEA.MA_C      TATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAG
GAL.GAL.      GCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTA


ZEA.MA_C      ACTTC-ATA---CTAAAGCAGACCACCATTTTT
GAL.GAL.      G-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#393

Mean pairwise ID: 30.93%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G


ZEA.MA_C      ATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TG
CAE.EL_C      GATGGAGTGAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC---GACCGAGCG-


ZEA.MA_C      CCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGG
CAE.EL_C      TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGAT-GGTCAGTCCCGGGT


ZEA.MA_C      ACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCT
CAE.EL_C      G-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCG


ZEA.MA_C      ATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAGA
CAE.EL_C      CGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG


ZEA.MA_C      CTTC-ATA---CTAAAGCAGACCACCATTTTT-
CAE.EL_C      -CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#394

Mean pairwise ID: 30.95%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


ZEA.MA_A      AATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGC
GAL.GAL.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG----CAGTGC-GCTATGCC----GAGCGG


ZEA.MA_A      T-TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG
GAL.GAL.      GCG-TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCG-AGGCACACCA


ZEA.MA_A      -CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCC
GAL.GAL.      GGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ZEA.MA_A      GACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-
GAL.GAL.      CGTGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGC


ZEA.MA_A      CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
GAL.GAL.      GTAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#395

Mean pairwise ID: 30.95%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G


ZEA.MA_A      ATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGCT
CAE.EL_C      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG---TCGTTG-TCAACGTC----GACCGAG


ZEA.MA_A      -TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-
CAE.EL_C      CG-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGAT-GGTCAGTCCCG


ZEA.MA_A      CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCG
CAE.EL_C      GGTG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACC


ZEA.MA_A      ACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-C
CAE.EL_C      GCGCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACA


ZEA.MA_A      AGAA-CC-TCA---CTAA-GCAAACCACCATCTTT-
CAE.EL_C      CAG-CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#396

Mean pairwise ID: 31.00%


HUM.LU_B      ----GGCCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGAAC-
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


HUM.LU_B      A-TTG--GGTCAGC-CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


HUM.LU_B      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCCT-
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


HUM.LU_B      AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC-CG
TRY.BR_B      AA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


HUM.LU_B      GCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGT-CC
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-----TTTGCGC-----CCC


HUM.LU_B      TGACT--CTTAA-TCGGACCATTTCCTTT
TRY.BR_B      AAG-TGT--CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#397

Mean pairwise ID: 31.10%


LYC.ES_K      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-TGGAGACATCAAAGTGGTTGAATA-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_K      -TTG--GGCTTTA--CCAGAA-GGTTG---GGCTTGGT--GGGCTTAGTTCTGGCC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_K      CCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_K      T-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_K      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCCTAATGG---
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------ACTAATCG-GTTCTA


LYC.ES_K      GTTGCT-CCAA--TAAACAACCACCTTT
TET.THE.      -CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#398

Mean pairwise ID: 31.10%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG-----CGGGGGCAATAAGGTAGTGTGG


CAE.EL_B      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTGTCAACGTC----GACCGAGCG
ZEA.MA_H      ATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-C


CAE.EL_B      -TCCGTGCCAAGCGC-TGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG
ZEA.MA_H      ACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAA


CAE.EL_B      TGCATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCG
ZEA.MA_H      CACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC


CAE.EL_B      CGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-----TATACACAGCCT
ZEA.MA_H      ACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT------------


CAE.EL_B      TCTCAATACCTTCAGACCACTTGTTTTT
ZEA.MA_H      ----------------------------


[Download ClustalW]

#399

Mean pairwise ID: 31.10%


ARA.TH_A      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG--TGGGGACATTAAGATGGTGGGACA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_A      C-TG---GTTCGGT-TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_A      GTCCAAGCTGTGAGTAATTAG-TGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCT-
TRY.BR_A      TGCTTGGTTGCGTGTCGGTGTT-GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


ARA.TH_A      AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-C
TRY.BR_A      AA-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


ARA.TH_A      AGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG--
TRY.BR_A      CCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CC


ARA.TH_A      TCCGAT--CTCATATGAACCACCATTTT
TRY.BR_A      CAAG-TGT-CGTCGCG--AGGCGG----


[Download ClustalW]

#400

Mean pairwise ID: 31.10%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG--TGAGGGCATCAGTGTGGTGGAATG-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_C      -TTG--AACATGC-CCAGAA-GGTA-GGGCTTGT-GTGACAATTCTCTGGCC-TGCCCTG
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-CTGCGTT----GACGTGGTG-CTC-T


LYC.ES_C      TCCAAGCAAAGAGTTGGGTCT-TGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC-CT-
LEI.MAJ.      GCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


LYC.ES_C      AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT-GT
LEI.MAJ.      TGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCC


LYC.ES_C      GCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG--
LEI.MAJ.      GCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----CC


LYC.ES_C      GCTGTT-CTAG-TTAAACTACCACATTT
LEI.MAJ.      CACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#401

Mean pairwise ID: 31.14%


ORY.SA_B      GCC-GAGCCAGGTAGCGTTGGCTTGTCACCCGAG--CGGGGGCAATAAGGTGGTGTTGGA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT----


ORY.SA_B      TGC-CTGGTC-GTTTGCG-CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC-CGC
TRY.BR_B      AGCGGGG--ACGTCTTGGACAAGCGGGG---GTTCTG-T-TGCGTT---GACTTGGTG-T


ORY.SA_B      CCGTTCCAAGTTGCGTAGCGTGTGTG--GGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGC
TRY.BR_B      TC-TGCTTGGTTG-CGTGT--CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGC


ORY.SA_B      ACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCT
TRY.BR_B      CGT-TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCA


ORY.SA_B      TC-CAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-C-A
TRY.BR_B      CGTTCCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC-


ORY.SA_B      AGT--GCCTTC--CATG-GCAGACCACCACCTTT
TRY.BR_B      ---CCCAAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#402

Mean pairwise ID: 31.14%


ARA.TH_D      GTC-GAGCTAAGTAACGAGAGCTTGTGACCCGAG-----TGGGGACAATAAGGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ARA.TH_D      ACAG--TG--GTTCAAT---TCCTCG-GGTC--GGACCTGATGCTGACATATATCTGAGC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


ARA.TH_D      -TGCCCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGA
DRO.MEL.      CG-TCCGCACTAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


ARA.TH_D      TTCT-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTC
DRO.MEL.      TGGCTAAGG-AGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


ARA.TH_D      TTACAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


ARA.TH_D      GGT-TCGATC---TCTC-CTGGACCACCACTTT-
DRO.MEL.      ---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#403

Mean pairwise ID: 31.16%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_A      ATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGCT
CAE.EL_A      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG---TCGTTG-TCTACGTC----GACCGAG


ZEA.MA_A      -TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-
CAE.EL_A      CG-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGC-GGTTAGTCCCG


ZEA.MA_A      CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCG
CAE.EL_A      GGTG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACC


ZEA.MA_A      ACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-C
CAE.EL_A      GCGTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACG


ZEA.MA_A      AGAA-CC-TCA---CTAA-GCAAACCACCATCTTT--
CAE.EL_A      CAG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#404

Mean pairwise ID: 31.16%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_A      ATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGCT
CAE.EL_D      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG---TCGTCG-TCTACGTC----GACCGAG


ZEA.MA_A      -TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-
CAE.EL_D      CG-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGC-GGTTAGTCCCG


ZEA.MA_A      CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCG
CAE.EL_D      GGTG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACC


ZEA.MA_A      ACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-C
CAE.EL_D      GCGTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACA


ZEA.MA_A      AGAA-CC-TCA---CTAA-GCAAACCACCATCTTT--
CAE.EL_D      CAG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#405

Mean pairwise ID: 31.17%


TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG--TGGGGGCATTAAAGTGATGTGAACG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG


TRI.AE_A      C-TGTT--GTA-GCG-CTGCG-GGCCTGGTCTGGG-TGTGCTACTGCTGGCC-CGCCCGT
LEI.MAJ.      CGGGG-AGGACGTGGACCAGCGAGGGT-GATTTG-CTGCGTT---GACGTGGTG-CTC-T


TRI.AE_A      TCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CGGTC-CA
LEI.MAJ.      GCTTGGCTG-TGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCG


TRI.AE_A      TAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTC-C
LEI.MAJ.      TTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTC


TRI.AE_A      AACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAAT-TGGGCCTCGCAG--
LEI.MAJ.      CGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC---CC


TRI.AE_A      -CCTAC-TCCA-GCAGACCACC--
LEI.MAJ.      CACGCTT-CGTCGCG--AAGCCTT


[Download ClustalW]

#406

Mean pairwise ID: 31.19%


LYC.ES_O      GCC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAAGGTGGTGGAATA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_O      --TTG--GGCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_O      TCCAAGCACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_O      AAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_O      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCC


LYC.ES_O      CTGCT--CCAA-TTAAACCACCACTTT
TRY.BR_B      AAG-TGT-CGTCGCG--AGGCGGTTT-


[Download ClustalW]

#407

Mean pairwise ID: 31.21%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG--TGGGGGCATGTGGGAAATGGAAC-A
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


HUM.LU_B      -TTG--GGTCAGC-CCAGTG-GATC-GGGTCCAGTGTTAGCTGCTTACTGGTC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


HUM.LU_B      TTCCAAGCCGGGAGTTGGGCTG-AGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC-CT
LEI.MAJ.      TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCG


HUM.LU_B      -AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC-C
LEI.MAJ.      TTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTC


HUM.LU_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACC-ATGT-T-CACTGGT-
LEI.MAJ.      CGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC-------GCACTTGAGC-----C


HUM.LU_B      CCTGACT-CTTAA-TCGGACCATTTCCTTT
LEI.MAJ.      CCACGCTT--CGTCGCG--AAGCCTT----


[Download ClustalW]

#408

Mean pairwise ID: 31.21%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-GA
LYC.ES_M      ----------------------------CAAG-----TGGGGATGTTAAGGTGGTGGAAT


DRO.MEL.      TGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAACG-
LYC.ES_M      A--TTG--GGCTGTC---CCAGAT-GGCTG-GGCTTGGT--GGGCTAATTTCTGGCC-TG


DRO.MEL.      TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTG
LYC.ES_M      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC


DRO.MEL.      GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTGGT
LYC.ES_M      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT


DRO.MEL.      AGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG--C
LYC.ES_M      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-


DRO.MEL.      CCAACCGATATGGTTGG-ACCACAATCTTT
LYC.ES_M      GTTGCT---CCAA--TAAACAACCACCTTT


[Download ClustalW]

#409

Mean pairwise ID: 31.21%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_B      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_B      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_B      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_B      AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--C


LYC.ES_B      GCTGCT---CTAA-TTAAACCACCACTTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#410

Mean pairwise ID: 31.21%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG--TGGGGACATTAAGATGGTGGGACAC
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


ARA.TH_F      --TG--GTTCGGT-TCCTCG-GATC-GGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


ARA.TH_F      GTCCAAGCTGTGAGTAATTAG-TGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT-CT
LEI.MAJ.      TGCTTGGCTGTGTGTCGGTGTG-GCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCG


ARA.TH_F      -AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-
LEI.MAJ.      TTGAA-GCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGT


ARA.TH_F      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACT-ATGGCC-TGCTGG
LEI.MAJ.      CCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----


ARA.TH_F      T--CCGATC-TCAT-ATGAACCACCATTTT
LEI.MAJ.      -CCCACGCTT-CGTCGCG--AAGCCTT---


[Download ClustalW]

#411

Mean pairwise ID: 31.21%


ARA.TH_C      GTC-GAACTCAGTAACGCGGGCTTGTGATCCAAG--TGGAGACAATAAGGGGATGGGACG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_C      --TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGCCC
TRY.BR_B      CGGGGACGTCTTGGA--CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC


ARA.TH_C      ATTCCAAGTTGGGAGTTGAGGCA-TGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCT
TRY.BR_B      -TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-


ARA.TH_C      -AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT-T
TRY.BR_B      TAA-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


ARA.TH_C      GACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAAG
TRY.BR_B      CCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC-----


ARA.TH_C      ---CCGCT--CCGA-TTGGACCATCACTTT
TRY.BR_B      CCCAAG-TGT-CGTCGCG--AGGCGGTTT-


[Download ClustalW]

#412

Mean pairwise ID: 31.21%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_I      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_I      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_I      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_I      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--C


LYC.ES_I      GTTGCT---CCAA-TTAAACCACCATTTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#413

Mean pairwise ID: 31.23%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG-----TGGAGACAATAAGGGGATGGGA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_C      CG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


ARA.TH_C      CCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


ARA.TH_C      T-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTT
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


ARA.TH_C      GACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAAG
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAG---


ARA.TH_C      --CCGCT---CCGA-TTGGACCATCACTTT---
CAE.EL_A      CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#414

Mean pairwise ID: 31.23%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG--TGAGGGTATCAAAGTGGTTGAACT-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


CIN.HYB.      -TTGA--GCTTGGC--TTAGCT-AGTTG-GGTCTGTA-GACACCGCACCTGGCT-TGCCC
LEP.COL.      AGG--GAGCTGTCTGGACCAGCATAGG-GTGCTTG-CGGCGTT----GACGTGGTG-CTC


CIN.HYB.      GTTCCAAGTCGAGAGTGGGTTCA-----TGTTTCCTGAGCGAAGGCT-CGGGTGATGTGA
LEP.COL.      -TGCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCT


CIN.HYB.      GCTTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTAC
LEP.COL.      CCGT-TAA-A-GTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCG


CIN.HYB.      CTCT-CGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--
LEP.COL.      CACGTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC-------ACCTGCG


CIN.HYB.      CCTGG--CTAGC--CCAA-CAGGACACCCATTT
LEP.COL.      C----CCCAGGCGA-TCCTGTG--AAGCTTT--


[Download ClustalW]

#415

Mean pairwise ID: 31.23%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG-----TGGAGACAATAAGGGGATGGGA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_C      CG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


ARA.TH_C      CCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


ARA.TH_C      T-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTT
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


ARA.TH_C      GACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAAG
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAG---


ARA.TH_C      --CCGCT---CCGA-TTGGACCATCACTTT---
CAE.EL_D      CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#416

Mean pairwise ID: 31.29%


HUM.JA_A      GGCCTAGCAACGTGGGCCTGTAACCCAAGTGGGGGCATGTGGGAGATGGGACT--TTGGG
SCH.POM.      -CGC--------------TGTAA----TG----GC------TTGGTCG-AAGTGTTTAGT


HUM.JA_A      TCAGC---CCATTG-GATC---GGGTCCAGTGTTAGCTGCTTGCTGGTC-TGCCCATTCC
SCH.POM.      ACTCCCAA-TAGTGCAT-GTTCGGTGGTCTCGGGTTC-------GAGTCT--CGCTTTCG


HUM.JA_A      AAGCCG-AGAGTT-GGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC-CT-AA
SCH.POM.      -ATCCCTCGATC-TGCCACGTCTGTTCGAAGAGTAGTCTTCGTG-GCAACTGGCAGTTAA


HUM.JA_A      AGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT-CGGC
SCH.POM.      ACCGTGTAGTACCGATGGAGGTTGGAA--ACAATGCACATCA-CTACCGG-GTCTTGGGC


HUM.JA_A      A-GTGGAA-GGATAACG-GGTCGGTGCTAC-TTGGGCCA-CCATGG-T-CACTGCA--TG
SCH.POM.      AGTGCGATAGCGA--TGGGATTC----ACCT---TCGCAG--GAT-GTGCAT----GGAA


HUM.JA_A      CACTCTTAA-TCAGACCATCTCTTTT
SCH.POM.      GTAT---AAACACA-ACGGTCGTT--


[Download ClustalW]

#417

Mean pairwise ID: 31.29%


TRI.AE_B      NCCGAGCTAGTTGCGGGAGCTTGTCACCCATG--TGGGGGCATTGAGGCGGTGTGGATGC
LEI.MAJ.      GCCGGAGC---TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AGC


TRI.AE_B      -TTG--GTGCGGT-TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TGCCCGTT
LEI.MAJ.      GGGGAGGACGTGGACCAGCGAGGGT-GATTTG-C-TGCGTT---GACGTGGTG-CTC-TG


TRI.AE_B      CCAAGTTGGTAGTGGGCTG-GGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC--CT-TA
LEI.MAJ.      CTTGGCTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTG


TRI.AE_B      AGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC-CAAC
LEI.MAJ.      AAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCGC


TRI.AE_B      GGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTC-TGGGCCTCCTA--CCC
LEI.MAJ.      CGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC--CCCAC


TRI.AE_B      CGC-CAT-A-GCAGACCACCATCTTT
LEI.MAJ.      GCTT--CGTCGCG--AAGCCTT----


[Download ClustalW]

#418

Mean pairwise ID: 31.29%


LYC.ES_A      GGC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_A      --TTG--GGCTTTA-CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTG
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_A      TCCAAGCACAGAGTTGGATCT-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_A      AAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCT-GTGC
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCACCTT-GCGCACGTTCCC


LYC.ES_A      AGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG--GTT
TRY.BR_A      -GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCAA


LYC.ES_A      GCT--CCAA--TAAACAACCACCTTT
TRY.BR_A      G-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#419

Mean pairwise ID: 31.31%


ARA.TH_F      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG--TGGGGACATTAAGATGGTGGGACA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_F      C--TG--GTTCGGT-TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_F      GTCCAAGCTGTGAGTAATTAG-TGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTCT-
TRY.BR_A      TGCTTGGTTGCGTGTCGGTGTT-GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


ARA.TH_F      AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-C
TRY.BR_A      AA-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


ARA.TH_F      AGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT-
TRY.BR_A      CCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----C


ARA.TH_F      -CCGATC--TCAT-ATGAACCACCATTTT
TRY.BR_A      CCAAG-TGT-CGTCGCG--AGGCGG----


[Download ClustalW]

#420

Mean pairwise ID: 31.31%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG--TGGGGACATTTAGATGGTGGAACAC
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


ARA.TH_E      --TG--GTTCGGG-TCCACG-GGCC-GGTTCTGTTGTTGGCATGTTTCTGGGC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


ARA.TH_E      GTCCAAGCTGTGAGTAAGACG-TGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTT-CT-
LEI.MAJ.      TGCTTGGCTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


ARA.TH_E      AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA-C
LEI.MAJ.      TGAA-GCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTC


ARA.TH_E      AGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACT-ATGGCC-TGCTGGT
LEI.MAJ.      CGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC-----


ARA.TH_E      --CCGATC-TCAT-ATGAACCACCATTTT
LEI.MAJ.      CCCACGCTT-CGTCGCG--AAGCCTT---


[Download ClustalW]

#421

Mean pairwise ID: 31.34%


LYC.ES_F      GCC-GAGCTTTGTAACGTGGGCTTGTAACCCGAG-----TGGGGGCAACAATGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_F      ATG--TTG--GGTCCAT---CTTGAT-GGATG-GGCTTGAA--GGGCTAATGTTCTGGCC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT-----GACGGAA


LYC.ES_F      -TGCCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGG
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


LYC.ES_F      CCTTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


LYC.ES_F      TCTGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TG
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC--------CGTTAT-C


LYC.ES_F      ATAG-GTTGCC----TAA-TTAAACCATCACTTTT
DRO.MEL.      AG--CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#422

Mean pairwise ID: 31.38%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG-----CGGGGGCACTAAAGGTGGCTGC
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT----AGATGAGTGT-


ORY.SA_A      GGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT
CAE.EL_C      -GGATGGAGT--GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC--GACCGAG


ORY.SA_A      -TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCT
CAE.EL_C      CG-TCCGTGCCAAGCGC-TGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCG


ORY.SA_A      TCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACT
CAE.EL_C      GGTG-----CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC


ORY.SA_A      GCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGG
CAE.EL_C      CACCGCGCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TA


ORY.SA_A      CC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT-
CAE.EL_C      TACACAG--CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#423

Mean pairwise ID: 31.40%


LYC.ES_J      GTC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-TGGAGACATCAAAGTGGTTGAATA-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_J      -TTG--GGCTTTA--CCAGAA-GGTTG---GGCTTGGT--GGGCTTAGTTCTGGCC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_J      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_J      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_J      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCCTAATGG---
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------ACTAATCG-GTTCTA


LYC.ES_J      GTTGCT-CCAA--TAAACAACCACCTTT
TET.THE.      -CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#424

Mean pairwise ID: 31.40%


LYC.ES_H      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-TGGAGACATCAAAGTGGTTGAAT-A
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_H      -TTG--GGCTGTA--CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_H      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_H      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTG
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_H      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCCTAATGG---
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------ACTAATCG-GTTCTA


LYC.ES_H      GTTGCT-CCAA-TAAACAACCACCTTTT
TET.THE.      -CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#425

Mean pairwise ID: 31.40%


LYC.ES_G      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_G      --TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_G      TCCAAGCACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_G      AAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_G      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----CCC


LYC.ES_G      CTGCT--CCAA-TTAAACCACCACTTTT
TRY.BR_B      AAG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#426

Mean pairwise ID: 31.40%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG-----CGGGGGCAATAAGGTAGTGTGG


CAE.EL_C      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTGTCAACGTC----GACCGAGCG
ZEA.MA_H      ATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-C


CAE.EL_C      -TCCGTGCCAAGCGC-TGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG
ZEA.MA_H      ACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAA


CAE.EL_C      TGCATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCG
ZEA.MA_H      CACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC


CAE.EL_C      CGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-----TATACACAGCCT
ZEA.MA_H      ACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT------------


CAE.EL_C      TCTCAATACCTTCAGACCACTTGTCACT
ZEA.MA_H      ----------------------------


[Download ClustalW]

#427

Mean pairwise ID: 31.42%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG-
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT---TCGGGGGCT--TTCACCAGCTG--AAC


LYC.ES_B      -TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
LEP.COL.      AGG-GAGCTGTCTGGACCAGCATAGGGTGCTTG-CGGCGTT----GACGTGGTG-CTC-T


LYC.ES_B      TCCAAGCTTAGAGTTGGATCA-----TGTGGCCCAATTGAAGAAA-TGGACTACTTGATT
LEP.COL.      GCTTGGCTGTGTGT-CGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCC


LYC.ES_B      CGT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTC
LEP.COL.      GT-TAA-AGTAGAGGAACTGGGTCAGGCCGGCA--ACGGAGCAGCCCA-CCTC-GCGCAC


LYC.ES_B      T-AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATG
LEP.COL.      GTCTGCCGTTGCAGAACC-ACACCGCG--GA-GCCTG-TCATC------ACCTGCGC---


LYC.ES_B      G-GCTGCT--CTAA-TTAAACCACCACTTTT
LEP.COL.      -CCCAGGCGA-TCCTGTG--AAGCTTT----


[Download ClustalW]

#428

Mean pairwise ID: 31.42%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_B      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_B      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_B      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTA
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_B      AGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-G
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CC


LYC.ES_B      CTGCT---CTAA-TTAAACCACCACTTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#429

Mean pairwise ID: 31.50%


LYC.ES_B      GTC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_B      --TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_B      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-A
TRY.BR_A      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_B      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT-AAG
TRY.BR_A      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_B      CGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG--GC
TRY.BR_A      C-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_B      TGCT--CTAA-TTAAACCACCACTTTT
TRY.BR_A      AG-TGT-CGTCGCG--AGGCGG-----


[Download ClustalW]

#430

Mean pairwise ID: 31.52%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG--TGGGGACTATAAGATGGTGGAACAC
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


ARA.TH_G      --TG--GATCGGC-CCA-CG-GGTC-GGATTTGTTGTTGGCATAGGTCTGGAC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


ARA.TH_G      ATCCAAGCTGTGAGTGAACCG-TATGAACCAAGCGAAGGTTTGATCCGTACGGTTG-CT-
LEI.MAJ.      TGCTTGGCTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


ARA.TH_G      AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT-C
LEI.MAJ.      TGAA-GCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTC


ARA.TH_G      AGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACT-ATGGTC-CGCTGGC
LEI.MAJ.      CGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC-----


ARA.TH_G      --TCGTAA-CCCGC-TTGAACCACCATTTT
LEI.MAJ.      CCCACGCTT--CGTCGCG--AAGCCTT---


[Download ClustalW]

#431

Mean pairwise ID: 31.53%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_C      ATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TG
CAE.EL_B      GATGGAGTGAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC---GACCGAGCG-


ZEA.MA_C      CCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGG
CAE.EL_B      TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGAT-GGTCAGTCCCGGGT


ZEA.MA_C      ACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCT
CAE.EL_B      G-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCG


ZEA.MA_C      ATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAGA
CAE.EL_B      CGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG


ZEA.MA_C      CTTC-ATA---CTAAAGCAGACCACCATTTTT-
CAE.EL_B      -CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#432

Mean pairwise ID: 31.55%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_A      ATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGCT
CAE.EL_B      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG---TCGTTG-TCAACGTC----GACCGAG


ZEA.MA_A      -TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-
CAE.EL_B      CG-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGAT-GGTCAGTCCCG


ZEA.MA_A      CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCG
CAE.EL_B      GGTG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACC


ZEA.MA_A      ACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-C
CAE.EL_B      GCGCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACA


ZEA.MA_A      AGAA-CC-TCA---CTAA-GCAAACCACCATCTTT-
CAE.EL_B      CAG-CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#433

Mean pairwise ID: 31.60%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAATGTGGTGGAATG-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_N      -TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTAT
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TG


LYC.ES_N      CCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTC-GT-A
LEI.MAJ.      CTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTT


LYC.ES_N      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT-AAG
LEI.MAJ.      GAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCG


LYC.ES_N      CGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG--GT
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC-------GCACTTGAGC----CCCA


LYC.ES_N      TGCT-CCAA-TTAAACCACCATTTTT
LEI.MAJ.      CGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#434

Mean pairwise ID: 31.60%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG-----CGGGGGCAATAAGGTAGTGTGG


FUG.RUB.      GATCGCTT-GAGCTCAGGAGTTCTGGGCTT---CAGCGGACTATGTC----GATCGGGTG
ZEA.MA_H      ATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-C


FUG.RUB.      -TCCGTACTAAGTTC-GGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGT
ZEA.MA_H      ACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAA


FUG.RUB.      CGCCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTG
ZEA.MA_H      CACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC


FUG.RUB.      CCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-----GTAGTTCAACCT
ZEA.MA_H      ACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT------------


FUG.RUB.      GAGTAACACAGCGGGACTCAGTCTTT
ZEA.MA_H      --------------------------


[Download ClustalW]

#435

Mean pairwise ID: 31.61%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG--TGGGGACATTAAGATGGTGGGACAC
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


ARA.TH_A      -TG---GTTCGGT-TCCTCG-GATC-GGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC-


ARA.TH_A      GTCCAAGCTGTGAGTAATTAG-TGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT-CT
LEI.MAJ.      TGCTTGGCTGTGTGTCGGTGTG-GCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCG


ARA.TH_A      -AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-
LEI.MAJ.      TTGAA-GCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGT


ARA.TH_A      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACT-ATGGCC-TGCTGG
LEI.MAJ.      CCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----


ARA.TH_A      --TCCGAT-CTCATATGAACCACCATTTT
LEI.MAJ.      CCCACGCTT-CGTCGCG--AAGCCTT---


[Download ClustalW]

#436

Mean pairwise ID: 31.61%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG-----CGGGGGCAATAAGGTAGTGTGG


CAE.EL_A      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTGTCTACGTC----GACCGAGCG
ZEA.MA_H      ATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-C


CAE.EL_A      -TCCGTGCCAAGCGC-TACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG
ZEA.MA_H      ACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAA


CAE.EL_A      TGCATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCG
ZEA.MA_H      CACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC


CAE.EL_A      TGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-----CATACGCAGCCT
ZEA.MA_H      ACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT------------


CAE.EL_A      TCTCGATACCTTCAGACCACTTATCATTT
ZEA.MA_H      -----------------------------


[Download ClustalW]

#437

Mean pairwise ID: 31.61%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG-----CGGGGGCAATAAGGTAGTGTGG


CAE.EL_D      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTCGTCTACGTC----GACCGAGCG
ZEA.MA_H      ATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-C


CAE.EL_D      -TCCGTGCCAAGCGC-TACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG
ZEA.MA_H      ACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAA


CAE.EL_D      TGCATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCG
ZEA.MA_H      CACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC


CAE.EL_D      TGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-----CATACACAGCCT
ZEA.MA_H      ACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT------------


CAE.EL_D      TCTCGATACCTTCAGACCACTTATCATTT
ZEA.MA_H      -----------------------------


[Download ClustalW]

#438

Mean pairwise ID: 31.61%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATGG
LYC.ES_L      ----------------------------------------------------------G-


CAE.BRI.      AGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC-----GACCGAGCG-TCCG
LYC.ES_L      TTG--GGTTGAC--CCAGAT-GGTTGGGTTCGGT--AGGCTTATAGTCTGGCC-TGCCCT


CAE.BRI.      TGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGC-TGGCGGTCCCGGGCGCAT
LYC.ES_L      CTCCAAGCATGGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCT-


CAE.BRI.      AAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGGTG
LYC.ES_L      AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTG


CAE.BRI.      CAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCACAG--CCT
LYC.ES_L      CAGTGGAAGGATAACG-GGTCAGTG-CTC--AGCGAGTCCAGTTAACGCCCTGATGG-GC


CAE.BRI.      CTCTGATACCTTCAG-ACCACTTGTCATT
LYC.ES_L      TGCT---CCAA-CTAAACCACCACTTT--


[Download ClustalW]

#439

Mean pairwise ID: 31.63%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG--CGGGGGCATTAAGGTGGTGTGGATG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG


ZEA.MA_F      T-TTCC--TGACGGA-TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-TGCCC
LEI.MAJ.      CGGGG-AGGACGTGGACCAGCGAGGGT-GATTTG-C-TGCGTT----GACGTGGTG-CTC


ZEA.MA_F      GTTCCAAGTTGGTTGTGGCTGGT-GGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTAGAC-
LEI.MAJ.      -TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCG-C


ZEA.MA_F      CT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCTT
LEI.MAJ.      CGTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCC-C-ACGCAC


ZEA.MA_F      C-CAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACT-CGGTC--CAG
LEI.MAJ.      GTCCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC-


ZEA.MA_F      AG--CC-TCA-TTAA-ACAGACCACCATCTTT
LEI.MAJ.      --CCCACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#440

Mean pairwise ID: 31.63%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG--CGGGGGCATTAAGGTGGTGTGAATG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT---AG


ZEA.MA_A      C-TTTG--CGATGGCTTTCTG-GGCCCTGGGCTCGT-TGTGACACTGGCCGGCT-TGCCC
LEI.MAJ.      CGGGG-AGGACGTGGACCAGCGAGGGT--GATTTG-CTGCGTT----GACGTGGTG-CTC


ZEA.MA_A      ATCCCAAGTTGGTAGTGTCTGGT-GGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-CAGAC
LEI.MAJ.      -TGCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGG-GTGGCGCGGGT-CCG-


ZEA.MA_A      -CT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACTC
LEI.MAJ.      CCGTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCAC


ZEA.MA_A      C-CAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACT-CAGGCT-CAG
LEI.MAJ.      GTCCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC-


ZEA.MA_A      AA--CC-TCA-CTAA-GCAAACCACCATCTTT
LEI.MAJ.      --CCCACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#441

Mean pairwise ID: 31.63%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG------TGAGGGTATCAAAGTGGTTGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


CIN.HYB.      ACT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-T
GAL.GAL.      GATCGCTT-GAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG


CIN.HYB.      GCCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGC
GAL.GAL.      -TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTT


CIN.HYB.      TTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCT
GAL.GAL.      GCCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTG


CIN.HYB.      CTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCT
GAL.GAL.      CCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTAG


CIN.HYB.      GG--CTAGC---CCAA-CAGGACACCCATTT-
GAL.GAL.      --CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#442

Mean pairwise ID: 31.63%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_C      CT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


HUM.LU_C      CCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.LU_C      T-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.LU_C      GGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG---C


HUM.LU_C      CTGACT--CTTAA-TAGGACCATTTCTTTT--
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#443

Mean pairwise ID: 31.64%


ARA.TH_F      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ARA.TH_F      ACAC--TG--GTTCGGT---TCCTCG-GATC--GGTTCTGATGTGGGCATGTTTCTGAGC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


ARA.TH_F      -TGCCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--G
DRO.MEL.      CG-TCCGCACTAAGCTTGCCATCAATAT-GGGTGCCATGGAGGAGTCCGTGGCATTCAGG


ARA.TH_F      GTTCT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCG
DRO.MEL.      TTGGCTAAGG-AGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCG


ARA.TH_F      CTTACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGC
DRO.MEL.      TGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CA


ARA.TH_F      TGGT-CCGATC---TCAT-ATGAACCACCATTTT-
DRO.MEL.      G---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#444

Mean pairwise ID: 31.64%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGCGCG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


ZEA.MA_B      GATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT
GAL.GAL.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GAGCGGG


ZEA.MA_B      -TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-
GAL.GAL.      CG-TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCG-AGGCACACCAG


ZEA.MA_B      CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
GAL.GAL.      GTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCC


ZEA.MA_B      CACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-
GAL.GAL.      CGTGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGC


ZEA.MA_B      CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
GAL.GAL.      GTAGCCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#445

Mean pairwise ID: 31.64%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G


ZEA.MA_E      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_C      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_E      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_C      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG


ZEA.MA_E      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGG
CAE.EL_C      TG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-CACCG


ZEA.MA_E      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.EL_C      CGCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACAC


ZEA.MA_E      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT-
CAE.EL_C      AG-CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#446

Mean pairwise ID: 31.64%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G


ZEA.MA_F      ATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-
CAE.EL_C      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_F      TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTA
CAE.EL_C      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG


ZEA.MA_F      GACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.EL_C      TG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-CACCG


ZEA.MA_F      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--CA
CAE.EL_C      CGCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACAC


ZEA.MA_F      GAG-CC-TCA---TTAA-ACAGACCACCATCTTT-
CAE.EL_C      AG-CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#447

Mean pairwise ID: 31.64%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGCGCGG
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G


ZEA.MA_B      ATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT-
CAE.EL_C      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_B      TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-C
CAE.EL_C      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGAT-GGTCAGTCCCGG


ZEA.MA_B      AGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
CAE.EL_C      GTG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-CACC


ZEA.MA_B      ACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-C
CAE.EL_C      GCGCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACA


ZEA.MA_B      AGATCC-TCT---CTTA-GCAAACCACCATCTTT-
CAE.EL_C      CAGCCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#448

Mean pairwise ID: 31.72%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_I      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_I      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_I      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_I      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CC


LYC.ES_I      TTGCT---CCAA-TTAAACCACCATTTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#449

Mean pairwise ID: 31.72%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAATGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_N      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_N      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_N      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_N      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CC


LYC.ES_N      TTGCT---CCAA-TTAAACCACCATTTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#450

Mean pairwise ID: 31.74%


ARA.TH_A      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ARA.TH_A      ACAC-TG---GTTCGGT---TCCTCG-GATC--GGTTCTGATGTGGGCATGTTTCTGAGC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


ARA.TH_A      -TGCCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAG
DRO.MEL.      CG-TCCGCACTAAGCTTGCCATCAATAT-GGGTGCCATGGAGGAGTCCGTGGCATTCAGG


ARA.TH_A      GTTCT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCG
DRO.MEL.      TTGGCTAAGG-AGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCG


ARA.TH_A      CTTACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGC
DRO.MEL.      TGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CA


ARA.TH_A      TGG-TCCGAT---CTCATATGAACCACCATTTT-
DRO.MEL.      G--CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#451

Mean pairwise ID: 31.80%


LYC.ES_H      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAAT-
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_H      A-TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_H      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_H      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_H      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_H      TGCT--CCAA-TAAACAACCACCTTTT
TRY.BR_B      AG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#452

Mean pairwise ID: 31.80%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_G      -TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTAT
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TG


LYC.ES_G      CCAAGCACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-CT-A
LEI.MAJ.      CTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTT


LYC.ES_G      AAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
LEI.MAJ.      GAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCG


LYC.ES_G      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----CCC


LYC.ES_G      CTGCT-CCAA-TTAAACCACCACTTTT
LEI.MAJ.      ACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#453

Mean pairwise ID: 31.80%


LYC.ES_A      GGC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-TGGAGACATCAAAGTGGTTGAATA-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_A      -TTG--GGCTTTA--CCAGAA-GGTT---GGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_A      CCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_A      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCTG
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_A      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT-ATCAAGTTCAGTAACGCCTAATGG---G
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-


LYC.ES_A      TTGCT-CCAA--TAAACAACCACCTTT
TET.THE.      CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#454

Mean pairwise ID: 31.83%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG-----TGAGGGTATCAAAGTGGTTGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


CIN.HYB.      CT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-TG
CAE.EL_C      ATGGAGT-GAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-


CIN.HYB.      CCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT
CAE.EL_C      TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTG


CIN.HYB.      TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTC
CAE.EL_C      CATAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGC


CIN.HYB.      TCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTG
CAE.EL_C      GGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG-


CIN.HYB.      G--CTAGC---CCAA-CAGGACACCCATTT---
CAE.EL_C      -CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#455

Mean pairwise ID: 31.90%


LYC.ES_A      GGC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_A      --TTG--GGCTTTA-CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTG
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_A      TCCAAGCACAGAGTTGGATCT-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_A      AAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCT-GTGC
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCACCTT-GCGCACGTTCCC


LYC.ES_A      AGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG--GTT
TRY.BR_B      -GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCAA


LYC.ES_A      GCT--CCAA--TAAACAACCACCTTT
TRY.BR_B      G-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#456

Mean pairwise ID: 31.90%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAAGGTGGTGGAATA-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_O      -TTG--GGCTGTC-CCAGAT-GGCTGGGCTTGGT-GGGCTAATTTCTGGCC-TGCCCTAT
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TG


LYC.ES_O      CCAAGCACAGAGTTGGATCA-TGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-CT-A
LEI.MAJ.      CTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTT


LYC.ES_O      AAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT-GTG
LEI.MAJ.      GAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCG


LYC.ES_O      CAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG--G
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----CCC


LYC.ES_O      CTGCT-CCAA-TTAAACCACCACTTT
LEI.MAJ.      ACGCTT-CGTCGCG--AAGCCTT---


[Download ClustalW]

#457

Mean pairwise ID: 31.90%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAAT-A
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_H      -TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTAT
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TG


LYC.ES_H      CCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTC-GT-A
LEI.MAJ.      CTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTT


LYC.ES_H      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
LEI.MAJ.      GAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCG


LYC.ES_H      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC-------GCACTTGAGC----CCCA


LYC.ES_H      TGCT-CCAA-TAAACAACCACCTTTT
LEI.MAJ.      CGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#458

Mean pairwise ID: 31.90%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_I      -TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTAT
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TG


LYC.ES_I      CCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTC-GT-A
LEI.MAJ.      CTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTT


LYC.ES_I      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT-AAG
LEI.MAJ.      GAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCG


LYC.ES_I      CGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG--GT
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC-------GCACTTGAGC----CCCA


LYC.ES_I      TGCT-CCAA-TTAAACCACCATTTTT
LEI.MAJ.      CGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#459

Mean pairwise ID: 31.93%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG------TGAGGGTATCAAAGTGGTTGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


CIN.HYB.      ACT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-T
RAT.NOR.      GATCGATT-GAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG


CIN.HYB.      GCCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGC
RAT.NOR.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


CIN.HYB.      TTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCT
RAT.NOR.      GCCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTG


CIN.HYB.      CTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCT
RAT.NOR.      CTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG


CIN.HYB.      GG--CTAGC---CCAA-CAGGACACCCATTT-
RAT.NOR.      --CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#460

Mean pairwise ID: 31.93%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG------TGAGGGTATCAAAGTGGTTGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


CIN.HYB.      ACT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-T
ORI.CUN.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG


CIN.HYB.      GCCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGC
ORI.CUN.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


CIN.HYB.      TTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCT
ORI.CUN.      GCCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTG


CIN.HYB.      CTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCT
ORI.CUN.      CTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG


CIN.HYB.      GG--CTAGC---CCAA-CAGGACACCCATTT-
ORI.CUN.      --CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#461

Mean pairwise ID: 31.93%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_C      CT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


HUM.LU_C      CCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.LU_C      T-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.LU_C      GGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG---C


HUM.LU_C      CTGACT--CTTAA-TAGGACCATTTCTTTT--
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#462

Mean pairwise ID: 31.94%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G


ZEA.MA_D      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_C      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_D      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_C      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG


ZEA.MA_D      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.EL_C      TG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-CACCG


ZEA.MA_D      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.EL_C      CGCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACAC


ZEA.MA_D      GAG-CC-TCA---CTAA-GCAGACCACCATCTT--
CAE.EL_C      AG-CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#463

Mean pairwise ID: 31.94%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG------CGGGGGCATTAAGGTGGTGTG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


ZEA.MA_F      GATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC
GAL.GAL.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GAGCGGG


ZEA.MA_F      -TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TT
GAL.GAL.      CG-TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGG


ZEA.MA_F      AGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
GAL.GAL.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_F      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--C
GAL.GAL.      GTGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCG


ZEA.MA_F      AGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
GAL.GAL.      TAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#464

Mean pairwise ID: 31.96%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG-----CGGGGGCACTAAAGGTGGCTGC
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT----AGATAAGTGT-


ORY.SA_A      GGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT
CAE.EL_B      -GGATGGAGT--GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC--GACCGAG


ORY.SA_A      -TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCT
CAE.EL_B      CG-TCCGTGCCAAGCGC-TGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCG


ORY.SA_A      TCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACT
CAE.EL_B      GGTG-----CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC


ORY.SA_A      GCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGG
CAE.EL_B      CACCGCGCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TA


ORY.SA_A      CC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT-
CAE.EL_B      TACACAG--CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#465

Mean pairwise ID: 32.01%


CIN.HYB.      ACC-GGGCTTGGTAACGCTAGTCTATAACTCAAG--TGAGGGTATCAAAGTGGTTGAACT
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


CIN.HYB.      --TTGA--GCTTGGC-TTAGCT-AGTTGGGTCTGTA-GACACCGCACCTGGCT-TGCCCG
TRY.BR_A      CGGGG-ACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-


CIN.HYB.      TTCCAAGTCGAGAGTGGGTTCA-TGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTT-
TRY.BR_A      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


CIN.HYB.      AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCT-C
TRY.BR_A      AA-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


CIN.HYB.      GACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTGG-
TRY.BR_A      CCC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----C


CIN.HYB.      --CTAGC--CCAA-CAGGACACCCATTT
TRY.BR_A      CCAAG-TGT-CGTCGCG--AGGCGG---


[Download ClustalW]

#466

Mean pairwise ID: 32.01%


LYC.ES_N      GTT-GAGCTTAGTAACGTGGGCTTGTAACCCAAG-TGGGGATGTTAATGTGGTGGAATG-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_N      -TTG--GGCTGTA--CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_N      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_N      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_N      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCCTGATGG---
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------ACTAATCG-GTTCTA


LYC.ES_N      GTTGCT-CCAA-TTAAACCACCATTTTT
TET.THE.      -CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#467

Mean pairwise ID: 32.04%


ARA.TH_E      GTC-GAGCTAAGTAACATGAGCTTGTAACCCATG-----TGGGGACATTTAGATGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ARA.TH_E      ACAC--TG--GTTCGGG---TCCACG-GGCC--GGTTCTGTTGTTGGCATGTTTCTGGGC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


ARA.TH_E      -TGCCCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGC
DRO.MEL.      CG-TCCGCACTAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


ARA.TH_E      TTCT-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGC
DRO.MEL.      TGGCTAAGG-AGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


ARA.TH_E      TTACAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


ARA.TH_E      GGT-CCGATC---TCAT-ATGAACCACCATTTT-
DRO.MEL.      ---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#468

Mean pairwise ID: 32.04%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_C      ATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TG
CAE.EL_D      GATGGAGTGAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC---GACCGAGCG-


ZEA.MA_C      CCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGG
CAE.EL_D      TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGC-GGTTAGTCCCGGGT


ZEA.MA_C      ACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCT
CAE.EL_D      G-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCG


ZEA.MA_C      ATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAGA
CAE.EL_D      TGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAG


ZEA.MA_C      CTTC-ATA---CTAAAGCAGACCACCATTTTT--
CAE.EL_D      -CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#469

Mean pairwise ID: 32.04%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G


ZEA.MA_G      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_C      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_G      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_C      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG


ZEA.MA_G      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGC
CAE.EL_C      TG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGC


ZEA.MA_G      TTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAG
CAE.EL_C      GCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACA


ZEA.MA_G      AG-CC-TCA---CTAA-GCAGACCACCATCTTT-
CAE.EL_C      G-CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#470

Mean pairwise ID: 32.04%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-----TGGGGGCAACAATGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_F      TG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-TG
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC-----GACCGAGCG-


LYC.ES_F      CCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCT
CAE.EL_D      TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG


LYC.ES_F      TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT
CAE.EL_D      CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTG


LYC.ES_F      GTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATA
CAE.EL_D      GTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA---------CATACACAG-


LYC.ES_F      G-GTTGCC----TAA-TTAAACCATCACTTTT--
CAE.EL_D      -CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#471

Mean pairwise ID: 32.04%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_C      ATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TG
CAE.EL_A      GATGGAGTGAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC---GACCGAGCG-


ZEA.MA_C      CCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGG
CAE.EL_A      TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGC-GGTTAGTCCCGGGT


ZEA.MA_C      ACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCT
CAE.EL_A      G-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCG


ZEA.MA_C      ATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAGA
CAE.EL_A      TGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAG


ZEA.MA_C      CTTC-ATA---CTAAAGCAGACCACCATTTTT--
CAE.EL_A      -CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#472

Mean pairwise ID: 32.11%


LYC.ES_N      GTT-GAGCTTAGTAACGTGGGCTTGTAACCCAAG--TGGGGATGTTAATGTGGTGGAATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_N      --TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_N      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_N      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT-AAG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_N      CGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG--GT
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_N      TGCT--CCAA-TTAAACCACCATTTTT
TRY.BR_B      AG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#473

Mean pairwise ID: 32.11%


LYC.ES_H      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-TGGAGACATCAAAGTGGTTGAAT-A
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_H      -TTG-GGCTGTA--CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_H      CTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_H      -AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGT
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_H      GCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCCTAATGG---G
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------GCTAATCG-GTTCTG-


LYC.ES_H      TTGCT-CCAA-TAAACAACCACCTTTT
TET.ROS.      CTATTC--TGATCA-GACACT------


[Download ClustalW]

#474

Mean pairwise ID: 32.11%


LYC.ES_I      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_I      --TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_I      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_I      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT-AAG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_I      CGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG--GT
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_I      TGCT--CCAA-TTAAACCACCATTTTT
TRY.BR_B      AG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#475

Mean pairwise ID: 32.13%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG------TGAGGGTATCAAAGTGGTTGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


CIN.HYB.      ACT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-T
HOM.SA_A      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG


CIN.HYB.      GCCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGC
HOM.SA_A      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


CIN.HYB.      TTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCT
HOM.SA_A      GCCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTG


CIN.HYB.      CTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCT
HOM.SA_A      CTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG


CIN.HYB.      GG--CTAGC---CCAA-CAGGACACCCATTT--
HOM.SA_A      --CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#476

Mean pairwise ID: 32.13%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG------TGAGGGTATCAAAGTGGTTGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


CIN.HYB.      ACT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-T
RAT.RAT.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG


CIN.HYB.      GCCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGC
RAT.RAT.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


CIN.HYB.      TTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCT
RAT.RAT.      GCCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTG


CIN.HYB.      CTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCT
RAT.RAT.      CTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG


CIN.HYB.      GG--CTAGC---CCAA-CAGGACACCCATTT--
RAT.RAT.      --CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#477

Mean pairwise ID: 32.14%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


ZEA.MA_A      AATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGC
RAT.NOR.      GGATCGATT-GAGTCCAGGAGTTCTGGGCTG----TAGTGC-GCTATGCC----GATCGG


ZEA.MA_A      T-TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG
RAT.NOR.      GTG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCA


ZEA.MA_A      -CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCC
RAT.NOR.      GGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ZEA.MA_A      GACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-
RAT.NOR.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_A      CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
RAT.NOR.      CCAG-CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#478

Mean pairwise ID: 32.14%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


ZEA.MA_A      AATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGC
ORI.CUN.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG----TCGTGC-GCTATGCC----GATCGG


ZEA.MA_A      T-TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG
ORI.CUN.      GTG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCA


ZEA.MA_A      -CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCC
ORI.CUN.      GGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ZEA.MA_A      GACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-
ORI.CUN.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_A      CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
ORI.CUN.      CCAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#479

Mean pairwise ID: 32.16%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG-----CGGGGGCACTAAAGGTGGCTGC
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT----AGATAAGTGT-


ORY.SA_A      GGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT
CAE.EL_D      -GGATGGAGT--GAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC--GACCGAG


ORY.SA_A      -TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCT
CAE.EL_D      CG-TCCGTGCCAAGCGC-TACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCG


ORY.SA_A      TCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACT
CAE.EL_D      GGTG-----CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC


ORY.SA_A      GCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGG
CAE.EL_D      GACCGCGTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CA


ORY.SA_A      CC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT--
CAE.EL_D      TACACAG--CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#480

Mean pairwise ID: 32.21%


TET.THE.      GCCAGGGTAGCA-ATACCTGTGTCTA-TATGTGGCATAAACAATGTAGGTT--GTGATAG
TRY.BR_A      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCT-GATCCCGCTTAGCGGGGACGTCTT


TET.THE.      ATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGA
TRY.BR_A      GGA--CAAGCGGGG-----GTTCTG-T-TGCGTTGACTTGGTGTTC-TGCTTGGTTGCGT


TET.THE.      GTTGCTAT-GGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAGGAAA
TRY.BR_A      GTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGGGGGGAA


TET.THE.      CGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTG-TTGTGGTGGAAGGATAAC
TRY.BR_A      CGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAGAAGCAC


TET.THE.      ATACTCA-TTAACTGTCAA--ACTAAT-CGGTTCTA-CTATCA--AAGCCAGACATT-
TRY.BR_A      ACCGAGGA-GCATCTCAGGAC--TTTGCGC----CCCAAG-TGTCGTCGCG-AGGCGG


[Download ClustalW]

#481

Mean pairwise ID: 32.21%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_K      -TTG--GGCTTTA-CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTGT
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TG


LYC.ES_K      CCAAGCACAGAGTAGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-A
LEI.MAJ.      CTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTT


LYC.ES_K      AAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
LEI.MAJ.      GAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCG


LYC.ES_K      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC-------GCACTTGAGC----CCCA


LYC.ES_K      TGCT-CCAA--TAAACAACCACCTTT
LEI.MAJ.      CGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#482

Mean pairwise ID: 32.22%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAATGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_N      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_N      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_N      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_N      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CC


LYC.ES_N      TTGCT---CCAA-TTAAACCACCATTTTT
FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#483

Mean pairwise ID: 32.22%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_B      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_B      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_B      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTA
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_B      AGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-G
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CC


LYC.ES_B      CTGCT---CTAA-TTAAACCACCACTTTT
FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#484

Mean pairwise ID: 32.23%


TET.THE.      GCCAGGGTAGCA-ATACCTGTGTCTA-TATGTGGCATAAACAATGTAGGTT--GTGATAG
TRY.BR_B      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCT-GATCCCGCTTAGCGGGGACGTCTT


TET.THE.      ATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGA
TRY.BR_B      GGA--CAAGCGGGG-----GTTCTG-T-TGCGTTGACTTGGTGTTC-TGCTTGGTTGCGT


TET.THE.      GTTGCTAT-GGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAGCTAAGGAAA
TRY.BR_B      GTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGGGGGGAA


TET.THE.      CGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTG-TTGTGGTGGAAGGATAAC
TRY.BR_B      CGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAGAAGCAC


TET.THE.      ATACTCA-TTAACTGTCAA--ACTAAT-CGGTTCTA-CTATCA--AAGCCAGACATT---
TRY.BR_B      ACCGAGGA-GCATCTCAGGAC--TTTGCGC----CCCAAG-TGTCGTCGCG-AGGCGGTT


TET.THE.      -
TRY.BR_B      T


[Download ClustalW]

#485

Mean pairwise ID: 32.24%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGCGCGG
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_B      ATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT-
CAE.EL_B      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_B      TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-C
CAE.EL_B      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGAT-GGTCAGTCCCGG


ZEA.MA_B      AGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
CAE.EL_B      GTG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-CACC


ZEA.MA_B      ACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-C
CAE.EL_B      GCGCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACA


ZEA.MA_B      AGATCC-TCT---CTTA-GCAAACCACCATCTTT-
CAE.EL_B      CAGCCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#486

Mean pairwise ID: 32.24%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_F      ATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-
CAE.EL_B      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_F      TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTA
CAE.EL_B      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG


ZEA.MA_F      GACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.EL_B      TG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-CACCG


ZEA.MA_F      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--CA
CAE.EL_B      CGCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACAC


ZEA.MA_F      GAG-CC-TCA---TTAA-ACAGACCACCATCTTT-
CAE.EL_B      AG-CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#487

Mean pairwise ID: 32.24%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_E      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_B      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_E      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_B      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG


ZEA.MA_E      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGG
CAE.EL_B      TG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-CACCG


ZEA.MA_E      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.EL_B      CGCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACAC


ZEA.MA_E      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT-
CAE.EL_B      AG-CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#488

Mean pairwise ID: 32.24%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


ZEA.MA_E      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
GAL.GAL.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GAGCGGG


ZEA.MA_E      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
GAL.GAL.      CG-TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGG


ZEA.MA_E      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCG
GAL.GAL.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_E      GCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
GAL.GAL.      GTGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCG


ZEA.MA_E      AGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
GAL.GAL.      TAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#489

Mean pairwise ID: 32.24%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_D      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_B      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_D      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_B      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG


ZEA.MA_D      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.EL_B      TG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-CACCG


ZEA.MA_D      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.EL_B      CGCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACAC


ZEA.MA_D      GAG-CC-TCA---CTAA-GCAGACCACCATCTT--
CAE.EL_B      AG-CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#490

Mean pairwise ID: 32.25%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG--CGGGGGCACTAAAGGTGGCTGCGGA
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT----AACCAGGCTT----


ORY.SA_A      TGT-TTGGTGTGGATTCTGATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT-TGC
LEI.MAJ.      AGCGGGG--AGGACGTGGA-CCAGCGAGGGT-GATTTG-C-TGCGTT--GACGTGGTG-C


ORY.SA_A      CCGTTCCAAGTTGCGTAGTGGGCCGG-AGGGGCTTTGGCGAAGGCCTTTGCTTTGCTTCT
LEI.MAJ.      TC-TGCTTGGCTG-TGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CC


ORY.SA_A      CCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCC
LEI.MAJ.      G----CCGTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-A


ORY.SA_A      CGCTTC-CATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTT-CTGGC
LEI.MAJ.      CGCACGTCCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTT


ORY.SA_A      C-CAGAGT--CCCTCT-ACAA--CAGACCACCATCTTT
LEI.MAJ.      GAGC----CCCACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#491

Mean pairwise ID: 32.31%


XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG-----CGGGGGCAATAAGGTAGTGTGG


XEN.LAE.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG---CACTGAGCTATGTC----GATCGGGTG
ZEA.MA_H      ATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-C


XEN.LAE.      -TCCGCACTAAGTTC-GGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGT
ZEA.MA_H      ACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAA


XEN.LAE.      TGCTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGT
ZEA.MA_H      CA-CT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGC


XEN.LAE.      GCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG----CAGAACAGCCT
ZEA.MA_H      CACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT-----------


XEN.LAE.      GAACAACACAGCGAGACACAGTTCT
ZEA.MA_H      -------------------------


[Download ClustalW]

#492

Mean pairwise ID: 32.32%


ARA.TH_A      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG--TGGGGACATTAAGATGGTGGGACA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_A      C-TG---GTTCGGT-TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_A      GTCCAAGCTGTGAGTAATTAG-TGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCT-
TRY.BR_B      TGCTTGGTTGCGTGTCGGTGTT-GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


ARA.TH_A      AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-C
TRY.BR_B      AA-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


ARA.TH_A      AGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG--
TRY.BR_B      CCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CC


ARA.TH_A      TCCGAT--CTCATATGAACCACCATTTT
TRY.BR_B      CAAG-TGT-CGTCGCG--AGGCGGTTT-


[Download ClustalW]

#493

Mean pairwise ID: 32.32%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G
ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAG-----CGGGGGCAATAAGGTAGTGTGG


CAE.BRI.      GATGGAGT-GAAGGGAGGAGTCCTGTGGGTG--TTGTCGGCAACGGC----GACCGAGCG
ZEA.MA_H      ATGT-CAAT--TGT-GGT---GCATG-TGCCTGGGTCTA-GTGCTACAAACTGTGGAC-C


CAE.BRI.      -TCCGTGCCAAGCGC-TGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGG
ZEA.MA_H      ACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAA


CAE.BRI.      CGCATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCG
ZEA.MA_H      CACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC


CAE.BRI.      CGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-----CGCCCACAGCCT
ZEA.MA_H      ACCAGCGGTGGAAGGATAATG-AGTCGCTA-TGCT--ATAGGCCCAAT------------


CAE.BRI.      CTCTGATACCTTCAGACCACTTGTCATT
ZEA.MA_H      ----------------------------


[Download ClustalW]

#494

Mean pairwise ID: 32.33%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_I      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_I      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_I      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_I      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CC


LYC.ES_I      TTGCT---CCAA-TTAAACCACCATTTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#495

Mean pairwise ID: 32.33%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAATGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_N      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_N      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_N      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_N      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CC


LYC.ES_N      TTGCT---CCAA-TTAAACCACCATTTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#496

Mean pairwise ID: 32.34%


ARA.TH_G      GTC-GAGCTATGTAACGAGAGCTTGTAACCCAAG-----TGGGGACTATAAGATGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ARA.TH_G      ACAC--TG--GATCGGC---CCA-CG-GGTC--GGATTTGTTGTTGGCATAGGTCTGGAC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


ARA.TH_G      -TGCCCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGT
DRO.MEL.      CG-TCCGCACTAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


ARA.TH_G      TGCT-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGC
DRO.MEL.      TGGCTAAGG-AGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


ARA.TH_G      TCTCAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


ARA.TH_G      GGC-TCGTAA--CCCGC-TTGAACCACCATTTT-
DRO.MEL.      ---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#497

Mean pairwise ID: 32.42%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


HUM.LU_B      C-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.LU_B      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.LU_B      T-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCC
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.LU_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTCC
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG------TATACACAG---CC


HUM.LU_B      TGACT--CTTAA-TCGGACCATTTCCTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#498

Mean pairwise ID: 32.42%


LYC.ES_B      GTC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA--TGGGGGCATTAATGTGGTGGAATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


LYC.ES_B      --TTG--GGCTGTA-CCAGAT-GGTTGGGCTTGGT-GGGCTAATTTCTGACT-TGCCCTA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-T


LYC.ES_B      TCCAAGCTTAGAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-A
TRY.BR_B      GCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


LYC.ES_B      AAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT-AAG
TRY.BR_B      A-AGTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTCC


LYC.ES_B      CGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG--GC
TRY.BR_B      C-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC----CCCA


LYC.ES_B      TGCT--CTAA-TTAAACCACCACTTTT
TRY.BR_B      AG-TGT-CGTCGCG--AGGCGGTTT--


[Download ClustalW]

#499

Mean pairwise ID: 32.42%


LYC.ES_K      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-TGGAGACATCAAAGTGGTTGAATA-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_K      -TTG-GGCTTTA--CCAGAA-GGTTG---GGCTTGGT--GGGCTTAGTTCTGGCC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_K      CTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_K      -AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGT
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_K      GCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCCTAATGG---G
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------GCTAATCG-GTTCTG-


LYC.ES_K      TTGCT-CCAA--TAAACAACCACCTTT
TET.ROS.      CTATTC--TGATCA-GACACT------


[Download ClustalW]

#500

Mean pairwise ID: 32.42%


LYC.ES_N      GTT-GAGCTTAGTAACGTGGGCTTGTAACCCAAG-TGGGGATGTTAATGTGGTGGAATG-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_N      -TTG-GGCTGTA--CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_N      CTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_N      -AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTAA
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_N      GCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCCTGATGG---G
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------GCTAATCG-GTTCTG-


LYC.ES_N      TTGCT-CCAA-TTAAACCACCATTTTT
TET.ROS.      CTATTC--TGATCA-GACACT------


[Download ClustalW]

#501

Mean pairwise ID: 32.42%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_B      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_B      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_B      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_B      AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--C


LYC.ES_B      GCTGCT---CTAA-TTAAACCACCACTTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#502

Mean pairwise ID: 32.43%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG-----TGAGGGTATCAAAGTGGTTGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


CIN.HYB.      CT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-TG
CAE.EL_B      ATGGAGT-GAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-


CIN.HYB.      CCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT
CAE.EL_B      TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTG


CIN.HYB.      TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTC
CAE.EL_B      CATAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGC


CIN.HYB.      TCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTG
CAE.EL_B      GGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG-


CIN.HYB.      G--CTAGC---CCAA-CAGGACACCCATTT---
CAE.EL_B      -CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#503

Mean pairwise ID: 32.44%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_D      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_A      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC----GACCGAGC


ZEA.MA_D      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_A      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG


ZEA.MA_D      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.EL_A      TG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-GACCG


ZEA.MA_D      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.EL_A      CGTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGC


ZEA.MA_D      GAG-CC-TCA---CTAA-GCAGACCACCATCTT---
CAE.EL_A      AG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#504

Mean pairwise ID: 32.44%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G


ZEA.MA_A      ATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGCT
CAE.BRI.      GATGGAGT-GAAGGGAGGAGTCCTGTGGGTG---TTGTCG-GCAACGGC----GACCGAG


ZEA.MA_A      -TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-
CAE.BRI.      CG-TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGC-TGGCGGTCCCG


ZEA.MA_A      CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCG
CAE.BRI.      GGCG-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACC


ZEA.MA_A      ACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-C
CAE.BRI.      GCGCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCA


ZEA.MA_A      AGAA-CC-TCA---CTAA-GCAAACCACCATCTTT-
CAE.BRI.      CAG-CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#505

Mean pairwise ID: 32.44%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_F      ATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-
CAE.EL_D      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC----GACCGAGC


ZEA.MA_F      TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTA
CAE.EL_D      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG


ZEA.MA_F      GACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.EL_D      TG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-GACCG


ZEA.MA_F      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--CA
CAE.EL_D      CGTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACAC


ZEA.MA_F      GAG-CC-TCA---TTAA-ACAGACCACCATCTTT--
CAE.EL_D      AG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#506

Mean pairwise ID: 32.44%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_E      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_D      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC----GACCGAGC


ZEA.MA_E      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_D      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG


ZEA.MA_E      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGG
CAE.EL_D      TG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-GACCG


ZEA.MA_E      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.EL_D      CGTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACAC


ZEA.MA_E      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT--
CAE.EL_D      AG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#507

Mean pairwise ID: 32.44%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_E      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_A      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC----GACCGAGC


ZEA.MA_E      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_A      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG


ZEA.MA_E      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGG
CAE.EL_A      TG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-GACCG


ZEA.MA_E      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.EL_A      CGTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGC


ZEA.MA_E      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT--
CAE.EL_A      AG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#508

Mean pairwise ID: 32.44%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGCGCGG
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_B      ATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT-
CAE.EL_D      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC----GACCGAGC


ZEA.MA_B      TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-C
CAE.EL_D      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGC-GGTTAGTCCCGG


ZEA.MA_B      AGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
CAE.EL_D      GTG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-GACC


ZEA.MA_B      ACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-C
CAE.EL_D      GCGTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACA


ZEA.MA_B      AGATCC-TCT---CTTA-GCAAACCACCATCTTT--
CAE.EL_D      CAGCCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#509

Mean pairwise ID: 32.44%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGCGCGG
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_B      ATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT-
CAE.EL_A      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC----GACCGAGC


ZEA.MA_B      TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-C
CAE.EL_A      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGC-GGTTAGTCCCGG


ZEA.MA_B      AGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
CAE.EL_A      GTG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-GACC


ZEA.MA_B      ACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-C
CAE.EL_A      GCGTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACG


ZEA.MA_B      AGATCC-TCT---CTTA-GCAAACCACCATCTTT--
CAE.EL_A      CAGCCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#510

Mean pairwise ID: 32.44%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_D      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_D      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC----GACCGAGC


ZEA.MA_D      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_D      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG


ZEA.MA_D      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.EL_D      TG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-GACCG


ZEA.MA_D      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.EL_D      CGTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACAC


ZEA.MA_D      GAG-CC-TCA---CTAA-GCAGACCACCATCTT---
CAE.EL_D      AG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#511

Mean pairwise ID: 32.52%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_J      -TTG--GGCTTTA-CCAGAA-GGTTGGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTGT
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-TG


LYC.ES_J      CCAAGCACAGAGTTGGATCA-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-A
LEI.MAJ.      CTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTT


LYC.ES_J      AAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT-GTG
LEI.MAJ.      GAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTCCG


LYC.ES_J      CAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG--GT
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC-------GCACTTGAGC----CCCA


LYC.ES_J      TGCT-CCAA--TAAACAACCACCTTT
LEI.MAJ.      CGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#512

Mean pairwise ID: 32.52%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG------TGGGGGCATTGAGGCGGTGTG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


TRI.AE_B      GATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-T
GAL.GAL.      GGATCGCTTGAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC---GAGCGGGCG


TRI.AE_B      GCCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-
GAL.GAL.      -TCCGCGCTAAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


TRI.AE_B      CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


TRI.AE_B      CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-C
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTAGCC


TRI.AE_B      CCCGC--CAT-A-GCAGACCACCATCTTT
GAL.GAL.      TGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#513

Mean pairwise ID: 32.52%


ARA.TH_F      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG--TGGGGACATTAAGATGGTGGGACA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_F      C--TG--GTTCGGT-TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_F      GTCCAAGCTGTGAGTAATTAG-TGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTCT-
TRY.BR_B      TGCTTGGTTGCGTGTCGGTGTT-GAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


ARA.TH_F      AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA-C
TRY.BR_B      AA-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


ARA.TH_F      AGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT-
TRY.BR_B      CCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----C


ARA.TH_F      -CCGATC--TCAT-ATGAACCACCATTTT
TRY.BR_B      CCAAG-TGT-CGTCGCG--AGGCGGTTT-


[Download ClustalW]

#514

Mean pairwise ID: 32.53%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG------TGAGGGTATCAAAGTGGTTGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


CIN.HYB.      ACT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-T
CAN.SPE.      GATCGCTT-GAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG


CIN.HYB.      GCCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGC
CAN.SPE.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


CIN.HYB.      TTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCT
CAN.SPE.      GCCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTG


CIN.HYB.      CTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCT
CAN.SPE.      CTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG


CIN.HYB.      GG--CTAGC---CCAA-CAGGACACCCATTT-
CAN.SPE.      --CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#515

Mean pairwise ID: 32.53%


ZEA.MA_E      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGCGGATT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


ZEA.MA_E      C-TTTG--CGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-T
TET.THE.      GTT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG


ZEA.MA_E      GCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAG
TET.THE.      -CCCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGC


ZEA.MA_E      ACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGC
TET.THE.      A-TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACT-TGCCGC


ZEA.MA_E      TTCCAACGGTGGGAGGATAACG-GGCCGCTGCACT--TCGAGCCCAACTCAGGCCCAGAG
TET.THE.      TTGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-GT


ZEA.MA_E      ----CC-TCA-CTAA-GCAGACCACCATCTTT
TET.THE.      TCTA-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#516

Mean pairwise ID: 32.54%


DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-
TRI.AE_A      NCC-GAGCTCAGTTGCGAGAGCTTGTAACCCGAG-----TGGGGGCATTAAAGTGATGTG


DRO.MEL.      -GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT---GACGGA
TRI.AE_A      AACGC-TGTT--GTA-GCG----CTGCG-GGCCT-GGTCTGGG--TGTGCTACTGCTGGC


DRO.MEL.      ACG-TCCGCACTAAGCTT-GCCAT-CAATAT-GGGTGCCATGGAGGAGTCCGTGGCATTC
TRI.AE_A      C-CGCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA


DRO.MEL.      AGGTTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCC
TRI.AE_A      -CGGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCC


DRO.MEL.      CGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-
TRI.AE_A      CGCTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTC


DRO.MEL.      CAG-CCCAACCGATATGGTTGG-ACCACAATCTTT
TRI.AE_A      GCAG--CCTAC---TCCA-GCAGACCACC------


[Download ClustalW]

#517

Mean pairwise ID: 32.60%


TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG
ZEA.MA_H      NCC-GAGCTCTGTAGCGAGTGCTTGTAACCCGAG-CGGGGGCAATAAGGTAGTGTGGATG


TET.THE.      GTT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG
ZEA.MA_H      T-CAAT--TGT-GGT---GCATG-TGCCT--GGGTCTA--GTGCTACAAACTGTGGAC-C


TET.THE.      -CCCGCTCCAAACAA-TGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGG
ZEA.MA_H      ACCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAA


TET.THE.      CATTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCT
ZEA.MA_H      CACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCC


TET.THE.      TGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCGGTTCT
ZEA.MA_H      ACCAGCGGTGGAAGGATAATG-AGTCGCTATGCT--ATAGGCCCAAT-------------


TET.THE.      ACTATCAAAGCCAGACATT
ZEA.MA_H      -------------------


[Download ClustalW]

#518

Mean pairwise ID: 32.62%


ARA.TH_E      GTC-GAGCTAAGTAACATGAGCTTGTAACCCATG--TGGGGACATTTAGATGGTGGAACA
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_E      C--TG--GTTCGGG-TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGCCCA
TRY.BR_A      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_E      GTCCAAGCTGTGAGTAAGACG-TGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT-A
TRY.BR_A      TGCTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


ARA.TH_E      AAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA-CA
TRY.BR_A      A-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


ARA.TH_E      GCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT--
TRY.BR_A      CC-GTTCGAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


ARA.TH_E      CCGATC--TCAT-ATGAACCACCATTTT
TRY.BR_A      CAAG-TGT-CGTCGCG--AGGCGG----


[Download ClustalW]

#519

Mean pairwise ID: 32.63%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_B      C-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


HUM.LU_B      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.LU_B      T-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCC
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.LU_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTCC
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA------CATACACAG---CC


HUM.LU_B      TGACT--CTTAA-TCGGACCATTTCCTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#520

Mean pairwise ID: 32.63%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


ZEA.MA_G      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
GAL.GAL.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GAGCGGG


ZEA.MA_G      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
GAL.GAL.      CG-TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGG


ZEA.MA_G      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCG
GAL.GAL.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG


ZEA.MA_G      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
GAL.GAL.      TGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGT


ZEA.MA_G      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
GAL.GAL.      AG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#521

Mean pairwise ID: 32.63%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-----TGGGGGCAACAATGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_F      TG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-TG
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC-----GACCGAGCG-


LYC.ES_F      CCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCT
CAE.EL_A      TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG


LYC.ES_F      TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT
CAE.EL_A      CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTG


LYC.ES_F      GTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATA
CAE.EL_A      GTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA---------CATACGCAG-


LYC.ES_F      G-GTTGCC----TAA-TTAAACCATCACTTTT--
CAE.EL_A      -CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#522

Mean pairwise ID: 32.63%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_G      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_B      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC----GACCGAGC


ZEA.MA_G      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_B      G-TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGG


ZEA.MA_G      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGC
CAE.EL_B      TG-CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGC


ZEA.MA_G      TTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAG
CAE.EL_B      GCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACA


ZEA.MA_G      AG-CC-TCA---CTAA-GCAGACCACCATCTTT-
CAE.EL_B      G-CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#523

Mean pairwise ID: 32.63%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_H      T-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_H      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_H      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_H      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CC


LYC.ES_H      TTGCT---CCAA-TAAACAACCACCTTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#524

Mean pairwise ID: 32.63%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


ZEA.MA_D      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
GAL.GAL.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GAGCGGG


ZEA.MA_D      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
GAL.GAL.      CG-TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGG


ZEA.MA_D      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
GAL.GAL.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_D      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
GAL.GAL.      GTGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCG


ZEA.MA_D      AGAG-CC-TCA---CTAA-GCAGACCACCATCTT
GAL.GAL.      TAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#525

Mean pairwise ID: 32.63%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_B      C-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


HUM.LU_B      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.LU_B      T-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCC
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.LU_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTCC
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA------CATACGCAG---CC


HUM.LU_B      TGACT--CTTAA-TCGGACCATTTCCTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#526

Mean pairwise ID: 32.63%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


HUM.LU_C      CT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.LU_C      CCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.LU_C      T-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.LU_C      GGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


HUM.LU_C      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#527

Mean pairwise ID: 32.64%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG------CGGGGGCAATAAGGTGGTGTT
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-


ORY.SA_B      GGATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGC
GAL.GAL.      -GGATCGCTT--GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC---GAGCGG


ORY.SA_B      C-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCC
GAL.GAL.      GCG-TCCGCGCTAAGGCC-GGCAT--CAATATGGTGAGCCCCGGGGAGCCGAGGCACACC


ORY.SA_B      CTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCC
GAL.GAL.      AGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ORY.SA_B      CGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-
GAL.GAL.      CGTGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGC


ORY.SA_B      C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
GAL.GAL.      GTAG--CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#528

Mean pairwise ID: 32.72%


LYC.ES_J      GTC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-TGGAGACATCAAAGTGGTTGAATA-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_J      -TTG-GGCTTTA--CCAGAA-GGTTG---GGCTTGGT--GGGCTTAGTTCTGGCC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_J      CTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_J      -AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGT
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_J      GCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCCTAATGG---G
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------GCTAATCG-GTTCTG-


LYC.ES_J      TTGCT-CCAA--TAAACAACCACCTTT
TET.ROS.      CTATTC--TGATCA-GACACT------


[Download ClustalW]

#529

Mean pairwise ID: 32.73%


ZEA.MA_B      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGCGCGGATG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


ZEA.MA_B      C-TTTG--CGATGGT---TTCTG-GGCCT--GGGCTCGT--TGTGACTCTAGCCGGCT-T
TET.THE.      GTT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG


ZEA.MA_B      GCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-CA
TET.THE.      -CCCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAG-GACTCCACCAGGG


ZEA.MA_B      GACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCA
TET.THE.      CA-TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACT-TGCCG


ZEA.MA_B      CTTCCAACGGTGGGAGGATAACA-AGCCGCTGCACT--TTGAGCCCAACACAGACCCAGA
TET.THE.      CTTGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-G


ZEA.MA_B      ----TCC-TCT-CTTA-GCAAACCACCATCTTT
TET.THE.      TTCTA-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#530

Mean pairwise ID: 32.73%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


ARA.TH_A      ACAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


ARA.TH_A      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT
GAL.GAL.      TCCGCGCTAAGGCCGGCATCAATAT-GGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
GAL.GAL.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_A      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
GAL.GAL.      CGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--


ARA.TH_A      -TCCGAT---CTCATATGAACCACCATTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#531

Mean pairwise ID: 32.74%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


ZEA.MA_A      AATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGC
RAT.RAT.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG----TAGTGC-GCTATGCC----GATCGG


ZEA.MA_A      T-TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG
RAT.RAT.      GTG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCA


ZEA.MA_A      -CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCC
RAT.RAT.      GGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ZEA.MA_A      GACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-
RAT.RAT.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_A      CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
RAT.RAT.      CCAG-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#532

Mean pairwise ID: 32.75%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG-----CGGGGGCACTAAAGGTGGCTGC
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT----AGATAAGTGT-


ORY.SA_A      GGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT
CAE.EL_A      -GGATGGAGT--GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC--GACCGAG


ORY.SA_A      -TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCT
CAE.EL_A      CG-TCCGTGCCAAGCGC-TACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCG


ORY.SA_A      TCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACT
CAE.EL_A      GGTG-----CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC


ORY.SA_A      GCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGG
CAE.EL_A      GACCGCGTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CA


ORY.SA_A      CC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT--
CAE.EL_A      TACGCAG--CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#533

Mean pairwise ID: 32.82%


ARA.TH_C      GTC-GAACTCAGTAACGCGGGCTTGTGATCCAAG-TGGAGACAATAAGGGGATGGGACG-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


ARA.TH_C      -TTG--GGTCGAT-CTCATTG-GGCC---GGGTTCGGGTTGGGCTATATTCTGGCC-CGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


ARA.TH_C      CCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


ARA.TH_C      T-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTT
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


ARA.TH_C      GACGGTGGAAGGATTACG-GGCCATTGCCT---TCCGAGCCCACTATGACCCAATAAG--
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-GTTCTA


ARA.TH_C      CCGCT-CCGA-TTGGACCATCACTTT
TET.THE.      CTATCA--AAGCCA-GACATT-----


[Download ClustalW]

#534

Mean pairwise ID: 32.83%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG-----TGGAGACAATAAGGGGATGGGA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


ARA.TH_C      CG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_C      CCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


ARA.TH_C      T-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTT
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


ARA.TH_C      GACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAAG
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG---


ARA.TH_C      --CCGCT---CCGA-TTGGACCATCACTTT--
CAE.EL_C      CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#535

Mean pairwise ID: 32.83%


GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCC-
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG------TGGGGGCATTAAAGTGATGTG


GAL.GAL.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC---GAGCGGGC
TRI.AE_A      AACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-


GAL.GAL.      G-TCCGCGCTAAGGCC-GGCAT-CAATAT-GGTGAGCCCCGGGGAGCCGAGGCACACCAG
TRI.AE_A      CGCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-C


GAL.GAL.      GTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG
TRI.AE_A      GGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG


GAL.GAL.      TGCCGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTA
TRI.AE_A      CTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGC


GAL.GAL.      G-CCTGGGCAACATAGCGAG-ACCCTGTCTCC
TRI.AE_A      AG--CCTAC---TCCA-GCAGACCACC-----


[Download ClustalW]

#536

Mean pairwise ID: 32.83%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_I      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_I      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_I      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_I      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CC


LYC.ES_I      TTGCT---CCAA-TTAAACCACCATTTTT
FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#537

Mean pairwise ID: 32.84%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGCGCG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


ZEA.MA_B      GATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT
RAT.NOR.      GGATCGATT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_B      -TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-
RAT.NOR.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAG


ZEA.MA_B      CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
RAT.NOR.      GTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCC


ZEA.MA_B      CACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-
RAT.NOR.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_B      CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
RAT.NOR.      CCAGCCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#538

Mean pairwise ID: 32.84%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_G      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_D      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC----GACCGAGC


ZEA.MA_G      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_D      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG


ZEA.MA_G      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGC
CAE.EL_D      TG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGC


ZEA.MA_G      TTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAG
CAE.EL_D      GTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACA


ZEA.MA_G      AG-CC-TCA---CTAA-GCAGACCACCATCTTT--
CAE.EL_D      G-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#539

Mean pairwise ID: 32.84%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGCGCG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


ZEA.MA_B      GATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT
ORI.CUN.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC----GATCGGG


ZEA.MA_B      -TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-
ORI.CUN.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAG


ZEA.MA_B      CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
ORI.CUN.      GTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCC


ZEA.MA_B      CACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-
ORI.CUN.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_B      CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
ORI.CUN.      CCAGCCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#540

Mean pairwise ID: 32.84%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_G      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.EL_A      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC----GACCGAGC


ZEA.MA_G      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.EL_A      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG


ZEA.MA_G      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGC
CAE.EL_A      TG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGC


ZEA.MA_G      TTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAG
CAE.EL_A      GTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCA


ZEA.MA_G      AG-CC-TCA---CTAA-GCAGACCACCATCTTT--
CAE.EL_A      G-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#541

Mean pairwise ID: 32.89%


TET.THE.      GCCAGGGTAGCA-ATACCTGTGTCTA-TATGTGGCATAAACAATGTAGGTT--GTGATAG
LEI.MAJ.      GCC-GGAGC--TCTGCTCTGTAACCTTCGGGGGCT-AACCAGGCTTAGCGGGGAGGACGT


TET.THE.      ATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATGA
LEI.MAJ.      GGA--CCAGCGAGGGT---GATTTG-C-TGCGTTGACGTGGTGCTC-TGCTTGGCTGTGT


TET.THE.      GTTGCTAT-GGTGGTAACCTAGTAATAGGACTCCACCAGGGCA-TTAAAGAGCTAAGGAA
LEI.MAJ.      GTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCGAGGGAA


TET.THE.      ACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTG-TTGTGGTGGAAGGATAA
LEI.MAJ.      CCGGGTCAGGCCGGAAACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCAGAATCA


TET.THE.      CATACTCA-TTAACTGTCAA-ACTAAT-CGGTTCTA-CTATCA-AAGCCAGACATT--
LEI.MAJ.      CACCGCGGA-GCATGTCC--GCACTTGAGC----CCCACGCTTCGTCGCG-AAGCCTT


[Download ClustalW]

#542

Mean pairwise ID: 32.93%


HUM.JA_B      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


HUM.JA_B      ACT--TTA--GTTCGGC---CCATTG-GATC--GGATCCAGTGTTAGCTGCTTGCTGGGC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


HUM.JA_B      -TGCCCATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAG
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


HUM.JA_B      CTCCT-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


HUM.JA_B      TCTCGGCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


HUM.JA_B      GAG-CTGACT--CTTAA-TAGGACCATTTCTTTT
DRO.MEL.      ---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#543

Mean pairwise ID: 32.93%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAGATGGGA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.JA_A      CT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


HUM.JA_A      CCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.JA_A      T-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTC
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.JA_A      GGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-T
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA------CATACACAG---CC


HUM.JA_A      GCACT--CTTAA-TCAGACCATCTCTTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#544

Mean pairwise ID: 32.93%


HUM.LU_C      ----GGTCTTAGCAACTTGGTCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


HUM.LU_C      ACT--TTG--GGTCAAC---CCAGTG-GTNC--GGGNCCAGTGCTAGCTGCTTACCCGGC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


HUM.LU_C      -TGCCCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


HUM.LU_C      CTCCT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


HUM.LU_C      TCTCGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


HUM.LU_C      GGG-CTGACT--CTTAA-TAGGACCATTTCTTTT
DRO.MEL.      ---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#545

Mean pairwise ID: 32.93%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAGATGGGA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.JA_A      CT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


HUM.JA_A      CCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.JA_A      T-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTC
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.JA_A      GGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-T
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA------CATACGCAG---CC


HUM.JA_A      GCACT--CTTAA-TCAGACCATCTCTTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#546

Mean pairwise ID: 32.93%


HUM.LU_A      GCC-GGTCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


HUM.LU_A      ACT--TTG--GGTCAAC---CTAGTG-GATC--GGGTCCAGTGTTAGCTGCTTACTGGTC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


HUM.LU_A      -TGCCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCAC
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


HUM.LU_A      GTCCT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


HUM.LU_A      TCTCGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


HUM.LU_A      AGG-CTGACT--CTTAA-TAGGACCATTTCTTTT
DRO.MEL.      ---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#547

Mean pairwise ID: 32.93%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG--CGGGGGCAATAAGGTGGTGTTGGAT
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT----A


ORY.SA_B      GC-CTGGTC-GTTTGCG-CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC-CGCC
LEI.MAJ.      GCGGGG--AGGACGTGGACCAGCGAGGGT-GATTTG-C-TGCGTT---GACGTGGTG-CT


ORY.SA_B      CGTTCCAAGTTGCGTAGCGTGTGTG--GGGCGCCTGGGCGAAGGCTCGAGCGTCCCTGCA
LEI.MAJ.      C-TGCTTGGCTG-TGTGT--CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CC


ORY.SA_B      C-CT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCGCT
LEI.MAJ.      GCCGTTGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCA


ORY.SA_B      TC-CAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTT-CCGGCC-C-
LEI.MAJ.      CGTCCGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC---------GCACTTGAGC


ORY.SA_B      AAGT--GCCTTC-CATG-GCAGACCACCACCTTT
LEI.MAJ.      ----CCCACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#548

Mean pairwise ID: 32.93%


ZEA.MA_D      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGCGGATT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


ZEA.MA_D      C-TTTG--CGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-T
TET.THE.      GTT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG


ZEA.MA_D      GCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAG
TET.THE.      -CCCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGC


ZEA.MA_D      ACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGC
TET.THE.      A-TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACT-TGCCGC


ZEA.MA_D      TTCCAACGGTGGGAGGATAACA-GGCCGCTGCACT--TCGAGCCCAACTCAGGCCCAGAG
TET.THE.      TTGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-GT


ZEA.MA_D      ----CC-TCA-CTAA-GCAGACCACCATCTT
TET.THE.      TCTA-CTATCA--AAGCCA-GACATT-----


[Download ClustalW]

#549

Mean pairwise ID: 32.93%


LYC.ES_C      GCC-GAGCTCAGTAGCGTGGGCTTGTAACTCAAG-----TGAGGGCATCAGTGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_C      ATG--TTG--AACATGC---CCAGAA-GGTA--GGGCTTGT--GTGACAATTCTCTGGCC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


LYC.ES_C      -TGCCCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGG
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


LYC.ES_C      CTCCT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


LYC.ES_C      TCTGTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGA
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT-CA


LYC.ES_C      TGG-GCTGTT---CTAG-TTAAACTACCACATTT
DRO.MEL.      G--CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#550

Mean pairwise ID: 32.93%


ZEA.MA_G      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGCGGATT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


ZEA.MA_G      C-TTTG--CGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-T
TET.THE.      GTT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG


ZEA.MA_G      GCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAG
TET.THE.      -CCCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGC


ZEA.MA_G      ACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCT
TET.THE.      A-TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCT


ZEA.MA_G      TCCAACGGTGGGAGGATAACG-GGCCGCTGCACT--TCGAGCCCAACTCAGGCCCAGAG-
TET.THE.      TGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-GTT


ZEA.MA_G      ---CC-TCA-CTAA-GCAGACCACCATCTTT
TET.THE.      CTA-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#551

Mean pairwise ID: 33.03%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG------TGGGGACTATAAGATGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


ARA.TH_G      ACAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


ARA.TH_G      CCCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGC
GAL.GAL.      TCCGCGCTAAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGC


ARA.TH_G      T-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
GAL.GAL.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


ARA.TH_G      CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG---


ARA.TH_G      -TCGTAA--CCCGC-TTGAACCACCATTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#552

Mean pairwise ID: 33.03%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG------TGGGGACAATAAGGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


ARA.TH_D      ACAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


ARA.TH_D      CCCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGC


ARA.TH_D      T-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA
GAL.GAL.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


ARA.TH_D      CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG---


ARA.TH_D      -TCGATC---TCTC-CTGGACCACCACTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#553

Mean pairwise ID: 33.03%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG
LYC.ES_M      -----------------------------CAAG-----TGGGGATGTTAAGGTGGTGGAA


CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T
LYC.ES_M      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC


CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC
LYC.ES_M      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC


CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG
LYC.ES_M      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG


CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--CC
LYC.ES_M      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G


CAE.BRI.      TCTCTGATACCTTCAG-ACCACTTGTCATT
LYC.ES_M      TTGCT---CCAA--TAAACAACCACCTTT-


[Download ClustalW]

#554

Mean pairwise ID: 33.03%


HUM.JA_A      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAGATGGG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


HUM.JA_A      ACT--TTG--GGTCAGC---CCATTG-GATC--GGGTCCAGTGTTAGCTGCTTGCTGGTC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


HUM.JA_A      -TGCCCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAG
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


HUM.JA_A      CTCCT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


HUM.JA_A      TCTCGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTG
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-----CGTTAT-CAG-


HUM.JA_A      CA-TGCACT--CTTAA-TCAGACCATCTCTTTT
DRO.MEL.      --CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#555

Mean pairwise ID: 33.03%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG--TGGAGACATCAAAGTGGTTGAATA-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


LYC.ES_A      -TTG--GGCTTTA-CCAGAA-GGTT-GGGCTTGGT-GGGCTTAGTTCTGGCC-TGCCCTG
LEI.MAJ.      GGGGAGGACGTGGA-CCAGCGAGGGT-GATTTG-CTGCGTT----GACGTGGTG-CTC-T


LYC.ES_A      TCCAAGCACAGAGTTGGATCT-CGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-CT-
LEI.MAJ.      GCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


LYC.ES_A      AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACGCTCCCGCTCT-GTG
LEI.MAJ.      TGAAGCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCACCCC-ACGCACGTCCG


LYC.ES_A      CAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGT-AACGCC-TAATGG--G
LEI.MAJ.      CCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----CCC


LYC.ES_A      TTGCT-CCAA--TAAACAACCACCTTT
LEI.MAJ.      ACGCTT-CGTCGCG--AAGCCTT----


[Download ClustalW]

#556

Mean pairwise ID: 33.03%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAATGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_N      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_N      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_N      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_N      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--C


LYC.ES_N      GTTGCT---CCAA-TTAAACCACCATTTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#557

Mean pairwise ID: 33.03%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG------TGGGGGCAACAATGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_F      ATG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-T
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC-----GAGCGGGCG


LYC.ES_F      GCCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCC
GAL.GAL.      -TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTT


LYC.ES_F      TTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC
GAL.GAL.      GCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


LYC.ES_F      TGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGAT
GAL.GAL.      CGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG---------CAGCGTAG


LYC.ES_F      AG-GTTGCC----TAA-TTAAACCATCACTTTT
GAL.GAL.      --CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#558

Mean pairwise ID: 33.03%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_B      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_B      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_B      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTA
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_B      AGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-G
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_B      CTGCT---CTAA-TTAAACCACCACTTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#559

Mean pairwise ID: 33.04%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


ZEA.MA_A      AATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGC
CAN.SPE.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG----CAGTGC-GCTATGCC----GATCGG


ZEA.MA_A      T-TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG
CAN.SPE.      GTG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCA


ZEA.MA_A      -CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCC
CAN.SPE.      GGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ZEA.MA_A      GACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-
CAN.SPE.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_A      CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
CAN.SPE.      CCAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#560

Mean pairwise ID: 33.04%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


ZEA.MA_F      ATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-
CAE.EL_A      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC----GACCGAGC


ZEA.MA_F      TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTA
CAE.EL_A      G-TCCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGG


ZEA.MA_F      GACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.EL_A      TG-CATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGC-GACCG


ZEA.MA_F      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--CA
CAE.EL_A      CGTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGC


ZEA.MA_F      GAG-CC-TCA---TTAA-ACAGACCACCATCTTT--
CAE.EL_A      AG-CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#561

Mean pairwise ID: 33.13%


ARA.TH_C      GTC-GAACTCAGTAACGCGGGCTTGTGATCCAAG-----TGGAGACAATAAGGGGATGGG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ARA.TH_C      ACG--TTG--GGTCGAT--CTCATTG-GGCC--GGGTTCGGGTTGGGCTATATTCTGGCC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


ARA.TH_C      -CGCCCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGT
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


ARA.TH_C      CTTCT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


ARA.TH_C      TCTTGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAA
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT-CA


ARA.TH_C      TAAG--CCGCT---CCGA-TTGGACCATCACTTT-
DRO.MEL.      G---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#562

Mean pairwise ID: 33.13%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G


ZEA.MA_D      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.BRI.      GATGGAGT-GAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC----GACCGAGC


ZEA.MA_D      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.BRI.      G-TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGG


ZEA.MA_D      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.BRI.      CG-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGC-CACCG


ZEA.MA_D      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.BRI.      CGCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCAC


ZEA.MA_D      GAG-CC-TCA---CTAA-GCAGACCACCATCTT--
CAE.BRI.      AG-CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#563

Mean pairwise ID: 33.13%


LYC.ES_A      GGC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-TGGAGACATCAAAGTGGTTGAATA-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_A      -TTG-GGCTTTA--CCAGAA-GGTT---GGGCTTGGT--GGGCTTAGTTCTGGCC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_A      CTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_A      -AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCTGT
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_A      GCAGTGGAAGGATAATG-GGTCGGTGTCTT-ATCAAGTTCAGTAACGCCTAATGG---GT
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-C


LYC.ES_A      TGCT-CCAA--TAAACAACCACCTTT
TET.ROS.      TATTC--TGATCA-GACACT------


[Download ClustalW]

#564

Mean pairwise ID: 33.13%


LYC.ES_I      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_I      ATG--TTG--GGCTGTA---CCAGAT-GGTTG-GGCTTGGT--GGGCTAATTTCTGACT-
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAAC


LYC.ES_I      TGCCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGAT
DRO.MEL.      G-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


LYC.ES_I      TCGT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


LYC.ES_I      CTAAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATG
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG-


LYC.ES_I      G-GTTGCT---CCAA-TTAAACCACCATTTTT
DRO.MEL.      -CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#565

Mean pairwise ID: 33.13%


LYC.ES_H      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_H      AT-A-TTG--GGCTGTA---CCAGAT-GGTTG-GGCTTGGT--GGGCTAATTTCTGACT-
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAAC


LYC.ES_H      TGCCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGAT
DRO.MEL.      G-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


LYC.ES_H      TCGT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


LYC.ES_H      CTGTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATG
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG-


LYC.ES_H      G-GTTGCT---CCAA-TAAACAACCACCTTTT
DRO.MEL.      -CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#566

Mean pairwise ID: 33.13%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G


ZEA.MA_E      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.BRI.      GATGGAGT-GAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC----GACCGAGC


ZEA.MA_E      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.BRI.      G-TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGG


ZEA.MA_E      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGG
CAE.BRI.      CG-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGC-CACCG


ZEA.MA_E      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAE.BRI.      CGCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCAC


ZEA.MA_E      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT-
CAE.BRI.      AG-CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#567

Mean pairwise ID: 33.13%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGCGCGG
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G


ZEA.MA_B      ATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT-
CAE.BRI.      GATGGAGT-GAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC----GACCGAGC


ZEA.MA_B      TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-C
CAE.BRI.      G-TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGC-TGGCGGTCCCGG


ZEA.MA_B      AGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
CAE.BRI.      GCG-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGC-CACC


ZEA.MA_B      ACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-C
CAE.BRI.      GCGCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCA


ZEA.MA_B      AGATCC-TCT---CTTA-GCAAACCACCATCTTT-
CAE.BRI.      CAGCCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#568

Mean pairwise ID: 33.13%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G


ZEA.MA_A      ATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGCT
FUG.RUB.      GATCGCTT-GAGCTCAGGAGTTCTGGGCTT----CAGCGG-ACTATGTC----GATCGGG


ZEA.MA_A      -TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-
FUG.RUB.      TG-TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCC-GGGATCACCAG


ZEA.MA_A      CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCG
FUG.RUB.      GTCG-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCC


ZEA.MA_A      ACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-C
FUG.RUB.      GTGCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTT


ZEA.MA_A      AGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
FUG.RUB.      CAA-CCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#569

Mean pairwise ID: 33.13%


ZEA.MA_A      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGTGAATG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


ZEA.MA_A      C-TTTG--CGATGGCT--TTCTG-GGCCCT-GGGCTCGT--TGTGACACTGGCCGGCT-T
TET.THE.      GTT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG


ZEA.MA_A      GCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-CA
TET.THE.      -CCCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAG-GACTCCACCAGGG


ZEA.MA_A      GACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGAC
TET.THE.      CA-TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGC


ZEA.MA_A      TCCCAACGGTGGGAGGATAACGAAGCCGCTGCACT--TTGAGCCTAACTCAGGCTCAGAA
TET.THE.      TTGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-GT


ZEA.MA_A      ----CC-TCA-CTAA-GCAAACCACCATCTTT
TET.THE.      TCTA-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#570

Mean pairwise ID: 33.14%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG------CGGGGGCACTAAAGGTGGCTG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC----TGAGGCCGGA


ORY.SA_A      CGGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGC
ORI.CUN.      --GGATCGCTT--GAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC--GATCGG


ORY.SA_A      T-TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGC
ORI.CUN.      GTG-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCA


ORY.SA_A      TTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCAC
ORI.CUN.      GGTTG-----CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAA


ORY.SA_A      TGCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTG
ORI.CUN.      CTCCCGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------


ORY.SA_A      GCC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
ORI.CUN.      CACTCCAG--CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#571

Mean pairwise ID: 33.14%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG------CGGGGGCACTAAAGGTGGCTG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC----TGAGACAGGA


ORY.SA_A      CGGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGC
RAT.NOR.      --GGATCGATT--GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC--GATCGG


ORY.SA_A      T-TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGC
RAT.NOR.      GTG-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCA


ORY.SA_A      TTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCAC
RAT.NOR.      GGTTG-----CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAA


ORY.SA_A      TGCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTG
RAT.NOR.      CTCCCGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------


ORY.SA_A      GCC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
RAT.NOR.      CACTCCAG--CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#572

Mean pairwise ID: 33.23%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG-----CGGGGGCAATAAGGTGGTGTTG
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT--


ORY.SA_B      GATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC
CAE.EL_C      GGATGGAGT--GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC---GACCGAG


ORY.SA_B      -CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCC
CAE.EL_C      CG-TCCGTGCCAAGCGC-TGCGT--CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCC


ORY.SA_B      TGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCC
CAE.EL_C      GGGTGCATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACC


ORY.SA_B      GCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-C
CAE.EL_C      GCGCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACA


ORY.SA_B      -AAGT-GCCTTC---CATG-GCAGACCACCACCTTT-
CAE.EL_C      CAG--CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#573

Mean pairwise ID: 33.23%


LYC.ES_I      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA-TGGGGGCATTAATGTGGTGGAATG-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_I      -TTG--GGCTGTA--CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_I      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_I      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_I      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCCTGATGG---
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------ACTAATCG-GTTCTA


LYC.ES_I      GTTGCT-CCAA-TTAAACCACCATTTTT
TET.THE.      -CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#574

Mean pairwise ID: 33.23%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


HUM.LU_C      ACT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


HUM.LU_C      CCCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


HUM.LU_C      CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


HUM.LU_C      CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG---


HUM.LU_C      -CTGACT--CTTAA-TAGGACCATTTCTTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#575

Mean pairwise ID: 33.23%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


ARA.TH_F      ACAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


ARA.TH_F      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT
GAL.GAL.      TCCGCGCTAAGGCCGGCATCAATAT-GGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


ARA.TH_F      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
GAL.GAL.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_F      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
GAL.GAL.      CGGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--


ARA.TH_F      T-CCGATC---TCAT-ATGAACCACCATTTT
GAL.GAL.      -CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#576

Mean pairwise ID: 33.23%


HUM.LU_D      GAC-GGGCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


HUM.LU_D      ACT--TTG--GGTCAAC---CTAGTG-GATC--GGGTCCAGTGTTAGCTGCTTACTGGTC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


HUM.LU_D      -TGCCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCT-GGGTTGCGCAG
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


HUM.LU_D      CTCCT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


HUM.LU_D      TCTCGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


HUM.LU_D      GGG-CTGACT--CTTAA-TAGGACCATTTCTTTT
DRO.MEL.      ---CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#577

Mean pairwise ID: 33.23%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_H      T-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_H      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_H      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_H      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CC


LYC.ES_H      TTGCT---CCAA-TAAACAACCACCTTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#578

Mean pairwise ID: 33.23%


CIN.HYB.      ACC-GGGCTTGGTAACGCTAGTCTATAACTCAAG--TGAGGGTATCAAAGTGGTTGAACT
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


CIN.HYB.      --TTGA--GCTTGGC-TTAGCT-AGTTGGGTCTGTA-GACACCGCACCTGGCT-TGCCCG
TRY.BR_B      CGGGG-ACGTCTTGGA-CAAGCGGGG--GTTCTG-TTGCGTT----GACTTGGTG-TTC-


CIN.HYB.      TTCCAAGTCGAGAGTGGGTTCA-TGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTT-
TRY.BR_B      TGCTTGGTTGCGTGT-CGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-T


CIN.HYB.      AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCT-C
TRY.BR_B      AA-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTT


CIN.HYB.      GACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTGG-
TRY.BR_B      CCC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC-------TTTGCGC----C


CIN.HYB.      --CTAGC--CCAA-CAGGACACCCATTT
TRY.BR_B      CCAAG-TGT-CGTCGCG--AGGCGGTTT


[Download ClustalW]

#579

Mean pairwise ID: 33.23%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


HUM.LU_C      CT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


HUM.LU_C      CCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


HUM.LU_C      CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


HUM.LU_C      CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG---


HUM.LU_C      -CTGACT--CTTAA-TAGGACCATTTCTTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#580

Mean pairwise ID: 33.33%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_I      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_I      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_I      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_I      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_I      TTGCT---CCAA-TTAAACCACCATTTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#581

Mean pairwise ID: 33.33%


HUM.LU_B      ----GGCCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


HUM.LU_B      AC-A-TTG--GGTCAGC---CCAGTG-GATC--GGGTCCAGTGTTAGCTGCTTACTGGTC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


HUM.LU_B      -TGCCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAG
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


HUM.LU_B      CTCCT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


HUM.LU_B      TCCCGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTG
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-----CGTTAT-CAG-


HUM.LU_B      GTCCTGACT--CTTAA-TCGGACCATTTCCTTT
DRO.MEL.      --CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#582

Mean pairwise ID: 33.33%


ARA.TH_G      GTC-GAGCTATGTAACGAGAGCTTGTAACCCAAG-TGGGGACTATAAGATGGTGGAACAC
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


ARA.TH_G      --TG--GATCGGC--CCA-CG-GGTC---GGATTTGTTGTTGGCATAGGTCTGGAC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


ARA.TH_G      CCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT
TET.THE.      CCGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATT


ARA.TH_G      -AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
TET.THE.      AAAGA-GCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


ARA.TH_G      AGCAGTGGACGGACAACG-GTTCGACGCCAC--ACAAATCCACTATGGTCCGCTGGC--T
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-


ARA.TH_G      CGTAA-CCCGC-TTGAACCACCATTTT
TET.THE.      CTATCA---AAGCCA-GACATT-----


[Download ClustalW]

#583

Mean pairwise ID: 33.33%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


ZEA.MA_A      AATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGC
HOM.SA_A      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG----TAGTGC-GCTATGCC----GATCGG


ZEA.MA_A      T-TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG
HOM.SA_A      GTG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCA


ZEA.MA_A      -CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCC
HOM.SA_A      GGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ZEA.MA_A      GACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-
HOM.SA_A      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_A      CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
HOM.SA_A      CCAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#584

Mean pairwise ID: 33.33%


LYC.ES_B      GTC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_B      ATG--TTG--GGCTGTA---CCAGAT-GGTT--GGGCTTGGT--GGGCTAATTTCTGACT
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


LYC.ES_B      -TGCCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGA
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


LYC.ES_B      TTCGT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


LYC.ES_B      TCTAAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGAT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


LYC.ES_B      GG-GCTGCT---CTAA-TTAAACCACCACTTTT
DRO.MEL.      --CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#585

Mean pairwise ID: 33.33%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG--TGAGGGTATCAAAGTGGTTGAACT-
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT---TCGGGGGCT---AACCAGGCTT--AGC


CIN.HYB.      -TTGA--GCTTGGC-TTAGCT-AGTTGGGTCTGTA-GACACCGCACCTGGCT-TGCCCGT
LEI.MAJ.      GGGG-AGGACGTGGA-CCAGCGAGGGTGATTTG-CTGCGTT----GACGTGGTG-CTC-T


CIN.HYB.      TCCAAGTCGAGAGTGGGTTCA-TGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT-TT-
LEI.MAJ.      GCTTGGCTGTGTGT-CGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGT


CIN.HYB.      AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCT-C
LEI.MAJ.      TGAA-GCGAGGGAACCGGGTCAGGCCGGAA--ACGGAGCAGCCCA-CCCC-ACGCACGTC


CIN.HYB.      GACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTGG-
LEI.MAJ.      CGCCGTTGCAGAATC-ACACCGCG--GA-GCATGTCC--------GCACTTGAGC----C


CIN.HYB.      --CTAGC-CCAA-CAGGACACCCATTT
LEI.MAJ.      CCACGCTT-CGTCGCG--AAGCCTT--


[Download ClustalW]

#586

Mean pairwise ID: 33.33%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAATGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_N      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_N      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_N      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_N      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_N      TTGCT---CCAA-TTAAACCACCATTTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#587

Mean pairwise ID: 33.33%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


ZEA.MA_A      AATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGC
HOM.SA_B      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG----TAGTGC-GCTATGCC----GATGGG


ZEA.MA_A      T-TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG
HOM.SA_B      GTG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCA


ZEA.MA_A      -CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCC
HOM.SA_B      GGTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ZEA.MA_A      GACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-
HOM.SA_B      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_A      CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
HOM.SA_B      CCAG-CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#588

Mean pairwise ID: 33.33%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-----TGGGGGCAACAATGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_F      TG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-TG
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC-----GACCGAGCG-


LYC.ES_F      CCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCT
CAE.EL_C      TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTG


LYC.ES_F      TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT
CAE.EL_C      CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCG


LYC.ES_F      GTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATA
CAE.EL_C      GTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG---------TATACACAG-


LYC.ES_F      G-GTTGCC----TAA-TTAAACCATCACTTTT-
CAE.EL_C      -CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#589

Mean pairwise ID: 33.33%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_B      C-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.LU_B      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.LU_B      T-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCC
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.LU_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTCC
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG------TATACACAG---CC


HUM.LU_B      TGACT--CTTAA-TCGGACCATTTCCTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#590

Mean pairwise ID: 33.33%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAGATGGGA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


HUM.JA_A      CT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.JA_A      CCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.JA_A      T-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTC
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.JA_A      GGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-T
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG------TATACACAG---CC


HUM.JA_A      GCACT--CTTAA-TCAGACCATCTCTTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#591

Mean pairwise ID: 33.33%


XEN.LAE.      GCC-GGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGC-TTGGGCTGTCGGAT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT------CGTGTGGCATAAACAATGT---A


XEN.LAE.      CGCTTGAGTCCAGGAGTTCTGGGCTG-----CACTGA-GCTATGTCGATCGGGTGTCCGC
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGT


XEN.LAE.      ACTAAGTTCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAA
TET.ROS.      TCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCA-TTAAA


XEN.LAE.      GGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGT
TET.ROS.      GAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGT


XEN.LAE.      AGTGGGATCGCGCCTGTGA-ATAGC--CGGTG---CAGAACAG----CCTGAACAACACA
TET.ROS.      GGAAGGATAACATACTCA-TTAACTGTCAA--GCTAAT-CG-GTTCTG-CTATTC----T


XEN.LAE.      GCGAGACACAGTTCT
TET.ROS.      GATCAGACACT----


[Download ClustalW]

#592

Mean pairwise ID: 33.43%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_D      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


HUM.LU_D      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.LU_D      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.LU_D      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACTGGG-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG---C


HUM.LU_D      CTGACT--CTTAA-TAGGACCATTTCTTTT--
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#593

Mean pairwise ID: 33.43%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_E      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_E      CCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_E      T-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_E      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAG--C


LYC.ES_E      GCTGTT---CTAG-TTAAACTACCACATTTT-
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#594

Mean pairwise ID: 33.43%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_E      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_E      CCCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_E      CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_E      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTAG--


LYC.ES_E      -GCTGTT---CTAG-TTAAACTACCACATTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC--


[Download ClustalW]

#595

Mean pairwise ID: 33.43%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_D      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


HUM.LU_D      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.LU_D      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.LU_D      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACTGGG-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG---C


HUM.LU_D      CTGACT--CTTAA-TAGGACCATTTCTTTT--
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#596

Mean pairwise ID: 33.43%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGCGCG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


ZEA.MA_B      GATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT
RAT.RAT.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_B      -TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-
RAT.RAT.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAG


ZEA.MA_B      CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
RAT.RAT.      GTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCC


ZEA.MA_B      CACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-
RAT.RAT.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_B      CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
RAT.RAT.      CCAGCCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#597

Mean pairwise ID: 33.43%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG------CGGGGGCATTAAGGTGGTGTG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


ZEA.MA_F      GATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC
RAT.NOR.      GGATCGATT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_F      -TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TT
RAT.NOR.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_F      AGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
RAT.NOR.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_F      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--C
RAT.NOR.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_F      AGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
RAT.NOR.      CAG-CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#598

Mean pairwise ID: 33.43%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG-----CGGGGGCAATAAGGTGGTGTTG
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT--


ORY.SA_B      GATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC
CAE.EL_D      GGATGGAGT--GAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC---GACCGAG


ORY.SA_B      -CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCC
CAE.EL_D      CG-TCCGTGCCAAGCGC-TACGT--CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCC


ORY.SA_B      TGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCC
CAE.EL_D      GGGTGCATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACC


ORY.SA_B      GCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-C
CAE.EL_D      GCGTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACA


ORY.SA_B      -AAGT-GCCTTC---CATG-GCAGACCACCACCTTT--
CAE.EL_D      CAG--CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#599

Mean pairwise ID: 33.43%


LYC.ES_N      GTT-GAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAATGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_N      ATG--TTG--GGCTGTA---CCAGAT-GGTTG-GGCTTGGT--GGGCTAATTTCTGACT-
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAAC


LYC.ES_N      TGCCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGAT
DRO.MEL.      G-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


LYC.ES_N      TCGT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


LYC.ES_N      CTAAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATG
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG-


LYC.ES_N      G-GTTGCT---CCAA-TTAAACCACCATTTTT
DRO.MEL.      -CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#600

Mean pairwise ID: 33.43%


ZEA.MA_F      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCTAAG-CGGGGGCATTAAGGTGGTGTGGATG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


ZEA.MA_F      T-TTCC--TGACGGA---TTCTG-GGCCT--GGGCTTGT-ATGTGCCACTGGCCGGCC-T
TET.THE.      GTT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG


ZEA.MA_F      GCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTAG
TET.THE.      -CCCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGC


ZEA.MA_F      ACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGC
TET.THE.      A-TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACT-TGCCGC


ZEA.MA_F      TTCCAACGGTGGGAGGATAACA-GGCCGCTGCATT--GCAAGCCCAACTCGGTC-CAGAG
TET.THE.      TTGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-GT


ZEA.MA_F      ----CC-TCA-TTAA-ACAGACCACCATCTTT
TET.THE.      TCTA-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#601

Mean pairwise ID: 33.43%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG------TGAGGGTATCAAAGTGGTTGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


CIN.HYB.      ACT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-T
HOM.SA_B      GATCGCTT-GAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG


CIN.HYB.      GCCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGC
HOM.SA_B      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


CIN.HYB.      TTT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCT
HOM.SA_B      GCCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTG


CIN.HYB.      CTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCT
HOM.SA_B      CTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG


CIN.HYB.      GG--CTAGC---CCAA-CAGGACACCCATTT-
HOM.SA_B      --CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#602

Mean pairwise ID: 33.43%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG-----TGGAGACAATAAGGGGATGGGA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_C      CG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_C      CCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


ARA.TH_C      T-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTT
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


ARA.TH_C      GACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAAG
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG---


ARA.TH_C      --CCGCT---CCGA-TTGGACCATCACTTT--
CAE.EL_B      CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#603

Mean pairwise ID: 33.43%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG------CGGGGGCATTAAGGTGGTGTG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


ZEA.MA_F      GATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC
ORI.CUN.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC----GATCGGG


ZEA.MA_F      -TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TT
ORI.CUN.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_F      AGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
ORI.CUN.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_F      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--C
ORI.CUN.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_F      AGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
ORI.CUN.      CAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#604

Mean pairwise ID: 33.53%


ZEA.MA_B      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGCGCG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ZEA.MA_B      GATGC-TTTG--CGATGGT----TTCTG-GGCCT-GGGCTCGT--TGTGACTCTAGCCGG
DRO.MEL.      -GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGG


ZEA.MA_B      CT-TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCT
DRO.MEL.      AACG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCC-GTGGCATTC


ZEA.MA_B      G-CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCG
DRO.MEL.      AGGTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGT-T


ZEA.MA_B      CCCACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGAC
DRO.MEL.      CCCGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTT


ZEA.MA_B      C-CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
DRO.MEL.      AT-CAGCCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#605

Mean pairwise ID: 33.53%


ZEA.MA_A      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ZEA.MA_A      AATGC-TTTG--CGATGGCT---TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGG
DRO.MEL.      -GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGG


ZEA.MA_A      CT-TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCT
DRO.MEL.      AACG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCC-GTGGCATTC


ZEA.MA_A      G-CAGACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGC
DRO.MEL.      AGGTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTC


ZEA.MA_A      CGACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT
DRO.MEL.      CCGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTA


ZEA.MA_A      -CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
DRO.MEL.      T-CAG-CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#606

Mean pairwise ID: 33.53%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


HUM.LU_A      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.LU_A      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.LU_A      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.LU_A      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACTAGG-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


HUM.LU_A      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#607

Mean pairwise ID: 33.53%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G


ZEA.MA_G      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
CAE.BRI.      GATGGAGT-GAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC----GACCGAGC


ZEA.MA_G      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
CAE.BRI.      G-TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGG


ZEA.MA_G      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGC
CAE.BRI.      CG-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGC


ZEA.MA_G      TTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAG
CAE.BRI.      GCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCACA


ZEA.MA_G      AG-CC-TCA---CTAA-GCAGACCACCATCTTT-
CAE.BRI.      G-CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#608

Mean pairwise ID: 33.53%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_C      CT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.LU_C      CCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.LU_C      T-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.LU_C      GGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


HUM.LU_C      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#609

Mean pairwise ID: 33.54%


ARA.TH_C      GTC-GAACTCAGTAACGCGGGCTTGTGATCCAAG-TGGAGACAATAAGGGGATGGGACG-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


ARA.TH_C      -TTG-GGTCGAT-CTCATTG-GGCC---GGGTTCGGGTTGGGCTATATTCTGGCC-CGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


ARA.TH_C      CATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTCT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


ARA.TH_C      -AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTTG
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


ARA.TH_C      ACGGTGGAAGGATTACG-GGCCATTGCCT---TCCGAGCCCACTATGACCCAATAAG--C
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GTTCTGC


ARA.TH_C      CGCT-CCGA-TTGGACCATCACTTT
TET.ROS.      TATTC--TGATCA-GACACT-----


[Download ClustalW]

#610

Mean pairwise ID: 33.63%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G


ZEA.MA_C      ATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TG
CAE.BRI.      GATGGAGTGAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC---GACCGAGCG-


ZEA.MA_C      CCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGG
CAE.BRI.      TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGC-TGGCGGTCCCGGGC


ZEA.MA_C      ACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCT
CAE.BRI.      G-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCG


ZEA.MA_C      ATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAGA
CAE.BRI.      CGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCACAG


ZEA.MA_C      CTTC-ATA---CTAAAGCAGACCACCATTTTT-
CAE.BRI.      -CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#611

Mean pairwise ID: 33.63%


LYC.ES_A      GGC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_A      ATA--TTG--GGCTTTA---CCAGAA-GGTT--GGGCTTGGT--GGGCTTAGTTCTGGCC
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGGAA


LYC.ES_A      -TGCCCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGA
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGG


LYC.ES_A      TTCCT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGC
DRO.MEL.      TTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGT


LYC.ES_A      TCTGTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAAT
DRO.MEL.      GGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG


LYC.ES_A      GG-GTTGCT---CCAA--TAAACAACCACCTTT
DRO.MEL.      --CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#612

Mean pairwise ID: 33.63%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG-----TGAGGGTATCAAAGTGGTTGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


CIN.HYB.      CT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-TG
CAE.BRI.      ATGGAGT-GAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-


CIN.HYB.      CCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT
CAE.BRI.      TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCG


CIN.HYB.      TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTC
CAE.BRI.      CATAAGG-AGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGC


CIN.HYB.      TCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTG
CAE.BRI.      GGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCACAG-


CIN.HYB.      G--CTAGC---CCAA-CAGGACACCCATTT---
CAE.BRI.      -CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#613

Mean pairwise ID: 33.63%


ORY.SA_B      GCC-GAGCCAGGTAGCGTTGGCTTGTCACCCGAG-CGGGGGCAATAAGGTGGTGTTGGAT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT----A


ORY.SA_B      GC-CTGGTC-GTTTGCG---CTTGG-GGTCT--GCGCCTGTGGTTTGCACTATGCGGCC-
TET.THE.      GGTT----GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT---AAGAGTGT


ORY.SA_B      CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCCT
TET.THE.      G-CCCGCTCCAAACAA-TGAGT--TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAG


ORY.SA_B      GCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCG
TET.THE.      GGCATTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCG


ORY.SA_B      CTTCCAACGGTGGAAGGATAACG-GGCCGCTGCAGC--CCTGGCCCGCTTCCGGCCC-AA
TET.THE.      CTTGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-G


ORY.SA_B      GT---GCCTTC-CATG-GCAGACCACCACCTTT
TET.THE.      TTCTA-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#614

Mean pairwise ID: 33.64%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_H      AT-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_H      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_H      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_H      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--C


LYC.ES_H      GTTGCT---CCAA-TAAACAACCACCTTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#615

Mean pairwise ID: 33.64%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAATGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_N      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_N      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_N      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_N      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_N      GTTGCT---CCAA-TTAAACCACCATTTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#616

Mean pairwise ID: 33.64%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_I      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_I      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_I      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_I      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--C


LYC.ES_I      GTTGCT---CCAA-TTAAACCACCATTTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#617

Mean pairwise ID: 33.64%


LYC.ES_I      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA-TGGGGGCATTAATGTGGTGGAATG-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_I      -TTG-GGCTGTA--CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGACT-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_I      CTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_I      -AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTAA
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_I      GCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCCTGATGG---G
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA------GCTAATCG-GTTCTG-


LYC.ES_I      TTGCT-CCAA-TTAAACCACCATTTTT
TET.ROS.      CTATTC--TGATCA-GACACT------


[Download ClustalW]

#618

Mean pairwise ID: 33.64%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_B      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_B      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_B      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTA
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_B      AGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-G
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_B      CTGCT---CTAA-TTAAACCACCACTTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#619

Mean pairwise ID: 33.64%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAATGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_N      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_N      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_N      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_N      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_N      GTTGCT---CCAA-TTAAACCACCATTTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#620

Mean pairwise ID: 33.72%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG------CGGGGGCACTAAAGGTGGCTG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC----TGAGGACAGA


ORY.SA_A      CGGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGC
RAT.RAT.      --GGATCGCTT--GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC--GATCGG


ORY.SA_A      T-TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGC
RAT.RAT.      GTG-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCA


ORY.SA_A      TTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCAC
RAT.RAT.      GGTTG-----CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAA


ORY.SA_A      TGCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTG
RAT.RAT.      CTCCCGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------


ORY.SA_A      GCC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
RAT.RAT.      CACTCCAG--CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#621

Mean pairwise ID: 33.73%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_A      CAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


ARA.TH_A      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTC
CAE.EL_D      CCGTGCCAAGCGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


ARA.TH_A      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.EL_D      ATAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTG


ARA.TH_A      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG-
CAE.EL_D      GTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--C


ARA.TH_A      TCCGAT---CTCATATGAACCACCATTTT---
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#622

Mean pairwise ID: 33.73%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG-----CGGGGGCATTAAGGTGGTGTGG
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G


ZEA.MA_F      ATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-
CAE.BRI.      GATGGAGT-GAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC----GACCGAGC


ZEA.MA_F      TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTA
CAE.BRI.      G-TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGG


ZEA.MA_F      GACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
CAE.BRI.      CG-CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGC-CACCG


ZEA.MA_F      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--CA
CAE.BRI.      CGCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCAC


ZEA.MA_F      GAG-CC-TCA---TTAA-ACAGACCACCATCTTT-
CAE.BRI.      AG-CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#623

Mean pairwise ID: 33.73%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGCGCG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


ZEA.MA_B      GATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT
CAN.SPE.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GATCGGG


ZEA.MA_B      -TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-
CAN.SPE.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAG


ZEA.MA_B      CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
CAN.SPE.      GTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCC


ZEA.MA_B      CACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-
CAN.SPE.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_B      CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
CAN.SPE.      CCAGCCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#624

Mean pairwise ID: 33.73%


ZEA.MA_C      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ZEA.MA_C      GATGC-TTG---GTACCGT---GTCTT-TGCCT-GGGTTCATGGTGTGCCTTTGTTGGCC
DRO.MEL.      -GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT---GACGGAA


ZEA.MA_C      -TGCCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-T
DRO.MEL.      CG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCC-GTGGCATTCAG


ZEA.MA_C      TGGACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCG
DRO.MEL.      GTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCC


ZEA.MA_C      GCTATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-T
DRO.MEL.      GTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT-


ZEA.MA_C      AGACTTC-ATA---CTAAAGCAGACCACCATTTTT
DRO.MEL.      CAG-CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#625

Mean pairwise ID: 33.73%


LYC.ES_K      GTT-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_K      ATA--TTG--GGCTTTA---CCAGAA-GGTTG-GGCTTGGT--GGGCTTAGTTCTGGCC-
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAAC


LYC.ES_K      TGCCCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGAT
DRO.MEL.      G-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


LYC.ES_K      TCCT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


LYC.ES_K      CTGTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATG
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG-


LYC.ES_K      G-GTTGCT---CCAA--TAAACAACCACCTTT
DRO.MEL.      -CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#626

Mean pairwise ID: 33.74%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


ARA.TH_A      CAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


ARA.TH_A      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTC
FUG.RUB.      CCGTACTAAGTTCGGTATCGATAT-GGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


ARA.TH_A      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
FUG.RUB.      CTAAGG-AGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCC


ARA.TH_A      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG-
FUG.RUB.      GCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--C


ARA.TH_A      TCCGAT---CTCATATGAACCACCATTTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT


[Download ClustalW]

#627

Mean pairwise ID: 33.74%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG-----TGGGGACTATAAGATGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


ARA.TH_G      CAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


ARA.TH_G      CCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT
FUG.RUB.      CCGTACTAAGTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCC


ARA.TH_G      -AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
FUG.RUB.      TAAGG-AGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


ARA.TH_G      AGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC-
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA---C


ARA.TH_G      TCGTAA--CCCGC-TTGAACCACCATTTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT


[Download ClustalW]

#628

Mean pairwise ID: 33.77%


CAE.EL_D      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.EL_D      GAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAG
TRY.BR_A      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.EL_D      CGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTC
TRY.BR_A      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.EL_D      GTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTG-GTGCAGTGGCCG
TRY.BR_A      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAG


CAE.EL_D      GACCGCGCTTGTAAGTTGA--CACA-CATACACAG-CCTTCTCGATACCTTCAGACCACT
TRY.BR_A      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.EL_D      TATCATTT
TRY.BR_A      G-------


[Download ClustalW]

#629

Mean pairwise ID: 33.83%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG-----CGGGGGCAATAAGGTGGTGTTG
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT--


ORY.SA_B      GATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC
CAE.EL_B      GGATGGAGT--GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC---GACCGAG


ORY.SA_B      -CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCC
CAE.EL_B      CG-TCCGTGCCAAGCGC-TGCGT--CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCC


ORY.SA_B      TGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCC
CAE.EL_B      GGGTGCATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACC


ORY.SA_B      GCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-C
CAE.EL_B      GCGCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACA


ORY.SA_B      -AAGT-GCCTTC---CATG-GCAGACCACCACCTTT-
CAE.EL_B      CAG--CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#630

Mean pairwise ID: 33.84%


HUM.LU_C      ----GGTCTTAGCAACTTGGTCCTGTAACCCAAG-TGGGGGCATGTGGGAAATGGAACT-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


HUM.LU_C      -TTG--GGTCAAC--CCAGTG-GTNC---GGGNCCAGTGCTAGCTGCTTACCCGGC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


HUM.LU_C      CCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


HUM.LU_C      T-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


HUM.LU_C      GGCAGTGGAAGGATAACG-GGCCGGTGCGCC--TTGAGCCAACACTGTTCAACTGGG--C
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-


HUM.LU_C      TGACT-CTTAA-TAGGACCATTTCTTTT
TET.THE.      CTATCA---AAGCCA-GACATT------


[Download ClustalW]

#631

Mean pairwise ID: 33.84%


TRI.AE_B      NCC-GAGCT-AGTTGCGGGAGCTTGTCACCCATG-----TGGGGGCATTGAGGCGGTGTG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


TRI.AE_B      GATGC-TTG--GTGCGGT----TTGTT-GGCCT-GGGCTTGTGATGTAACCTTGCTGGCC
DRO.MEL.      -GATGGCCTGAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT---GACGGAA


TRI.AE_B      -TGCCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGG
DRO.MEL.      CG-TCCGCACTAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


TRI.AE_B      C-CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


TRI.AE_B      TCCAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT-CAG


TRI.AE_B      -CCCCGC--CAT-A-GCAGACCACCATCTTT
DRO.MEL.      CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#632

Mean pairwise ID: 33.84%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


HUM.LU_D      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.LU_D      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.LU_D      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.LU_D      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACTGGG-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


HUM.LU_D      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#633

Mean pairwise ID: 33.84%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_K      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_K      CCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_K      T-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_K      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CC


LYC.ES_K      TTGCT---CCAA--TAAACAACCACCTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#634

Mean pairwise ID: 33.84%


ARA.TH_E      GTC-GAGCTAAGTAACATGAGCTTGTAACCCATG--TGGGGACATTTAGATGGTGGAACA
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---TCGGGGGCT---GATCCCGCTT--AG


ARA.TH_E      C--TG--GTTCGGG-TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGCCCA
TRY.BR_B      CGGGGACGTCTTGGA-CAAGCGGGG--GTTCTG-T-TGCGTT----GACTTGGTG-TTC-


ARA.TH_E      GTCCAAGCTGTGAGTAAGACG-TGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT-A
TRY.BR_B      TGCTTGGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TA


ARA.TH_E      AAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA-CA
TRY.BR_B      A-A-GTGGGGGGAACGGGTCAGGCCGGTG--ACGGAGCAGCCCA-CCTT-GCGCACGTTC


ARA.TH_E      GCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT--
TRY.BR_B      CC-GTTGCAGAAGC-ACACCGAG--GA-GCATCTCAGGAC------TTTGCGC-----CC


ARA.TH_E      CCGATC--TCAT-ATGAACCACCATTTT
TRY.BR_B      CAAG-TGT-CGTCGCG--AGGCGGTTT-


[Download ClustalW]

#635

Mean pairwise ID: 33.93%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


ZEA.MA_C      GATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-T
ORI.CUN.      GGATCGCTTGAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC---GATCGGGTG


ZEA.MA_C      GCCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTG
ORI.CUN.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGT


ZEA.MA_C      GACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGC
ORI.CUN.      TG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT


ZEA.MA_C      TATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAG
ORI.CUN.      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCA


ZEA.MA_C      ACTTC-ATA---CTAAAGCAGACCACCATTTTT
ORI.CUN.      G-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#636

Mean pairwise ID: 33.93%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


ZEA.MA_C      GATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-T
RAT.NOR.      GGATCGATTGAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGTG


ZEA.MA_C      GCCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTG
RAT.NOR.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGT


ZEA.MA_C      GACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGC
RAT.NOR.      TG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT


ZEA.MA_C      TATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAG
RAT.NOR.      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCA


ZEA.MA_C      ACTTC-ATA---CTAAAGCAGACCACCATTTTT
RAT.NOR.      G-CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#637

Mean pairwise ID: 33.94%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


ARA.TH_A      ACAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_A      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT
ORI.CUN.      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
ORI.CUN.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_A      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
ORI.CUN.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_A      -TCCGAT---CTCATATGAACCACCATTTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#638

Mean pairwise ID: 33.94%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG-----TGGGGGCATTGAGGCGGTGTGG
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


TRI.AE_B      ATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TG
CAE.EL_D      GATGGAGTGAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC---GACCGAGCG-


TRI.AE_B      CCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-C
CAE.EL_D      TCCGTGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


TRI.AE_B      T-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCC
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


TRI.AE_B      AACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-CC
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAGCCT


TRI.AE_B      CCGC--CAT-A-GCAGACCACCATCTTT--
CAE.EL_D      TCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#639

Mean pairwise ID: 33.94%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_I      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_I      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_I      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_I      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_I      TTGCT---CCAA-TTAAACCACCATTTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#640

Mean pairwise ID: 33.94%


HUM.LU_C      ----GGTCTTAGCAACTTGGTCCTGTAACCCAAG-TGGGGGCATGTGGGAAATGGAACT-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


HUM.LU_C      -TTG-GGTCAAC--CCAGTG-GTNC---GGGNCCAGTGCTAGCTGCTTACCCGGC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


HUM.LU_C      CATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCCT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


HUM.LU_C      -AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCG
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


HUM.LU_C      GCAGTGGAAGGATAACG-GGCCGGTGCGCC--TTGAGCCAACACTGTTCAACTGGG--CT
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-C


HUM.LU_C      GACT-CTTAA-TAGGACCATTTCTTTT
TET.ROS.      TATTC---TGATCA-GACACT------


[Download ClustalW]

#641

Mean pairwise ID: 33.94%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAATGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_N      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_N      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_N      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_N      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_N      GTTGCT---CCAA-TTAAACCACCATTTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#642

Mean pairwise ID: 33.94%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG------TGGGGACATTTAGATGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


ARA.TH_E      ACAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


ARA.TH_E      CCCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTC
GAL.GAL.      TCCGCGCTAAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGC


ARA.TH_E      T-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA
GAL.GAL.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


ARA.TH_E      CAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG---


ARA.TH_E      -CCGATC---TCAT-ATGAACCACCATTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#643

Mean pairwise ID: 33.94%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


ARA.TH_A      ACAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_A      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT
CAN.SPE.      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
CAN.SPE.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_A      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
CAN.SPE.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_A      -TCCGAT---CTCATATGAACCACCATTTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#644

Mean pairwise ID: 33.94%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


LYC.ES_B      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


LYC.ES_B      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


LYC.ES_B      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTA
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


LYC.ES_B      AGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-G
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--CC


LYC.ES_B      CTGCT---CTAA-TTAAACCACCACTTTT-
CAE.BRI.      TCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#645

Mean pairwise ID: 33.94%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_K      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_K      CCCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_K      CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_K      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--C


LYC.ES_K      GTTGCT---CCAA--TAAACAACCACCTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#646

Mean pairwise ID: 33.94%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG------TGGGGACAATAAGGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


ARA.TH_D      ACAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_D      CCCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_D      T-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA
ORI.CUN.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_D      CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_D      -TCGATC---TCTC-CTGGACCACCACTTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#647

Mean pairwise ID: 33.94%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


ARA.TH_A      CAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


ARA.TH_A      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT-
XEN.LAE.      CCGCACTAAGTTCGGTATCAATAT-GGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
XEN.LAE.      TCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGC


ARA.TH_A      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
XEN.LAE.      CGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--


ARA.TH_A      -TCCGAT---CTCATATGAACCACCATTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT-


[Download ClustalW]

#648

Mean pairwise ID: 33.94%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAATGTGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_N      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_N      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_N      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_N      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_N      TTGCT---CCAA-TTAAACCACCATTTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#649

Mean pairwise ID: 33.96%


TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A
ZEA.MA_H      NCC-GAGCTCTGTAGCGAGTGCTTGTAACCCGAG-CGGGGGCAATAAGGTAGTGTGGATG


TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-
ZEA.MA_H      T-CAAT-TGT-GGT---GCATG-TGCCT--GGGTCTA--GTGCTACAAACTGTGGAC-CA


TET.ROS.      CCCGTTCCAAACAG-TGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGC
ZEA.MA_H      CCCATTCCAAGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAAC


TET.ROS.      ATTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTT
ZEA.MA_H      ACT-AAAGTGGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCA


TET.ROS.      ATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCGGTTCTG
ZEA.MA_H      CCAGCGGTGGAAGGATAATG-AGTCGCTATGCT--ATAGGCCCAAT--------------


TET.ROS.      CTATTCTGATCAGACACT
ZEA.MA_H      ------------------


[Download ClustalW]

#650

Mean pairwise ID: 33.97%


XEN.LAE.      GCC-GGGCGCTGTGGCGTGTGCCTGTAATCCAGCTACTTGGAGGC-TTGGGCTGTCGGAT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA------TATGTGGCATAAACAATGT--AG


XEN.LAE.      CGCTTGAGTCCAGGAGTTCTGGGCTG-----CACTGA-GCTATGTCGATCGGGTGTCCGC
TET.THE.      GTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGC


XEN.LAE.      ACTAAGTTCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCTCTAA
TET.THE.      TCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCA-TTAAA


XEN.LAE.      GGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACCCCCGTGCCGATCAGT
TET.THE.      GAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGT


XEN.LAE.      AGTGGGATCGCGCCTGTGA-ATAGC--CGGTG---CAGAACAG----CCTGAACAACACA
TET.THE.      GGAAGGATAACATACTCA-TTAACTGTCAA--ACTAAT-CG-GTTCTA-CTATCA----A


XEN.LAE.      GCGAGACACAGTTCT
TET.THE.      AGCCAGACATT----


[Download ClustalW]

#651

Mean pairwise ID: 34.02%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG------CGGGGGCACTAAAGGTGGCTG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC----TGAGGCAGGA


ORY.SA_A      CGGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGC
CAN.SPE.      --GGATCGCTT--GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC--GATCGG


ORY.SA_A      T-TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGC
CAN.SPE.      GTG-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCA


ORY.SA_A      TTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCAC
CAN.SPE.      GGTTG-----CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAA


ORY.SA_A      TGCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTG
CAN.SPE.      CTCCCGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------


ORY.SA_A      GCC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
CAN.SPE.      CACTCCAG--CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#652

Mean pairwise ID: 34.02%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG-----CGGGGGCAATAAGGTGGTGTTG
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT--


ORY.SA_B      GATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC
CAE.EL_A      GGATGGAGT--GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC---GACCGAG


ORY.SA_B      -CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCC
CAE.EL_A      CG-TCCGTGCCAAGCGC-TACGT--CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCC


ORY.SA_B      TGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCC
CAE.EL_A      GGGTGCATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACC


ORY.SA_B      GCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-C
CAE.EL_A      GCGTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACG


ORY.SA_B      -AAGT-GCCTTC---CATG-GCAGACCACCACCTTT--
CAE.EL_A      CAG--CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#653

Mean pairwise ID: 34.03%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGCGCG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


ZEA.MA_B      GATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT
HOM.SA_B      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATGGGG


ZEA.MA_B      -TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-
HOM.SA_B      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAG


ZEA.MA_B      CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
HOM.SA_B      GTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCC


ZEA.MA_B      CACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-
HOM.SA_B      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_B      CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
HOM.SA_B      CCAGCCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#654

Mean pairwise ID: 34.03%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


ZEA.MA_E      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
RAT.NOR.      GGATCGATT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_E      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
RAT.NOR.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_E      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCG
RAT.NOR.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_E      GCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
RAT.NOR.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_E      AGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
RAT.NOR.      CAG-CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#655

Mean pairwise ID: 34.03%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG------CGGGGGCATTAAGGTGGTGTG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


ZEA.MA_F      GATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC
RAT.RAT.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_F      -TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TT
RAT.RAT.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_F      AGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
RAT.RAT.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_F      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--C
RAT.RAT.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_F      AGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
RAT.RAT.      CAG-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#656

Mean pairwise ID: 34.03%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


ZEA.MA_E      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
ORI.CUN.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC----GATCGGG


ZEA.MA_E      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
ORI.CUN.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_E      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCG
ORI.CUN.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_E      GCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
ORI.CUN.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_E      AGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
ORI.CUN.      CAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#657

Mean pairwise ID: 34.03%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGCGCG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


ZEA.MA_B      GATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT
HOM.SA_A      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_B      -TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-
HOM.SA_A      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAG


ZEA.MA_B      CAGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
HOM.SA_A      GTTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCC


ZEA.MA_B      CACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-
HOM.SA_A      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ZEA.MA_B      CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
HOM.SA_A      CCAGCCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#658

Mean pairwise ID: 34.04%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_E      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_E      CCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_E      T-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_E      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAG--C


LYC.ES_E      GCTGTT---CTAG-TTAAACTACCACATTTT-
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#659

Mean pairwise ID: 34.04%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_A      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


HUM.LU_A      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.LU_A      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.LU_A      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACTAGG-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG---C


HUM.LU_A      CTGACT--CTTAA-TAGGACCATTTCTTTT--
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#660

Mean pairwise ID: 34.04%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG-----TGGGGGCATTGAGGCGGTGTGG
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G


TRI.AE_B      ATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TG
CAE.EL_C      GATGGAGTGAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC---GACCGAGCG-


TRI.AE_B      CCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-C
CAE.EL_C      TCCGTGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


TRI.AE_B      T-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCC
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


TRI.AE_B      AACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-CC
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAGCCT


TRI.AE_B      CCGC--CAT-A-GCAGACCACCATCTTT-
CAE.EL_C      TCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#661

Mean pairwise ID: 34.04%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


ARA.TH_F      CAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


ARA.TH_F      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTC
CAE.BRI.      CCGTGCCAAGCGCTGCGTCGCCAG-GGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


ARA.TH_F      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.BRI.      ATAAGG-AGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCG


ARA.TH_F      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
CAE.BRI.      GTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG---


ARA.TH_F      -CCGATC---TCAT-ATGAACCACCATTTT--
CAE.BRI.      CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#662

Mean pairwise ID: 34.04%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGG
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G


ZEA.MA_C      ATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TG
FUG.RUB.      GATCGCTTGAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC---GATCGGGTG-


ZEA.MA_C      CCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGG
FUG.RUB.      TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCC-GGGATCACCAGGTC


ZEA.MA_C      ACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCT
FUG.RUB.      G-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTG


ZEA.MA_C      ATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAGA
FUG.RUB.      CCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCAA


ZEA.MA_C      CTTC-ATA---CTAAAGCAGACCACCATTTTT
FUG.RUB.      -CCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#663

Mean pairwise ID: 34.04%


LYC.ES_J      GTC-GAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_J      ATA--TTG--GGCTTTA---CCAGAA-GGTTG-GGCTTGGT--GGGCTTAGTTCTGGCC-
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAAC


LYC.ES_J      TGCCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGAT
DRO.MEL.      G-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


LYC.ES_J      TCCT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


LYC.ES_J      CTGTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATG
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC------CGTTAT-CAG-


LYC.ES_J      G-GTTGCT---CCAA--TAAACAACCACCTTT
DRO.MEL.      -CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#664

Mean pairwise ID: 34.04%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_A      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


HUM.LU_A      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.LU_A      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.LU_A      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACTAGG-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG---C


HUM.LU_A      CTGACT--CTTAA-TAGGACCATTTCTTTT--
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#665

Mean pairwise ID: 34.05%


ARA.TH_D      GTC-GAGCTAAGTAACGAGAGCTTGTGACCCGAG-TGGGGACAATAAGGTGGTGGAACAG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


ARA.TH_D      --TG--GTTCAAT--TCCTCG-GGTC---GGACCTGATGCTGACATATATCTGAGC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


ARA.TH_D      CCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT
TET.THE.      CCGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATT


ARA.TH_D      -AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTAC
TET.THE.      AAAGA-GCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


ARA.TH_D      AGCAGTGGATGGATCATA-GTTCGAAGTCTC--TCAGATCCACTATGGCCCGCTGGT--T
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-


ARA.TH_D      CGATC-TCTC-CTGGACCACCACTTT
TET.THE.      CTATCA--AAGCCA-GACATT-----


[Download ClustalW]

#666

Mean pairwise ID: 34.07%


CAE.EL_A      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT-AGATAAGTGTGGAT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT------CGTGTGGCATAAACAATGT---A


CAE.EL_A      GGAGTGAGAGGAGGAGTCCTGTGTATG----TCGTTG-TCTACGTCGACCGAGCGTCCGT
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGT


CAE.EL_A      GCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAG
TET.ROS.      TCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAG


CAE.EL_A      GAGTCGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
TET.ROS.      AGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTG


CAE.EL_A      GCCGGACCGCGCTTGTGA-GTTGA--CACA--CATACGCAG----CCTTCTCGATACCTT
TET.ROS.      GAAGGATAACATACTCA-TTAACTGTCAA-GCTAAT-CG-GTTCTG-CTATTC----TGA


CAE.EL_A      CAGACCACTTATCATTT
TET.ROS.      TCAGACACT--------


[Download ClustalW]

#667

Mean pairwise ID: 34.12%


ORY.SA_A      GCC-GAGCTCAGTAGCGAGAGCCTGTAACCCAAG-CGGGGGCACTAAAGGTGGCTGCGGA
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC---ATAAACAATGT----


ORY.SA_A      TGT-TTGGTGTGGATTCTG-ATCCTG-GGCCC--CATGTTGTTGTAATC-TTGCTGGCT-
TET.THE.      AGGTT----GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT--AAGAGTGT


ORY.SA_A      TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTT
TET.THE.      G-CCCGCTCCAAACAA-TGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGG


ORY.SA_A      CTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTG
TET.THE.      GCA-----TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTT


ORY.SA_A      CCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTGCACC--TTGGGCCCGCTTCTGGCC
TET.THE.      GCCGCTTGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAAT


ORY.SA_A      CAGAGT---CCCTCT-ACAA--CAGACCACCATCTTT
TET.THE.      CG-GTTCTA-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#668

Mean pairwise ID: 34.13%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGCGCGG
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G


ZEA.MA_B      ATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT-
FUG.RUB.      GATCGCTT-GAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC----GATCGGGT


ZEA.MA_B      TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-C
FUG.RUB.      G-TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCC-GGGATCACCAGG


ZEA.MA_B      AGACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
FUG.RUB.      TCG-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGC-CCCC


ZEA.MA_B      ACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-C
FUG.RUB.      GTGCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTT


ZEA.MA_B      AGATCC-TCT---CTTA-GCAAACCACCATCTTT
FUG.RUB.      CAACCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#669

Mean pairwise ID: 34.13%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G


ZEA.MA_E      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
FUG.RUB.      GATCGCTT-GAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC----GATCGGGT


ZEA.MA_E      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
FUG.RUB.      G-TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGT


ZEA.MA_E      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGG
FUG.RUB.      CG-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGC-CCCCG


ZEA.MA_E      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
FUG.RUB.      TGCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTC


ZEA.MA_E      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
FUG.RUB.      AA-CCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#670

Mean pairwise ID: 34.14%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


HUM.LU_C      ACT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


HUM.LU_C      CCCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_C      CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_C      CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


HUM.LU_C      -CTGACT--CTTAA-TAGGACCATTTCTTTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#671

Mean pairwise ID: 34.14%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_A      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_A      CCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_A      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCTG
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_A      TGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CC


LYC.ES_A      TTGCT---CCAA--TAAACAACCACCTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#672

Mean pairwise ID: 34.14%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


ARA.TH_A      ACAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_A      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT
HOM.SA_A      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
HOM.SA_A      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_A      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
HOM.SA_A      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_A      -TCCGAT---CTCATATGAACCACCATTTT-
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#673

Mean pairwise ID: 34.14%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_J      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_J      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_J      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_J      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG--CC


LYC.ES_J      TTGCT---CCAA--TAAACAACCACCTTT--
CAE.EL_D      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#674

Mean pairwise ID: 34.14%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_G      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_G      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_G      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_G      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTAG--


LYC.ES_G      -GCTGCT---CCAA-TTAAACCACCACTTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#675

Mean pairwise ID: 34.14%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


HUM.LU_C      ACT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_C      CCCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_C      CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_C      CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


HUM.LU_C      -CTGACT--CTTAA-TAGGACCATTTCTTTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#676

Mean pairwise ID: 34.14%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG-----TGGGGACATTTAGATGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


ARA.TH_E      CAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


ARA.TH_E      CCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT
CAE.BRI.      CCGTGCCAAGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCA


ARA.TH_E      -AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTAC
CAE.BRI.      TAAGG-AGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


ARA.TH_E      AGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT-
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG---C


ARA.TH_E      CCGATC---TCAT-ATGAACCACCATTTT--
CAE.BRI.      CTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#677

Mean pairwise ID: 34.18%


CAE.EL_B      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT-AGATAAGTGTGGAT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT------CGTGTGGCATAAACAATGT---A


CAE.EL_B      GGAGTGAGAGGAGGAGTCCTGTGTATG----TCGTTG-TCAACGTCGACCGAGCGTCCGT
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGT


CAE.EL_B      GCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG
TET.ROS.      TCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAG


CAE.EL_B      GAGTGGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
TET.ROS.      AGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTG


CAE.EL_B      GCCGGACTGCGCTTGTGA-GTTGA--CACG--TATACACAG----CCTTCTCAATACCTT
TET.ROS.      GAAGGATAACATACTCA-TTAACTGTCAA-GCTAAT-CG-GTTCTG-CTATTC----TGA


CAE.EL_B      CAGACCACTTGTTTTT
TET.ROS.      TCAGACACT-------


[Download ClustalW]

#678

Mean pairwise ID: 34.20%


CAE.EL_C      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.EL_C      GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
TRY.BR_A      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.EL_C      CGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTG
TRY.BR_A      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.EL_C      GTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCG-GTGCAGTGGCCG
TRY.BR_A      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAG


CAE.EL_C      GACAGCGCTTGTGAGTTGA--CACG-TATACACAG-CCTTCTCAATACCTTCAGACCACT
TRY.BR_A      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.EL_C      TGTCACT
TRY.BR_A      G------


[Download ClustalW]

#679

Mean pairwise ID: 34.20%


CAE.EL_B      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.EL_B      GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
TRY.BR_A      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.EL_B      CGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTG
TRY.BR_A      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.EL_B      GTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCG-GTGCAGTGGCCG
TRY.BR_A      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAG


CAE.EL_B      GACTGCGCTTGTGAGTTGA--CACG-TATACACAG-CCTTCTCAATACCTTCAGACCACT
TRY.BR_A      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.EL_B      TGTTTTT
TRY.BR_A      G------


[Download ClustalW]

#680

Mean pairwise ID: 34.22%


TET.ROS.      GCCAGGGTAGCA-ATGCCTGTGACCT-CGTGTGGCATAAACAATGT-AGTTA--GAATAG
TRY.BR_B      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCT-GATCCCGCTTAGCGGGGACGTCTT


TET.ROS.      TCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGA
TRY.BR_B      GGA--CAAGCGGGG-----GTTCTG-T-TGCGTTGACTTGGTGTTC-TGCTTGGTTGCGT


TET.ROS.      GTTGCTAT-GGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAGGAAC
TRY.BR_B      GTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGGGGGGAA


TET.ROS.      CGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTA-TTGTGGTGGAAGGATAAC
TRY.BR_B      CGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAGAAGCAC


TET.ROS.      ATACTCA-TTAACTGTCAA--GCTAAT-CGGTTCTG-CTATTC--TGATCAGACACT---
TRY.BR_B      ACCGAGGA-GCATCTCAGGAC--TTTGCGC----CCCAAG-TGTCGTCGCG-AGGCGGTT


TET.ROS.      -
TRY.BR_B      T


[Download ClustalW]

#681

Mean pairwise ID: 34.23%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGG
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


ZEA.MA_C      ATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-TG
XEN.LAE.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC---GATCGGGTG-


ZEA.MA_C      CCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGG
XEN.LAE.      TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCT-CGGATCACCAGGTT


ZEA.MA_C      AC-CT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGC
XEN.LAE.      G-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGT


ZEA.MA_C      TATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAG
XEN.LAE.      GCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACA


ZEA.MA_C      ACTTC-ATA---CTAAAGCAGACCACCATTTTT
XEN.LAE.      G-CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#682

Mean pairwise ID: 34.23%


TET.ROS.      GCCAGGGTAGCA-ATGCCTGTGACCT-CGTGTGGCATAAACAATGT-AGTTA--GAATAG
TRY.BR_A      AGCCGGAGCGCATTGCTCTGTAACCTTCGGGGGCT-GATCCCGCTTAGCGGGGACGTCTT


TET.ROS.      TCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGA
TRY.BR_A      GGA--CAAGCGGGG-----GTTCTG-T-TGCGTTGACTTGGTGTTC-TGCTTGGTTGCGT


TET.ROS.      GTTGCTAT-GGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAGCTGAGGAAC
TRY.BR_A      GTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGGGGGGAA


TET.ROS.      CGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTA-TTGTGGTGGAAGGATAAC
TRY.BR_A      CGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAGAAGCAC


TET.ROS.      ATACTCA-TTAACTGTCAA--GCTAAT-CGGTTCTG-CTATTC--TGATCAGACACT-
TRY.BR_A      ACCGAGGA-GCATCTCAGGAC--TTTGCGC----CCCAAG-TGTCGTCGCG-AGGCGG


[Download ClustalW]

#683

Mean pairwise ID: 34.23%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-----TGGGGGCAACAATGTGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_F      TG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-TG
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC-----GACCGAGCG-


LYC.ES_F      CCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCT
CAE.EL_B      TCCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTG


LYC.ES_F      TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT
CAE.EL_B      CATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCG


LYC.ES_F      GTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATA
CAE.EL_B      GTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG---------TATACACAG-


LYC.ES_F      G-GTTGCC----TAA-TTAAACCATCACTTTT-
CAE.EL_B      -CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#684

Mean pairwise ID: 34.23%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_F      CAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


ARA.TH_F      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTC
CAE.EL_D      CCGTGCCAAGCGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


ARA.TH_F      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.EL_D      ATAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTG


ARA.TH_F      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
CAE.EL_D      GTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG---


ARA.TH_F      -CCGATC---TCAT-ATGAACCACCATTTT---
CAE.EL_D      CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#685

Mean pairwise ID: 34.23%


LYC.ES_G      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_G      ATG--TTG--GGCTGTA---CCAGAT-GGTTG-GGCTTGGT--GGGCTAATTTCTGGCC-
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAAC


LYC.ES_G      TGCCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGAT
DRO.MEL.      G-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


LYC.ES_G      TCCT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


LYC.ES_G      TTGTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGAT
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT-CAG


LYC.ES_G      GG-GCTGCT---CCAA-TTAAACCACCACTTTT
DRO.MEL.      --CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#686

Mean pairwise ID: 34.24%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_H      T-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_H      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_H      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_H      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_H      TTGCT---CCAA-TAAACAACCACCTTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#687

Mean pairwise ID: 34.24%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_J      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_J      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_J      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_J      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--C


LYC.ES_J      GTTGCT---CCAA--TAAACAACCACCTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#688

Mean pairwise ID: 34.24%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAATGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_N      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_N      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_N      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_N      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_N      GTTGCT---CCAA-TTAAACCACCATTTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#689

Mean pairwise ID: 34.24%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_B      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_B      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_B      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_B      AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_B      GCTGCT---CTAA-TTAAACCACCACTTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#690

Mean pairwise ID: 34.24%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_B      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_B      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_B      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_B      AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_B      GCTGCT---CTAA-TTAAACCACCACTTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#691

Mean pairwise ID: 34.24%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAATGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_N      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_N      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_N      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_N      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_N      GTTGCT---CCAA-TTAAACCACCATTTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#692

Mean pairwise ID: 34.24%


LYC.ES_E      GTC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG-TGGGGATGTTAAGGTGGTGGAATA-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_E      -TTG--GGCTGTC--CCAGAT-GGCTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_E      CCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_E      T-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_E      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCCTGATGG--
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA-------ACTAATCG-GTTCT


LYC.ES_E      -GCTGTT-CTAG-TTAAACTACCACATTTT
TET.THE.      A-CTATCA--AAGCCA-GACATT-------


[Download ClustalW]

#693

Mean pairwise ID: 34.24%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAGATGGGA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.JA_A      CT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.JA_A      CCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.JA_A      T-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTC
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.JA_A      GGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-T
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG------TATACACAG---CC


HUM.JA_A      GCACT--CTTAA-TCAGACCATCTCTTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#694

Mean pairwise ID: 34.24%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_A      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_A      CCCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_A      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_A      GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG--C


LYC.ES_A      GTTGCT---CCAA--TAAACAACCACCTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#695

Mean pairwise ID: 34.24%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_I      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_I      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_I      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_I      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_I      GTTGCT---CCAA-TTAAACCACCATTTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#696

Mean pairwise ID: 34.24%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG------TGGGGACAATAAGGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


ARA.TH_D      ACAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_D      CCCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_D      T-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA
RAT.NOR.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_D      CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_D      -TCGATC---TCTC-CTGGACCACCACTTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#697

Mean pairwise ID: 34.24%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


ARA.TH_A      ACAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_A      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT
RAT.NOR.      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
RAT.NOR.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_A      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
RAT.NOR.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_A      -TCCGAT---CTCATATGAACCACCATTTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#698

Mean pairwise ID: 34.24%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_O      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_O      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_O      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_O      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTAG--


LYC.ES_O      -GCTGCT---CCAA-TTAAACCACCACTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#699

Mean pairwise ID: 34.24%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_I      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_I      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_I      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_I      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_I      GTTGCT---CCAA-TTAAACCACCATTTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#700

Mean pairwise ID: 34.31%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG------CGGGGGCACTAAAGGTGGCTG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC----TGAGGTGGGA


ORY.SA_A      CGGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGC
HOM.SA_B      --GGATCGCTT--GAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC--GATGGG


ORY.SA_A      T-TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGC
HOM.SA_B      GTG-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCA


ORY.SA_A      TTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCAC
HOM.SA_B      GGTTG-----CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAA


ORY.SA_A      TGCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTG
HOM.SA_B      CTCCCGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------


ORY.SA_A      GCC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
HOM.SA_B      CACTCCAG--CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#701

Mean pairwise ID: 34.31%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG------CGGGGGCACTAAAGGTGGCTG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC----TGAGGCTGGA


ORY.SA_A      CGGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGC
HOM.SA_A      --GGATCGCTT--GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC--GATCGG


ORY.SA_A      T-TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGC
HOM.SA_A      GTG-TCCGCACTAAGTTC-GGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCA


ORY.SA_A      TTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCAC
HOM.SA_A      GGTTG-----CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAA


ORY.SA_A      TGCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTG
HOM.SA_A      CTCCCGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------


ORY.SA_A      GCC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
HOM.SA_A      CACTCCAG--CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#702

Mean pairwise ID: 34.33%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG------CGGGGGCATTAAGGTGGTGTG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


ZEA.MA_F      GATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC
CAN.SPE.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GATCGGG


ZEA.MA_F      -TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TT
CAN.SPE.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_F      AGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
CAN.SPE.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_F      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--C
CAN.SPE.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_F      AGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
CAN.SPE.      CAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#703

Mean pairwise ID: 34.34%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG-----TGAGGGCATCAGTGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_C      TG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_C      CCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_C      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTG
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_C      TGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAG--C


LYC.ES_C      GCTGTT---CTAG-TTAAACTACCACATTT--
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#704

Mean pairwise ID: 34.34%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_A      CAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


ARA.TH_A      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTC
CAE.EL_A      CCGTGCCAAGCGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


ARA.TH_A      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.EL_A      ATAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTG


ARA.TH_A      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG-
CAE.EL_A      GTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--C


ARA.TH_A      TCCGAT---CTCATATGAACCACCATTTT---
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#705

Mean pairwise ID: 34.34%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_G      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_G      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_G      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_G      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAG--C


LYC.ES_G      GCTGCT---CCAA-TTAAACCACCACTTTT--
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#706

Mean pairwise ID: 34.34%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_O      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


LYC.ES_O      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_O      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_O      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA--------CATACACAG--C


LYC.ES_O      GCTGCT---CCAA-TTAAACCACCACTTT---
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#707

Mean pairwise ID: 34.34%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG-----TGGGGACATTTAGATGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_E      CAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


ARA.TH_E      CCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT
CAE.EL_D      CCGTGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCA


ARA.TH_E      -AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTAC
CAE.EL_D      TAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


ARA.TH_E      AGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG---C


ARA.TH_E      CCGATC---TCAT-ATGAACCACCATTTT---
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#708

Mean pairwise ID: 34.38%


CAE.EL_D      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT-AGATAAGTGTGGAT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT------CGTGTGGCATAAACAATGT---A


CAE.EL_D      GGAGTGAGAGGAGGAGTCCTGTGTATG----TCGTCG-TCTACGTCGACCGAGCGTCCGT
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGT


CAE.EL_D      GCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAG
TET.ROS.      TCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAG


CAE.EL_D      GAGTCGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
TET.ROS.      AGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTG


CAE.EL_D      GCCGGACCGCGCTTGTAA-GTTGA--CACA--CATACACAG----CCTTCTCGATACCTT
TET.ROS.      GAAGGATAACATACTCA-TTAACTGTCAA-GCTAAT-CG-GTTCTG-CTATTC----TGA


CAE.EL_D      CAGACCACTTATCATTT
TET.ROS.      TCAGACACT--------


[Download ClustalW]

#709

Mean pairwise ID: 34.42%


ORY.SA_A      GCC-GAGCTCAGTAGCGAGAGCCTGTAACCCAAG-CGGGGGCACTAAAGGTGGCTGCGGA
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC---ATAAACAATGT----


ORY.SA_A      TGT-TTGGTGTGGATTCTG-ATCCTG-GGCCC--CATGTTGTTGTAATC-TTGCTGGCT-
TET.ROS.      -AGTTA----GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT--AAGAGTGT


ORY.SA_A      TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCTT
TET.ROS.      G-CCCGTTCCAAACAG-TGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGG


ORY.SA_A      CTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTG
TET.ROS.      GCA-----TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTT


ORY.SA_A      CCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTGCACC--TTGGGCCCGCTTCTGGCC
TET.ROS.      GCCGCTTATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAAT


ORY.SA_A      CAGAGT---CCCTCT-ACAA--CAGACCACCATCTTT
TET.ROS.      CG-GTTCTG-CTATTC--TGATCA-GACACT------


[Download ClustalW]

#710

Mean pairwise ID: 34.42%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG-----CGGGGGCAATAAGGTGGTGTTG
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT--


ORY.SA_B      GATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC
CAE.BRI.      GGATGGAGT--GAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC---GACCGAG


ORY.SA_B      -CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCC
CAE.BRI.      CG-TCCGTGCCAAGCGC-TGCGT--CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCC


ORY.SA_B      TGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCC
CAE.BRI.      GGGCGCATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACC


ORY.SA_B      GCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-C
CAE.BRI.      GCGCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCA


ORY.SA_B      -AAGT-GCCTTC---CATG-GCAGACCACCACCTTT-
CAE.BRI.      CAG--CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#711

Mean pairwise ID: 34.43%


LYC.ES_E      GTC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_E      ATA--TTG--GGCTGTC---CCAGAT-GGCTG-GGCTTGGT--GGGCTAATTTCTGGCC-
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAAC


LYC.ES_E      TGCCCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGAT
DRO.MEL.      G-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


LYC.ES_E      TCCT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


LYC.ES_E      TTGTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGAT
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT-CAG


LYC.ES_E      GG-GCTGTT---CTAG-TTAAACTACCACATTTT
DRO.MEL.      --CCCAACCGATATGGTTGG-ACCACAATCTTT-


[Download ClustalW]

#712

Mean pairwise ID: 34.43%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


ZEA.MA_D      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
ORI.CUN.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC----GATCGGG


ZEA.MA_D      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
ORI.CUN.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_D      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
ORI.CUN.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_D      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
ORI.CUN.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_D      AGAG-CC-TCA---CTAA-GCAGACCACCATCTT
ORI.CUN.      CAG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#713

Mean pairwise ID: 34.43%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


ZEA.MA_G      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
ORI.CUN.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC----GATCGGG


ZEA.MA_G      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
ORI.CUN.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_G      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCG
ORI.CUN.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG


ZEA.MA_G      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
ORI.CUN.      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCC


ZEA.MA_G      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
ORI.CUN.      AG-CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#714

Mean pairwise ID: 34.43%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


ZEA.MA_D      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
RAT.NOR.      GGATCGATT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_D      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
RAT.NOR.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_D      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
RAT.NOR.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_D      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
RAT.NOR.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_D      AGAG-CC-TCA---CTAA-GCAGACCACCATCTT
RAT.NOR.      CAG-CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#715

Mean pairwise ID: 34.43%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


ZEA.MA_G      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
RAT.NOR.      GGATCGATT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_G      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
RAT.NOR.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_G      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCG
RAT.NOR.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG


ZEA.MA_G      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
RAT.NOR.      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCC


ZEA.MA_G      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
RAT.NOR.      AG-CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#716

Mean pairwise ID: 34.44%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


HUM.LU_C      ACT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_C      CCCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_C      CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_C      CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


HUM.LU_C      -CTGACT--CTTAA-TAGGACCATTTCTTTT
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#717

Mean pairwise ID: 34.44%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


HUM.LU_C      ACT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_C      CCCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_C      CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_C      CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


HUM.LU_C      -CTGACT--CTTAA-TAGGACCATTTCTTTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#718

Mean pairwise ID: 34.44%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG------TGAGGGCATCAGTGTGGTGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


LYC.ES_C      ATG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


LYC.ES_C      CCCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


LYC.ES_C      CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


LYC.ES_C      GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTAG--


LYC.ES_C      -GCTGTT---CTAG-TTAAACTACCACATTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#719

Mean pairwise ID: 34.44%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


ARA.TH_A      ACAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_A      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT
RAT.RAT.      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
RAT.RAT.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_A      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
RAT.RAT.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_A      -TCCGAT---CTCATATGAACCACCATTTT-
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#720

Mean pairwise ID: 34.44%


ZEA.MA_F      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCTAAG-CGGGGGCATTAAGGTGGTGTGGATG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A


ZEA.MA_F      T-TTCC-TGACGGA---TTCTG-GGCCT--GGGCTTGT-ATGTGCCACTGGCCGGCC-TG
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-


ZEA.MA_F      CCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTAGA
TET.ROS.      CCCGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCA


ZEA.MA_F      CCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCT
TET.ROS.      -TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACT-TGCCGCT


ZEA.MA_F      TCCAACGGTGGGAGGATAACA-GGCCGCTGCATT--GCAAGCCCAACTCGGTC-CAGAG-
TET.ROS.      TATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GTT


ZEA.MA_F      ---CC-TCA-TTAA-ACAGACCACCATCTTT
TET.ROS.      CTG-CTATTC--TGATCA-GACACT------


[Download ClustalW]

#721

Mean pairwise ID: 34.44%


ZEA.MA_E      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGCGGATT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A


ZEA.MA_E      C-TTTG-CGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-TG
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-


ZEA.MA_E      CCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGA
TET.ROS.      CCCGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCA


ZEA.MA_E      CCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCGGCT
TET.ROS.      -TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACT-TGCCGCT


ZEA.MA_E      TCCAACGGTGGGAGGATAACG-GGCCGCTGCACT--TCGAGCCCAACTCAGGCCCAGAG-
TET.ROS.      TATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GTT


ZEA.MA_E      ---CC-TCA-CTAA-GCAGACCACCATCTTT
TET.ROS.      CTG-CTATTC--TGATCA-GACACT------


[Download ClustalW]

#722

Mean pairwise ID: 34.44%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_K      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_K      CCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_K      T-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_K      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CC


LYC.ES_K      TTGCT---CCAA--TAAACAACCACCTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#723

Mean pairwise ID: 34.44%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


ARA.TH_F      ACAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_F      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT
ORI.CUN.      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_F      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
ORI.CUN.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_F      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
ORI.CUN.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_F      T-CCGATC---TCAT-ATGAACCACCATTTT
ORI.CUN.      -CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#724

Mean pairwise ID: 34.44%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG-----TGGGGACTATAAGATGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


ARA.TH_G      CAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


ARA.TH_G      CCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT
CAE.BRI.      CCGTGCCAAGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCA


ARA.TH_G      -AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.BRI.      TAAGG-AGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


ARA.TH_G      AGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC-
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG---C


ARA.TH_G      TCGTAA--CCCGC-TTGAACCACCATTTT--
CAE.BRI.      CTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#725

Mean pairwise ID: 34.44%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


HUM.LU_C      ACT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_C      CCCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_C      CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_C      CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


HUM.LU_C      -CTGACT--CTTAA-TAGGACCATTTCTTTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#726

Mean pairwise ID: 34.44%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_A      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.LU_A      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.LU_A      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.LU_A      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACTAGG-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


HUM.LU_A      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#727

Mean pairwise ID: 34.44%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


ARA.TH_A      CAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_A      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTC
CAE.EL_C      CCGTGCCAAGCGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


ARA.TH_A      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.EL_C      ATAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCG


ARA.TH_A      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG-
CAE.EL_C      GTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--C


ARA.TH_A      TCCGAT---CTCATATGAACCACCATTTT--
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#728

Mean pairwise ID: 34.44%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


HUM.LU_C      ACT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_C      CCCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_C      CT-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_C      CGGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


HUM.LU_C      -CTGACT--CTTAA-TAGGACCATTTCTTTT
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#729

Mean pairwise ID: 34.44%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG------TGGGGACAATAAGGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


ARA.TH_D      ACAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_D      CCCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_D      T-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA
RAT.RAT.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_D      CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_D      -TCGATC---TCTC-CTGGACCACCACTTT-
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#730

Mean pairwise ID: 34.45%


LYC.ES_C      GCC-GAGCTCAGTAGCGTGGGCTTGTAACTCAAG-TGAGGGCATCAGTGTGGTGGAATG-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_C      -TTG--AACATGC--CCAGAA-GGTA---GGGCTTGT--GTGACAATTCTCTGGCC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_C      CCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_C      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTG
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_C      TGCAGTGGAAGGATAACG-AGCCAGTGTCAT--ATAAGTTCAACGAATGTCTGATGG---
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-GTTCTA


LYC.ES_C      GCTGTT-CTAG-TTAAACTACCACATTT
TET.THE.      -CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#731

Mean pairwise ID: 34.46%


ARA.TH_D      GTC-GAGCTAAGTAACGAGAGCTTGTGACCCGAG-TGGGGACAATAAGGTGGTGGAACAG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


ARA.TH_D      --TG-GTTCAAT--TCCTCG-GGTC---GGACCTGATGCTGACATATATCTGAGC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


ARA.TH_D      CAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT-
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


ARA.TH_D      AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTACA
TET.ROS.      AAGA-GCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


ARA.TH_D      GCAGTGGATGGATCATA-GTTCGAAGTCTC--TCAGATCCACTATGGCCCGCTGGT--TC
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-C


ARA.TH_D      GATC-TCTC-CTGGACCACCACTTT
TET.ROS.      TATTC--TGATCA-GACACT-----


[Download ClustalW]

#732

Mean pairwise ID: 34.49%


FUG.RUB.      GCC-GGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACT-GGGAGGC-TGAGGCTGGCGG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA--------TATGTGGCATAAACAATGT--


FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT-----CAGCGG-ACTATGTCGATCGGGTGTCC
TET.THE.      AGGTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCC


FUG.RUB.      GTACTAAGTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTA
TET.THE.      GCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAA


FUG.RUB.      AGGAGGGGTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAG
TET.THE.      AGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGG


FUG.RUB.      TAGTGGGATCGCGCCCGTGA-ATAGA--CGCT--GTAGTTCAA----CCTGAGTAACACA
TET.THE.      TGGAAGGATAACATACTCA-TTAACTGTCAA-ACTAAT-CG-GTTCTA-CTATCA----A


FUG.RUB.      GCGGGACTCAGTCTTT
TET.THE.      AGCCAGACATT-----


[Download ClustalW]

#733

Mean pairwise ID: 34.49%


CAE.EL_C      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT-AGATGAGTGTGGAT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT------CGTGTGGCATAAACAATGT---A


CAE.EL_C      GGAGTGAGAGGAGGAGTCCTGTGTATG----TCGTTG-TCAACGTCGACCGAGCGTCCGT
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGT


CAE.EL_C      GCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG
TET.ROS.      TCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAG


CAE.EL_C      GAGTGGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
TET.ROS.      AGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTG


CAE.EL_C      GCCGGACAGCGCTTGTGA-GTTGA--CACG--TATACACAG----CCTTCTCAATACCTT
TET.ROS.      GAAGGATAACATACTCA-TTAACTGTCAA-GCTAAT-CG-GTTCTG-CTATTC----TGA


CAE.EL_C      CAGACCACTTGTCACT
TET.ROS.      TCAGACACT-------


[Download ClustalW]

#734

Mean pairwise ID: 34.51%


ORY.SA_B      GCC-GAGCCAGGTAGCGTTGGCTTGTCACCCGAG-----CGGGGGCAATAAGGTGGTGTT
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ORY.SA_B      GGATGC-CTGGTC-GTTTGCG----CTTGG-GGTCT-GCGCCTGTGGTTTGCACTATGCG
DRO.MEL.      --GATGGCCT--GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT---GACG


ORY.SA_B      GCC-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGT
DRO.MEL.      GAACG-TCCGCACTAAGCTT-GCCAT--CAATATGGGTGCCATGGAGGAGTCCGTGGCAT


ORY.SA_B      CCCTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCG
DRO.MEL.      TCAGGTTGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTT


ORY.SA_B      CCCGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGC
DRO.MEL.      CCCGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTT


ORY.SA_B      C-C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
DRO.MEL.      AT-CAG--CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#735

Mean pairwise ID: 34.52%


ZEA.MA_A      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGTGA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


ZEA.MA_A      ATGC-TTTG--CGATGGCT--TTCTG-GGCCCTGGGCTCGT--TGTGACACTGGCCGGCT
XEN.LAE.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG----CACTGA-GCTATGTC----GATCGGG


ZEA.MA_A      -TGCCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-
XEN.LAE.      TG-TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCT-CGGATCACCAG


ZEA.MA_A      CAGAC-CT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCC
XEN.LAE.      GTTG-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCC


ZEA.MA_A      GACTCCCAACGGTGGGAGGATAACGAAGCCGCTG-CACT--TTGAGCCTAACTCAGGCT-
XEN.LAE.      CGTGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGA


ZEA.MA_A      CAGAA-CC-TCA---CTAA-GCAAACCACCATCTTT
XEN.LAE.      ACAG-CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#736

Mean pairwise ID: 34.53%


ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
LYC.ES_D      ------------------------------------------------------------


ZEA.MA_H      AATTGTGGTGCATGTGCCTGGGTCTAGTGCTACAAACTGTGGACCACCCATTCCAAGTTG
LYC.ES_D      --------------------------------TAG-TTCTGGCCTGCCCTGTCCAAGCAC


ZEA.MA_H      CGTAGTGGGTTTCGGATGCCTTGGCGAAAGCTTTG-CATCC-CAACACTAAAGTGGCGGA
LYC.ES_D      -AGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCG


ZEA.MA_H      CATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTGGAAGGA
LYC.ES_D      GACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA


ZEA.MA_H      TAATGAGTCGCTATGCT-ATAGGCCCAAT-------------------------------
LYC.ES_D      TAATGGGTCGGTGTCTTATCAAGTTCAGTAACGCCTAATGGGTTGCTCCAACTAAACCAC


ZEA.MA_H      -------
LYC.ES_D      CACTTTT


[Download ClustalW]

#737

Mean pairwise ID: 34.53%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G


ZEA.MA_D      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
FUG.RUB.      GATCGCTT-GAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC----GATCGGGT


ZEA.MA_D      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
FUG.RUB.      G-TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGT


ZEA.MA_D      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
FUG.RUB.      CG-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGC-CCCCG


ZEA.MA_D      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
FUG.RUB.      TGCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTC


ZEA.MA_D      GAG-CC-TCA---CTAA-GCAGACCACCATCTT
FUG.RUB.      AA-CCTGAGTAACACAGCGGG-ACTCAGTCTTT


[Download ClustalW]

#738

Mean pairwise ID: 34.53%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-----TGGGGGCAACAATGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_F      TG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-TG
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC-----GATCGGGTG-


LYC.ES_F      CCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCT
XEN.LAE.      TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTG


LYC.ES_F      -TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC
XEN.LAE.      CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGC


LYC.ES_F      TGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGAT
XEN.LAE.      CGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG---------CAGAACAG


LYC.ES_F      AG-GTTGCC----TAA-TTAAACCATCACTTTT
XEN.LAE.      --CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#739

Mean pairwise ID: 34.53%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


ZEA.MA_C      GATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-T
CAN.SPE.      GGATCGCTTGAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC---GATCGGGTG


ZEA.MA_C      GCCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTG
CAN.SPE.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGT


ZEA.MA_C      GACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGC
CAN.SPE.      TG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT


ZEA.MA_C      TATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAG
CAN.SPE.      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCA


ZEA.MA_C      ACTTC-ATA---CTAAAGCAGACCACCATTTTT
CAN.SPE.      G-CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#740

Mean pairwise ID: 34.53%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


ZEA.MA_C      GATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-T
RAT.RAT.      GGATCGCTTGAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGTG


ZEA.MA_C      GCCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTG
RAT.RAT.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGT


ZEA.MA_C      GACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGC
RAT.RAT.      TG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT


ZEA.MA_C      TATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAG
RAT.RAT.      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCA


ZEA.MA_C      ACTTC-ATA---CTAAAGCAGACCACCATTTTT
RAT.RAT.      G-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#741

Mean pairwise ID: 34.53%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G


ZEA.MA_G      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
FUG.RUB.      GATCGCTT-GAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC----GATCGGGT


ZEA.MA_G      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
FUG.RUB.      G-TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGT


ZEA.MA_G      GACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGC
FUG.RUB.      CG-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGT


ZEA.MA_G      TTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CAG
FUG.RUB.      GCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCA


ZEA.MA_G      AG-CC-TCA---CTAA-GCAGACCACCATCTTT
FUG.RUB.      A-CCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#742

Mean pairwise ID: 34.55%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG------TGGGGACAATAAGGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


ARA.TH_D      ACAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_D      CCCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_D      T-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA
CAN.SPE.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_D      CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_D      -TCGATC---TCTC-CTGGACCACCACTTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#743

Mean pairwise ID: 34.55%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_B      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_B      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_B      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_B      AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_B      GCTGCT---CTAA-TTAAACCACCACTTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#744

Mean pairwise ID: 34.55%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_I      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_I      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_I      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_I      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_I      GTTGCT---CCAA-TTAAACCACCATTTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#745

Mean pairwise ID: 34.55%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAATGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_N      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_N      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_N      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_N      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_N      GTTGCT---CCAA-TTAAACCACCATTTTT
HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#746

Mean pairwise ID: 34.55%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


HUM.LU_C      CT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


HUM.LU_C      CCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCC
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


HUM.LU_C      T-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


HUM.LU_C      GGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG-
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA---C


HUM.LU_C      CTGACT--CTTAA-TAGGACCATTTCTTTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#747

Mean pairwise ID: 34.55%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


ARA.TH_A      ACAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


ARA.TH_A      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTT
HOM.SA_B      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_A      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
HOM.SA_B      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_A      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
HOM.SA_B      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_A      -TCCGAT---CTCATATGAACCACCATTTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#748

Mean pairwise ID: 34.55%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG-----TGGGGGCATTGAGGCGGTGTGG
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


TRI.AE_B      ATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TG
CAE.EL_A      GATGGAGTGAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC---GACCGAGCG-


TRI.AE_B      CCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-C
CAE.EL_A      TCCGTGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


TRI.AE_B      T-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCC
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


TRI.AE_B      AACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-CC
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAGCCT


TRI.AE_B      CCGC--CAT-A-GCAGACCACCATCTTT--
CAE.EL_A      TCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#749

Mean pairwise ID: 34.56%


TET.ROS.      GCCAGGGTAGCA-ATGCCTGTGACCT-CGTGTGGCATAAACAATGT-AGTTA--GAATAG
LEI.MAJ.      GCC-GGAGC--TCTGCTCTGTAACCTTCGGGGGCT-AACCAGGCTTAGCGGGGAGGACGT


TET.ROS.      TCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTCCAAACAGTGA
LEI.MAJ.      GGA--CCAGCGAGGGT---GATTTG-C-TGCGTTGACGTGGTGCTC-TGCTTGGCTGTGT


TET.ROS.      GTTGCTAT-GGTGGAAACCTAGTAATAGGACTTCACCAGGGCA-TTAAAGAGCTGAGGAA
LEI.MAJ.      GTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCGAGGGAA


TET.ROS.      CCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTA-TTGTGGTGGAAGGATAA
LEI.MAJ.      CCGGGTCAGGCCGGAAACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCAGAATCA


TET.ROS.      CATACTCA-TTAACTGTCAA-GCTAAT-CGGTTCTG-CTATTC-TGATCAGACACT--
LEI.MAJ.      CACCGCGGA-GCATGTCC--GCACTTGAGC----CCCACGCTTCGTCGCG-AAGCCTT


[Download ClustalW]

#750

Mean pairwise ID: 34.59%


GAL.GAL.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGCCCGCCG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---------CGTGTGGCATAAACAATGT-


GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG-----CAGTGC-GCTATGCCGAGCGGGCGTC
TET.ROS.      --AGTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


GAL.GAL.      CGCGCTAAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCT
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


GAL.GAL.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCA
TET.ROS.      AAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTG


GAL.GAL.      GTAACGGGATCGCGCCTGTGA-ATAGC--CACTG---CAGCGTAG----CCTGGGCAACA
TET.ROS.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--GCTAAT-CG-GTTCTG-CTATTC---


GAL.GAL.      TAGCGAGACCCTGTCTCC
TET.ROS.      -TGATCAGACACT-----


[Download ClustalW]

#751

Mean pairwise ID: 34.63%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG------CGGGGGCATTAAGGTGGTGTG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


ZEA.MA_F      GATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC
HOM.SA_B      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATGGGG


ZEA.MA_F      -TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TT
HOM.SA_B      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_F      AGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
HOM.SA_B      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_F      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--C
HOM.SA_B      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_F      AGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
HOM.SA_B      CAG-CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#752

Mean pairwise ID: 34.63%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG------CGGGGGCATTAAGGTGGTGTG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


ZEA.MA_F      GATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC
HOM.SA_A      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_F      -TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TT
HOM.SA_A      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_F      AGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
HOM.SA_A      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_F      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--C
HOM.SA_A      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_F      AGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
HOM.SA_A      CAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#753

Mean pairwise ID: 34.63%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


ZEA.MA_D      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
RAT.RAT.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_D      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
RAT.RAT.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_D      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
RAT.RAT.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_D      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
RAT.RAT.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_D      AGAG-CC-TCA---CTAA-GCAGACCACCATCTT-
RAT.RAT.      CAG-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#754

Mean pairwise ID: 34.63%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


ZEA.MA_E      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
RAT.RAT.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_E      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
RAT.RAT.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_E      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCG
RAT.RAT.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_E      GCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
RAT.RAT.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_E      AGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
RAT.RAT.      CAG-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#755

Mean pairwise ID: 34.64%


ZEA.MA_B      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGCGCGGATG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A


ZEA.MA_B      C-TTTG-CGATGGT---TTCTG-GGCCT--GGGCTCGT--TGTGACTCTAGCCGGCT-TG
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-


ZEA.MA_B      CCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-CAG
TET.ROS.      CCCGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAG-GACTTCACCAGGGC


ZEA.MA_B      ACCT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCAC
TET.ROS.      A-TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACT-TGCCGC


ZEA.MA_B      TTCCAACGGTGGGAGGATAACA-AGCCGCTGCACT--TTGAGCCCAACACAGACCCAGA-
TET.ROS.      TTATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GT


ZEA.MA_B      ---TCC-TCT-CTTA-GCAAACCACCATCTTT
TET.ROS.      TCTG-CTATTC--TGATCA-GACACT------


[Download ClustalW]

#756

Mean pairwise ID: 34.64%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG-----TGGGGACAATAAGGTGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_D      CAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


ARA.TH_D      CCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT
CAE.EL_D      CCGTGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCA


ARA.TH_D      -AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTAC
CAE.EL_D      TAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


ARA.TH_D      AGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG---C


ARA.TH_D      TCGATC---TCTC-CTGGACCACCACTTT---
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#757

Mean pairwise ID: 34.64%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG-----TGGAGACAATAAGGGGATGGGA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


ARA.TH_C      CG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


ARA.TH_C      CCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTTC
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


ARA.TH_C      T-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCTT
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


ARA.TH_C      GACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAAG
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCACAG---


ARA.TH_C      --CCGCT---CCGA-TTGGACCATCACTTT--
CAE.BRI.      CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#758

Mean pairwise ID: 34.64%


HUM.JA_B      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.JA_B      CT--TTA--GTTCGGC--CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


HUM.JA_B      CCATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.JA_B      T-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTC
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.JA_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTGAG-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG---C


HUM.JA_B      CTGACT--CTTAA-TAGGACCATTTCTTTT--
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#759

Mean pairwise ID: 34.64%


HUM.JA_B      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.JA_B      CT--TTA--GTTCGGC--CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


HUM.JA_B      CCATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCC
CAE.EL_D      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


HUM.JA_B      T-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTC
CAE.EL_D      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


HUM.JA_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTGAG-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG---C


HUM.JA_B      CTGACT--CTTAA-TAGGACCATTTCTTTT--
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#760

Mean pairwise ID: 34.65%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG-----TGGGGGCATTGAGGCGGTGTGG
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G


TRI.AE_B      ATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TG
CAE.EL_B      GATGGAGTGAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC---GACCGAGCG-


TRI.AE_B      CCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-C
CAE.EL_B      TCCGTGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


TRI.AE_B      T-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCC
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


TRI.AE_B      AACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-CC
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACAGCCT


TRI.AE_B      CCGC--CAT-A-GCAGACCACCATCTTT-
CAE.EL_B      TCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#761

Mean pairwise ID: 34.65%


TRI.AE_B      NCC-GAGCT-AGTTGCGGGAGCTTGTCACCCATG-TGGGGGCATTGAGGCGGTGTGGATG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


TRI.AE_B      C-TTG--GTGCGGT---TTGTT-GGCCT--GGGCTTGTGATGTAACCTTGCTGGCC-TGC
TET.THE.      GTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT---AAGAGTGTG-C


TRI.AE_B      CCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-CT
TET.THE.      CCGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATT


TRI.AE_B      -TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCCA
TET.THE.      AAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGTT


TRI.AE_B      ACGGTGGAAGGATAACA-GGCCGCTGCAGC--ATGGGCCCGCTCTGGGCCTCCTA-----
TET.THE.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAAT-CG-GTTCTA


TRI.AE_B      CCCCGC-CAT-A-GCAGACCACCATCTTT
TET.THE.      -CTATCA---AAGCCA-GACATT------


[Download ClustalW]

#762

Mean pairwise ID: 34.66%


ARA.TH_A      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG-TGGGGACATTAAGATGGTGGGACAC
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


ARA.TH_A      -TG--GTTCGGT--TCCTCG-GATC---GGTTCTGATGTGGGCATGTTTCTGAGC-TGCC
TET.THE.      TT-GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


ARA.TH_A      CAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCT
TET.THE.      CGCTCCAAACAATGAGTTGCTAT-GGTGGTAACCTAGTAATAGGACTCCACCAGGGCATT


ARA.TH_A      -AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTAC
TET.THE.      AAAGA-GCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


ARA.TH_A      AGCAGTGGACGGATCACG-GTTTAGCGTCGC--TCAGAACCACTATGGCCTGCTGG---T
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-


ARA.TH_A      CCGAT-CTCATATGAACCACCATTTT
TET.THE.      CTATCA--AAGCCA-GACATT-----


[Download ClustalW]

#763

Mean pairwise ID: 34.72%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG------CGGGGGCAATAAGGTGGTGTT
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


ORY.SA_B      GGATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGC
ORI.CUN.      -GGATCGCTT--GAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC---GATCGG


ORY.SA_B      C-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCC
ORI.CUN.      GTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCTCCCGGGAGCGGGGGACCACC


ORY.SA_B      CTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCC
ORI.CUN.      AGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ORY.SA_B      CGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-
ORI.CUN.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ORY.SA_B      C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
ORI.CUN.      CCAG--CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#764

Mean pairwise ID: 34.72%


ZEA.MA_E      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ZEA.MA_E      GATTC-TTTG--CGATGGCT---TTCTG-GGCCC-GGGCTCGCTATGTGCCTTTGGCCGG
DRO.MEL.      -GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGG


ZEA.MA_E      CC-TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-
DRO.MEL.      AACG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCA


ZEA.MA_E      CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGC
DRO.MEL.      GGTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGT-TC


ZEA.MA_E      CGGCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC
DRO.MEL.      CCGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTA


ZEA.MA_E      -CAGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
DRO.MEL.      T-CAG-CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#765

Mean pairwise ID: 34.72%


ZEA.MA_D      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ZEA.MA_D      GATTC-TTTG--CGATGGCT---TTCTG-GGCCC-GGGCTCGCTATGTGCCTTTGGCCGG
DRO.MEL.      -GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGG


ZEA.MA_D      CC-TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-
DRO.MEL.      AACG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCA


ZEA.MA_D      CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGC
DRO.MEL.      GGTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGT-TC


ZEA.MA_D      CCGCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC
DRO.MEL.      CCGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTA


ZEA.MA_D      -CAGAG-CC-TCA---CTAA-GCAGACCACCATCTT-
DRO.MEL.      T-CAG-CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#766

Mean pairwise ID: 34.72%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG------CGGGGGCAATAAGGTGGTGTT
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


ORY.SA_B      GGATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGC
RAT.NOR.      -GGATCGATT--GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGG


ORY.SA_B      C-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCC
RAT.NOR.      GTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCTCCCGGGAGCGGGGGACCACC


ORY.SA_B      CTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCC
RAT.NOR.      AGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ORY.SA_B      CGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-
RAT.NOR.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ORY.SA_B      C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
RAT.NOR.      CCAG--CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#767

Mean pairwise ID: 34.74%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_A      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_A      CCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_A      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCTG
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_A      TGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CC


LYC.ES_A      TTGCT---CCAA--TAAACAACCACCTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#768

Mean pairwise ID: 34.74%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_E      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_E      CCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_E      T-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_E      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCAA--C


LYC.ES_E      GCTGTT---CTAG-TTAAACTACCACATTTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT--


[Download ClustalW]

#769

Mean pairwise ID: 34.74%


CAE.EL_D      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.EL_D      GAGTGAGAGGAGGAGTCCTGTGTATGTCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAG
TRY.BR_B      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.EL_D      CGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTC
TRY.BR_B      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.EL_D      GTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTG-GTGCAGTGGCCG
TRY.BR_B      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAG


CAE.EL_D      GACCGCGCTTGTAAGTTGA--CACA-CATACACAG-CCTTCTCGATACCTTCAGACCACT
TRY.BR_B      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.EL_D      TATCATTT
TRY.BR_B      GTTT----


[Download ClustalW]

#770

Mean pairwise ID: 34.74%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


ARA.TH_A      CAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


ARA.TH_A      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTC
CAE.BRI.      CCGTGCCAAGCGCTGCGTCGCCAG-GGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


ARA.TH_A      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.BRI.      ATAAGG-AGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCG


ARA.TH_A      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG-
CAE.BRI.      GTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--C


ARA.TH_A      TCCGAT---CTCATATGAACCACCATTTT--
CAE.BRI.      CTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#771

Mean pairwise ID: 34.74%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


ARA.TH_F      ACAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_F      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT
CAN.SPE.      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_F      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
CAN.SPE.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_F      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
CAN.SPE.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_F      T-CCGATC---TCAT-ATGAACCACCATTTT
CAN.SPE.      -CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#772

Mean pairwise ID: 34.74%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG-----TGAGGGTATCAAAGTGGTTGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


CIN.HYB.      CT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-TG
XEN.LAE.      ATCGCTT-GAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-


CIN.HYB.      CCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT
XEN.LAE.      TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTG


CIN.HYB.      -TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCT
XEN.LAE.      CTCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTG


CIN.HYB.      CTCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCT
XEN.LAE.      CCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACAG


CIN.HYB.      GG--CTAGC---CCAA-CAGGACACCCATTT
XEN.LAE.      --CCTGAACAACACAGCGAG-ACACAGTTCT


[Download ClustalW]

#773

Mean pairwise ID: 34.74%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG------TGGGGACAATAAGGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


ARA.TH_D      ACAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_D      CCCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_D      T-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA
HOM.SA_A      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_D      CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_D      -TCGATC---TCTC-CTGGACCACCACTTT-
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#774

Mean pairwise ID: 34.74%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_J      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_J      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_J      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_J      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG--CC


LYC.ES_J      TTGCT---CCAA--TAAACAACCACCTTT--
CAE.EL_A      TTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#775

Mean pairwise ID: 34.74%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.LU_D      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.LU_D      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.LU_D      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.LU_D      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACTGGG-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


HUM.LU_D      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#776

Mean pairwise ID: 34.74%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


ARA.TH_F      ACAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_F      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT
RAT.NOR.      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_F      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
RAT.NOR.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_F      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
RAT.NOR.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_F      T-CCGATC---TCAT-ATGAACCACCATTTT
RAT.NOR.      -CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#777

Mean pairwise ID: 34.74%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG-----TGAGGGCATCAGTGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_C      TG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_C      CCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_C      CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_C      GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACAG--


LYC.ES_C      -GCTGTT---CTAG-TTAAACTACCACATTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#778

Mean pairwise ID: 34.74%


CAE.EL_A      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.EL_A      GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAG
TRY.BR_A      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.EL_A      CGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTC
TRY.BR_A      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.EL_A      GTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTG-GTGCAGTGGCCG
TRY.BR_A      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAG


CAE.EL_A      GACCGCGCTTGTGAGTTGA--CACA-CATACGCAG-CCTTCTCGATACCTTCAGACCACT
TRY.BR_A      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.EL_A      TATCATTT
TRY.BR_A      G-------


[Download ClustalW]

#779

Mean pairwise ID: 34.74%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG-----TGGGGGCATTAAAGTGATGTGA


FUG.RUB.      GATCGCTT-GAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC---GATCGGGTG
TRI.AE_A      ACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-C


FUG.RUB.      -TCCGTACTAAGTTC-GGTAT-CGATAT-GGTGCTCCTGGGGGAGCCCGGGATCACCAGG
TRI.AE_A      GCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CG


FUG.RUB.      TCGCCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGT
TRI.AE_A      GTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGC


FUG.RUB.      GCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA
TRI.AE_A      TTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGCA


FUG.RUB.      -CCTGAGTAACACAGCGGG-ACTCAGTCTTT
TRI.AE_A      G--CCTAC---TCCA-GCAGACCACC-----


[Download ClustalW]

#780

Mean pairwise ID: 34.74%


ZEA.MA_A      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGTGAATG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A


ZEA.MA_A      C-TTTG-CGATGGCT--TTCTG-GGCCCT-GGGCTCGT--TGTGACACTGGCCGGCT-TG
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-


ZEA.MA_A      CCCATCCCAAGTTGGTAGTGTCTGGTGGGGGCTCTAGCGAAAGCTTTGGGTCTCTG-CAG
TET.ROS.      CCCGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAG-GACTTCACCAGGGC


ZEA.MA_A      ACCT-GGAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTGCCGACT
TET.ROS.      A-TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCT


ZEA.MA_A      CCCAACGGTGGGAGGATAACGAAGCCGCTGCACT--TTGAGCCTAACTCAGGCTCAGAA-
TET.ROS.      TATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GTT


ZEA.MA_A      ---CC-TCA-CTAA-GCAAACCACCATCTTT
TET.ROS.      CTG-CTATTC--TGATCA-GACACT------


[Download ClustalW]

#781

Mean pairwise ID: 34.74%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG------TGGAGACAATAAGGGGATGGG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


ARA.TH_C      ACG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


ARA.TH_C      CCCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAA
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CAGCGTAG--


ARA.TH_C      G--CCGCT---CCGA-TTGGACCATCACTTT
GAL.GAL.      -CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#782

Mean pairwise ID: 34.82%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGT-CTGATTGTGGGATGGC
TET.ROS.      GCCAGGGTAG-CA---ATGCCTGTGACCT------CGTGTGGCATAAACAATGT--AGTT


DRO.MEL.      CTGAGGCTGGGATCTACTGCGTAGCGG--ACCAG--CTCATGTTGACGGAACGTCCGCAC
TET.ROS.      A--GAATAGTCA-GAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGTTC


DRO.MEL.      TAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGA
TET.ROS.      CAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAGAG


DRO.MEL.      GGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGT
TET.ROS.      CTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTGGA


DRO.MEL.      GGGATAGCGTACCGGA-GTGGA--CTGC-CGTTAT-CAG----CCCAACCGATATGGTTG
TET.ROS.      AGGATAACATACTCA-TTAACTGTCAA-GCTAAT-CG-GTTCTG-CTATTC----TGATC


DRO.MEL.      GACCACAATCTTT
TET.ROS.      AGACACT------


[Download ClustalW]

#783

Mean pairwise ID: 34.83%


LYC.ES_O      GCC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGA
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


LYC.ES_O      ATA--TTG--GGCTGTC---CCAGAT-GGCTG-GGCTTGGT--GGGCTAATTTCTGGCC-
DRO.MEL.      GATGGCCTGAGGCTGGGATCTACTGCGTAGCGGACCAG--CTCATGTT----GACGGAAC


LYC.ES_O      TGCCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGAT
DRO.MEL.      G-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGT


LYC.ES_O      TCCT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCT
DRO.MEL.      TGGCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCCCGTG


LYC.ES_O      TTGTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGAT
DRO.MEL.      GTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT-CAG


LYC.ES_O      GG-GCTGCT---CCAA-TTAAACCACCACTTT-
DRO.MEL.      --CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#784

Mean pairwise ID: 34.83%


ORY.SA_B      GCC-GAGCCAGGTAGCGTTGGCTTGTCACCCGAG-CGGGGGCAATAAGGTGGTGTTGGAT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT-----


ORY.SA_B      GC-CTGGTC-GTTTGCG---CTTGG-GGTCT--GCGCCTGTGGTTTGCACTATGCGGCC-
TET.ROS.      AGTTA----GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT---AAGAGTGT


ORY.SA_B      CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCCT
TET.ROS.      G-CCCGTTCCAAACAG-TGAGT--TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAG


ORY.SA_B      GCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCCG
TET.ROS.      GGCATTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCG


ORY.SA_B      CTTCCAACGGTGGAAGGATAACG-GGCCGCTGCAGC--CCTGGCCCGCTTCCGGCCC-AA
TET.ROS.      CTTATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-G


ORY.SA_B      GT---GCCTTC-CATG-GCAGACCACCACCTTT
TET.ROS.      TTCTG-CTATTC--TGATCA-GACACT------


[Download ClustalW]

#785

Mean pairwise ID: 34.83%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


ZEA.MA_C      GATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-T
HOM.SA_A      GGATCGCTTGAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGTG


ZEA.MA_C      GCCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTG
HOM.SA_A      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGT


ZEA.MA_C      GACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGC
HOM.SA_A      TG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT


ZEA.MA_C      TATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAG
HOM.SA_A      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCA


ZEA.MA_C      ACTTC-ATA---CTAAAGCAGACCACCATTTTT
HOM.SA_A      G-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#786

Mean pairwise ID: 34.83%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_F      CAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


ARA.TH_F      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTC
CAE.EL_A      CCGTGCCAAGCGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


ARA.TH_F      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.EL_A      ATAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTG


ARA.TH_F      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
CAE.EL_A      GTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG---


ARA.TH_F      -CCGATC---TCAT-ATGAACCACCATTTT---
CAE.EL_A      CCTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#787

Mean pairwise ID: 34.83%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG-----TGGGGGCATTAAAGTGATGTGA


CAE.EL_B      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC---GACCGAGCG
TRI.AE_A      ACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-C


CAE.EL_B      -TCCGTGCCAAGCGC-TGCGT-CACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGG
TRI.AE_A      GCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CG


CAE.EL_B      GTGCATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGC
TRI.AE_A      GTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGC


CAE.EL_B      GCGGTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG
TRI.AE_A      TTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGCA


CAE.EL_B      -CCTTCTCAATACCTTCAG-ACCACTTGTTTTT
TRI.AE_A      G--CCTAC---TCCA-GCAGACCACC-------


[Download ClustalW]

#788

Mean pairwise ID: 34.85%


ZEA.MA_G      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGCGGATT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A


ZEA.MA_G      C-TTTG-CGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-TG
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-


ZEA.MA_G      CCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGA
TET.ROS.      CCCGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCA


ZEA.MA_G      CCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCGCTT
TET.ROS.      -TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTT


ZEA.MA_G      CCAACGGTGGGAGGATAACG-GGCCGCTGCACT--TCGAGCCCAACTCAGGCCCAGAG--
TET.ROS.      ATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GTTC


ZEA.MA_G      --CC-TCA-CTAA-GCAGACCACCATCTTT
TET.ROS.      TG-CTATTC--TGATCA-GACACT------


[Download ClustalW]

#789

Mean pairwise ID: 34.85%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_I      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_I      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_I      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_I      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_I      GTTGCT---CCAA-TTAAACCACCATTTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#790

Mean pairwise ID: 34.85%


ZEA.MA_D      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGCGGATT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A


ZEA.MA_D      C-TTTG-CGATGGCT--TTCTG-GGCCC--GGGCTCGCTATGTGCCTTTGGCCGGCC-TG
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-


ZEA.MA_D      CCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCAGA
TET.ROS.      CCCGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCA


ZEA.MA_D      CCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCGCT
TET.ROS.      -TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACT-TGCCGCT


ZEA.MA_D      TCCAACGGTGGGAGGATAACA-GGCCGCTGCACT--TCGAGCCCAACTCAGGCCCAGAG-
TET.ROS.      TATTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GTT


ZEA.MA_D      ---CC-TCA-CTAA-GCAGACCACCATCTT
TET.ROS.      CTG-CTATTC--TGATCA-GACACT-----


[Download ClustalW]

#791

Mean pairwise ID: 34.85%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


LYC.ES_I      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


LYC.ES_I      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


LYC.ES_I      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


LYC.ES_I      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--CC


LYC.ES_I      TTGCT---CCAA-TTAAACCACCATTTTT-
CAE.BRI.      TCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#792

Mean pairwise ID: 34.85%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_B      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_B      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_B      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_B      AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_B      GCTGCT---CTAA-TTAAACCACCACTTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#793

Mean pairwise ID: 34.85%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_I      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_I      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_I      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_I      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_I      GTTGCT---CCAA-TTAAACCACCATTTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#794

Mean pairwise ID: 34.85%


LYC.ES_N      GTTGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAATGTGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


LYC.ES_N      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


LYC.ES_N      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


LYC.ES_N      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCTA
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


LYC.ES_N      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-G
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--CC


LYC.ES_N      TTGCT---CCAA-TTAAACCACCATTTTT-
CAE.BRI.      TCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#795

Mean pairwise ID: 34.85%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


HUM.LU_B      AC-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


HUM.LU_B      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


HUM.LU_B      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


HUM.LU_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTC
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CAGCGTAG---C


HUM.LU_B      CTGACT--CTTAA-TCGGACCATTTCCTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#796

Mean pairwise ID: 34.85%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG------TGGGGACATTTAGATGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


ARA.TH_E      ACAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_E      CCCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTC
ORI.CUN.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_E      T-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA
ORI.CUN.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_E      CAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_E      -CCGATC---TCAT-ATGAACCACCATTTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#797

Mean pairwise ID: 34.85%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG------TGGGGACATTTAGATGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


ARA.TH_E      ACAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_E      CCCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTC
RAT.NOR.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_E      T-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA
RAT.NOR.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_E      CAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_E      -CCGATC---TCAT-ATGAACCACCATTTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#798

Mean pairwise ID: 34.85%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


ARA.TH_F      CAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


ARA.TH_F      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTC
FUG.RUB.      CCGTACTAAGTTCGGTATCGATAT-GGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


ARA.TH_F      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
FUG.RUB.      CTAAGG-AGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCC


ARA.TH_F      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
FUG.RUB.      GCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA---


ARA.TH_F      -CCGATC---TCAT-ATGAACCACCATTTT
FUG.RUB.      CCTGAGTAACACAGCGGG-ACTCAGTCTTT


[Download ClustalW]

#799

Mean pairwise ID: 34.85%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_H      T-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_H      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_H      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_H      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_H      TTGCT---CCAA-TAAACAACCACCTTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#800

Mean pairwise ID: 34.85%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_B      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_B      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_B      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_B      AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_B      GCTGCT---CTAA-TTAAACCACCACTTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#801

Mean pairwise ID: 34.86%


ARA.TH_F      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG-TGGGGACATTAAGATGGTGGGACAC
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


ARA.TH_F      --TG--GTTCGGT--TCCTCG-GATC---GGTTCTGATGTGGGCATGTTTCTGAGC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


ARA.TH_F      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTC
TET.THE.      CCGCTCCAAACAATGAGTTGCTAT-GGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


ARA.TH_F      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
TET.THE.      TAAAGA-GCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTG


ARA.TH_F      CAGCAGTGGACGGATCACG-GTTTAGCGTCGC--TCAGAACCACTATGGCCTGCTGGT--
TET.THE.      TTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA


ARA.TH_F      CCGATC-TCAT-ATGAACCACCATTTT
TET.THE.      -CTATCA--AAGCCA-GACATT-----


[Download ClustalW]

#802

Mean pairwise ID: 34.86%


LYC.ES_B      GTC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA-TGGGGGCATTAATGTGGTGGAATG-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_B      -TTG--GGCTGTA--CCAGAT-GGTT---GGGCTTGGT--GGGCTAATTTCTGACT-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_B      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_B      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTA
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_B      AGCGGTGGAAGGATAACG-AGTCGGTGTTCT--CTGAGTCCAGTAATGCCTGATGG---G
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-


LYC.ES_B      CTGCT-CTAA-TTAAACCACCACTTTT
TET.THE.      CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#803

Mean pairwise ID: 34.90%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG-----CGGGGGCACTAAAGGTGGCTGC
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT----AGACAAGTGT-


ORY.SA_A      GGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT
CAE.BRI.      -GGATGGAGT--GAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC--GACCGAG


ORY.SA_A      -TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCT
CAE.BRI.      CG-TCCGTGCCAAGCGC-TGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCG


ORY.SA_A      TCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACT
CAE.BRI.      GGCG-----CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGC


ORY.SA_A      GCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGG
CAE.BRI.      CACCGCGCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CG


ORY.SA_A      CC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT-
CAE.BRI.      CCCACAG--CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#804

Mean pairwise ID: 34.93%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG-----CGGGGGCATTAAGGTGGTGTGG
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


ZEA.MA_F      ATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-
XEN.LAE.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC----GATCGGGT


ZEA.MA_F      TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTA
XEN.LAE.      G-TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGT


ZEA.MA_F      GAC-CT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
XEN.LAE.      TG-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-CCCC


ZEA.MA_F      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--C
XEN.LAE.      GTGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAA


ZEA.MA_F      AGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
XEN.LAE.      CAG-CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#805

Mean pairwise ID: 34.93%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


ZEA.MA_E      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
CAN.SPE.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GATCGGG


ZEA.MA_E      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
CAN.SPE.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_E      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCG
CAN.SPE.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_E      GCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
CAN.SPE.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_E      AGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
CAN.SPE.      CAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#806

Mean pairwise ID: 34.94%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_E      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_E      CCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_E      CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_E      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACAG--


LYC.ES_E      -GCTGTT---CTAG-TTAAACTACCACATTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT---


[Download ClustalW]

#807

Mean pairwise ID: 34.94%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_G      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_G      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_G      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_G      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAG--C


LYC.ES_G      GCTGCT---CCAA-TTAAACCACCACTTTT--
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#808

Mean pairwise ID: 34.94%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


ARA.TH_F      CAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_F      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTC
CAE.EL_C      CCGTGCCAAGCGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


ARA.TH_F      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.EL_C      ATAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCG


ARA.TH_F      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
CAE.EL_C      GTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---


ARA.TH_F      -CCGATC---TCAT-ATGAACCACCATTTT--
CAE.EL_C      CCTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#809

Mean pairwise ID: 34.94%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-----TGGGGGCAACAATGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_F      TG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-TG
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC-----GATCGGGTG-


LYC.ES_F      CCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCT
FUG.RUB.      TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCG


LYC.ES_F      TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT
FUG.RUB.      CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCC


LYC.ES_F      GTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATA
FUG.RUB.      GCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT---------GTAGTTCAA-


LYC.ES_F      G-GTTGCC----TAA-TTAAACCATCACTTTT
FUG.RUB.      -CCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#810

Mean pairwise ID: 34.94%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


ARA.TH_F      ACAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_F      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT
HOM.SA_A      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_F      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
HOM.SA_A      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_F      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
HOM.SA_A      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_F      T-CCGATC---TCAT-ATGAACCACCATTTT-
HOM.SA_A      -CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#811

Mean pairwise ID: 34.94%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


ARA.TH_F      ACAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_F      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT
RAT.RAT.      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_F      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
RAT.RAT.      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_F      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
RAT.RAT.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_F      T-CCGATC---TCAT-ATGAACCACCATTTT-
RAT.RAT.      -CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#812

Mean pairwise ID: 34.94%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG-----TGGGGACATTTAGATGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_E      CAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


ARA.TH_E      CCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT
CAE.EL_A      CCGTGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCA


ARA.TH_E      -AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTAC
CAE.EL_A      TAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


ARA.TH_E      AGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG---C


ARA.TH_E      CCGATC---TCAT-ATGAACCACCATTTT---
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#813

Mean pairwise ID: 34.94%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_O      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_O      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_O      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_O      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAG--C


LYC.ES_O      GCTGCT---CCAA-TTAAACCACCACTTT---
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#814

Mean pairwise ID: 34.94%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG-----TGAGGGCATCAGTGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_C      TG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


LYC.ES_C      CCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCC
CAE.EL_A      CCGTGCCAAGCGCTACGT-CACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGC


LYC.ES_C      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTG
CAE.EL_A      ATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


LYC.ES_C      TGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA--------CATACGCAG--C


LYC.ES_C      GCTGTT---CTAG-TTAAACTACCACATTT--
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#815

Mean pairwise ID: 34.95%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG-----TGGGGACAATAAGGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


ARA.TH_D      CAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


ARA.TH_D      CCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT
FUG.RUB.      CCGTACTAAGTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCC


ARA.TH_D      -AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTAC
FUG.RUB.      TAAGG-AGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


ARA.TH_D      AGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT-
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA---C


ARA.TH_D      TCGATC---TCTC-CTGGACCACCACTTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT


[Download ClustalW]

#816

Mean pairwise ID: 34.97%


ARA.TH_G      GTC-GAGCTATGTAACGAGAGCTTGTAACCCAAG-TGGGGACTATAAGATGGTGGAACAC
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


ARA.TH_G      --TG-GATCGGC--CCA-CG-GGTC---GGATTTGTTGTTGGCATAGGTCTGGAC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


ARA.TH_G      CAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT-
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


ARA.TH_G      AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTCA
TET.ROS.      AAGA-GCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


ARA.TH_G      GCAGTGGACGGACAACG-GTTCGACGCCAC--ACAAATCCACTATGGTCCGCTGGC--TC
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-C


ARA.TH_G      GTAA-CCCGC-TTGAACCACCATTTT
TET.ROS.      TATTC---TGATCA-GACACT-----


[Download ClustalW]

#817

Mean pairwise ID: 34.99%


ORY.SA_A      GCC-GAGCTCAGTAGCGAGAGCCTGTAACCCAAG-----CGGGGGCACTAAAGGTGGCTG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT----CTGATTGTGG


ORY.SA_A      CGGATGT-TTGGTGTGGATTCTG--ATCCTG-GGCCC-CATGTTGTTGTAATC-TTGCTG
DRO.MEL.      ---GATGGCCT--GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT--GACG


ORY.SA_A      GCT-TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTT
DRO.MEL.      GAACG-TCCGCACTAAGCTT-GCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATT


ORY.SA_A      GCTTCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATC
DRO.MEL.      CAGGTTG-----GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAG


ORY.SA_A      ACTGCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTC
DRO.MEL.      AGTTCCCGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------


ORY.SA_A      TGGCC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
DRO.MEL.      CGTTAT-CAG--CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#818

Mean pairwise ID: 35.00%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG-----CGGGGGCACTAAAGGTGGCTGC
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC----TTGGGCTGTC-


ORY.SA_A      GGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT
XEN.LAE.      -GGATCGCTT--GAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC--GATCGGG


ORY.SA_A      -TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCT
XEN.LAE.      TG-TCCGCACTAAGTTC-GGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAG


ORY.SA_A      TCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACT
XEN.LAE.      GTTG----CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC


ORY.SA_A      GCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGG
XEN.LAE.      CCCCGTGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------C


ORY.SA_A      CC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
XEN.LAE.      AGAACAG--CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#819

Mean pairwise ID: 35.01%


ZEA.MA_F      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCTAAG-----CGGGGGCATTAAGGTGGTGTG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ZEA.MA_F      GATGT-TTCC--TGACGGA----TTCTG-GGCCT-GGGCTTGT-ATGTGCCACTGGCCGG
DRO.MEL.      -GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGG


ZEA.MA_F      CC-TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-
DRO.MEL.      AACG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCA


ZEA.MA_F      TTAGACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGC
DRO.MEL.      GGTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGT-TC


ZEA.MA_F      CCGCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC-
DRO.MEL.      CCGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTA


ZEA.MA_F      -CAGAG-CC-TCA---TTAA-ACAGACCACCATCTTT
DRO.MEL.      T-CAG-CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#820

Mean pairwise ID: 35.02%


CAE.EL_A      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT-AGATAAGTGTGGAT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA------TATGTGGCATAAACAATGT--AG


CAE.EL_A      GGAGTGAGAGGAGGAGTCCTGTGTATG----TCGTTG-TCTACGTCGACCGAGCGTCCGT
TET.THE.      GTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGC


CAE.EL_A      GCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAG
TET.THE.      TCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAG


CAE.EL_A      GAGTCGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
TET.THE.      AGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTG


CAE.EL_A      GCCGGACCGCGCTTGTGA-GTTGA--CACA--CATACGCAG----CCTTCTCGATACCTT
TET.THE.      GAAGGATAACATACTCA-TTAACTGTCAA-ACTAAT-CG-GTTCTA-CTATCA----AAG


CAE.EL_A      CAGACCACTTATCATTT
TET.THE.      CCAGACATT--------


[Download ClustalW]

#821

Mean pairwise ID: 35.03%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


ZEA.MA_G      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
RAT.RAT.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_G      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
RAT.RAT.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_G      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCG
RAT.RAT.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG


ZEA.MA_G      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
RAT.RAT.      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCC


ZEA.MA_G      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
RAT.RAT.      AG-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#822

Mean pairwise ID: 35.05%


ARA.TH_A      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_A      CAC-TG---GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_A      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTC
CAE.EL_B      CCGTGCCAAGCGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


ARA.TH_A      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.EL_B      ATAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCG


ARA.TH_A      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG-
CAE.EL_B      GTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--C


ARA.TH_A      TCCGAT---CTCATATGAACCACCATTTT--
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#823

Mean pairwise ID: 35.05%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG------TGGGGACATTTAGATGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


ARA.TH_E      ACAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_E      CCCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTC
RAT.RAT.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_E      T-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA
RAT.RAT.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_E      CAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_E      -CCGATC---TCAT-ATGAACCACCATTTT-
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#824

Mean pairwise ID: 35.05%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_G      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_G      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_G      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_G      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACAG--


LYC.ES_G      -GCTGCT---CCAA-TTAAACCACCACTTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#825

Mean pairwise ID: 35.05%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_E      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_E      CCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_E      T-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_E      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--C


LYC.ES_E      GCTGTT---CTAG-TTAAACTACCACATTTT
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#826

Mean pairwise ID: 35.05%


HUM.JA_B      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


HUM.JA_B      CT--TTA--GTTCGGC--CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.JA_B      CCATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.JA_B      T-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTC
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.JA_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTGAG-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


HUM.JA_B      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#827

Mean pairwise ID: 35.05%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG-----TGGGGACAATAAGGTGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


ARA.TH_D      CAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


ARA.TH_D      CCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT
CAE.BRI.      CCGTGCCAAGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCA


ARA.TH_D      -AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTAC
CAE.BRI.      TAAGG-AGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


ARA.TH_D      AGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT-
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG---C


ARA.TH_D      TCGATC---TCTC-CTGGACCACCACTTT--
CAE.BRI.      CTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#828

Mean pairwise ID: 35.05%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG-----TGGGGACATTTAGATGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


ARA.TH_E      CAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_E      CCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT
CAE.EL_C      CCGTGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCA


ARA.TH_E      -AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTAC
CAE.EL_C      TAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


ARA.TH_E      AGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


ARA.TH_E      CCGATC---TCAT-ATGAACCACCATTTT--
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#829

Mean pairwise ID: 35.06%


TRI.AE_B      NCC-GAGCT-AGTTGCGGGAGCTTGTCACCCATG-TGGGGGCATTGAGGCGGTGTGGATG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A


TRI.AE_B      C-TTG-GTGCGGT---TTGTT-GGCCT--GGGCTTGTGATGTAACCTTGCTGGCC-TGCC
TET.ROS.      GTTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT---AAGAGTGTG-CC


TRI.AE_B      CGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-CT-
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


TRI.AE_B      TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCCAA
TET.ROS.      AAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATTG


TRI.AE_B      CGGTGGAAGGATAACA-GGCCGCTGCAGC--ATGGGCCCGCTCTGGGCCTCCTA-----C
TET.ROS.      TGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAAT-CG-GTTCTG-


TRI.AE_B      CCCGC-CAT-A-GCAGACCACCATCTTT
TET.ROS.      CTATTC---TGATCA-GACACT------


[Download ClustalW]

#830

Mean pairwise ID: 35.12%


ZEA.MA_G      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCG
DRO.MEL.      GACTGGAAGG-TTGGCA-GCTTCTGTAATCA-CGCTTCTGTGAGGT---CTGATTGTGG-


ZEA.MA_G      GATTC-TTTG--CGATGGCT---TTCTG-GGCCC-GGGCTCGCTATGTGCCTTTGGCCGG
DRO.MEL.      -GATGGCCT-GAGGCTGGGATCTACTGCGTAGCGG-ACCAG--CTCATGTT----GACGG


ZEA.MA_G      CC-TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-
DRO.MEL.      AACG-TCCGCACTAAGCTTGCCAT-CAATATGGGTGCCATGGAGGAGTCCGTGGCATTCA


ZEA.MA_G      CCAGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCC
DRO.MEL.      GGTTG-GCTAAGGAGGGATGAACCGGGCCAGGGGTGAA--AACCAGCAGCCAAGAGTTCC


ZEA.MA_G      CGCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-
DRO.MEL.      CGTGGTAGGCAGTAGTGGGATA-GCGTACCG--GA-GTGGA--CTGC-------CGTTAT


ZEA.MA_G      CAGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
DRO.MEL.      -CAG-CCCAACCGATATGGTTGG-ACCACAATCTTT


[Download ClustalW]

#831

Mean pairwise ID: 35.14%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG-----TGGGGGCAACAATGTGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


LYC.ES_F      TG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-TG
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC-----GACCGAGCG-


LYC.ES_F      CCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCT
CAE.BRI.      TCCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCG


LYC.ES_F      TT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCT
CAE.BRI.      CATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCG


LYC.ES_F      GTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGATA
CAE.BRI.      GTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT---------CGCCCACAG-


LYC.ES_F      G-GTTGCC----TAA-TTAAACCATCACTTTT-
CAE.BRI.      -CCTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#832

Mean pairwise ID: 35.14%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG------TGGGGGCAACAATGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_F      ATG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-T
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC-----GATCGGGTG


LYC.ES_F      GCCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCC
RAT.NOR.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


LYC.ES_F      TTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC
RAT.NOR.      GCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


LYC.ES_F      TGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGAT
RAT.NOR.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG---------CACTCCAG


LYC.ES_F      AG-GTTGCC----TAA-TTAAACCATCACTTTT
RAT.NOR.      --CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#833

Mean pairwise ID: 35.14%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGT-G
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG-----TGGGGGCATTAAAGTGATGTGA


CAE.EL_C      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCAACGTC---GACCGAGCG
TRI.AE_A      ACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-C


CAE.EL_C      -TCCGTGCCAAGCGC-TGCGT-CACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGG
TRI.AE_A      GCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CG


CAE.EL_C      GTGCATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGC
TRI.AE_A      GTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGC


CAE.EL_C      GCGGTGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG
TRI.AE_A      TTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGCA


CAE.EL_C      -CCTTCTCAATACCTTCAG-ACCACTTGTCACT
TRI.AE_A      G--CCTAC---TCCA-GCAGACCACC-------


[Download ClustalW]

#834

Mean pairwise ID: 35.14%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG------TGGGGGCAACAATGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_F      ATG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-T
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC-----GATCGGGTG


LYC.ES_F      GCCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCC
CAN.SPE.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


LYC.ES_F      TTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC
CAN.SPE.      GCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


LYC.ES_F      TGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGAT
CAN.SPE.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG---------CACTCCAG


LYC.ES_F      AG-GTTGCC----TAA-TTAAACCATCACTTTT
CAN.SPE.      --CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#835

Mean pairwise ID: 35.14%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGT-CTGATTGTGGGATGGC
TET.THE.      GCCAGGGTAG-CA---ATACCTGTGTCTA------TATGTGGCATAAACAATGT-AGGTT


DRO.MEL.      CTGAGGCTGGGATCTACTGCGTAGCGG--ACCAG--CTCATGTTGACGGAACGTCCGCAC
TET.THE.      --GTGATAGATA-GGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTC


DRO.MEL.      TAAGCTTGCCATCAATATGGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGA
TET.THE.      CAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAGAG


DRO.MEL.      GGGATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGTAGGCAGTAGT
TET.THE.      CTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTGGA


DRO.MEL.      GGGATAGCGTACCGGA-GTGGA--CTGC-CGTTAT-CAG----CCCAACCGATATGGTTG
TET.THE.      AGGATAACATACTCA-TTAACTGTCAA-ACTAAT-CG-GTTCTA-CTATCA----AAGCC


DRO.MEL.      GACCACAATCTTT
TET.THE.      AGACATT------


[Download ClustalW]

#836

Mean pairwise ID: 35.15%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_K      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_K      CCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_K      T-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_K      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_K      TTGCT---CCAA--TAAACAACCACCTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#837

Mean pairwise ID: 35.15%


LYC.ES_B      GTCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_B      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_B      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_B      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_B      AAGCGGTGGAAGGATAACG-AGTCGGTG-TTCT--CTGAGTCCAGTAATGCC-TGATGG-
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_B      GCTGCT---CTAA-TTAAACCACCACTTTT
HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#838

Mean pairwise ID: 35.15%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG-----TGGGGACTATAAGATGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


ARA.TH_G      CAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


ARA.TH_G      CCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTG-C
XEN.LAE.      CCGCACTAAGTTCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCT


ARA.TH_G      T-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
XEN.LAE.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


ARA.TH_G      CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG---


ARA.TH_G      -TCGTAA--CCCGC-TTGAACCACCATTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT-


[Download ClustalW]

#839

Mean pairwise ID: 35.15%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG------TGGGGACATTTAGATGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


ARA.TH_E      ACAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_E      CCCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTC
CAN.SPE.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_E      T-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA
CAN.SPE.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_E      CAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_E      -CCGATC---TCAT-ATGAACCACCATTTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#840

Mean pairwise ID: 35.15%


LYC.ES_I      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_I      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_I      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_I      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAG-TTTCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_I      AAGCGGTGGAAGGATAACG-AGTCGGTGTTCT---CTGAGTCCAGTAACGCC-TGATGG-
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_I      GTTGCT---CCAA-TTAAACCACCATTTTT
HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#841

Mean pairwise ID: 35.15%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG------TGGGGACTATAAGATGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


ARA.TH_G      ACAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_G      CCCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGC
ORI.CUN.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_G      T-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
ORI.CUN.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_G      CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_G      -TCGTAA--CCCGC-TTGAACCACCATTTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#842

Mean pairwise ID: 35.16%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAGTGGAGACATCAAAGTGGTTGAATATTG
TRI.AE_C      ------------------------------------------------------------


LYC.ES_H      GGCTGTACCAGATGGTTGGGCTTGGTGGGCTAATTTCTGACTTGCCCTATCCAAGCTT-A
TRI.AE_C      -----------------------------------GGTGGTCTGCCCGTTCCAAGTTGAG


LYC.ES_H      GAGTTGGATCA-TGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT-AAAGTGGGGCG
TRI.AE_C      TAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATGTGGCAGG


LYC.ES_H      GAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA
TRI.AE_C      CACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAGGA


LYC.ES_H      TAATGGGTCGGTGTCTT-ATCAAGTTC-AGTAACGCCTAATGGGTTGCTCCAA-TAAACA
TRI.AE_C      TAACGGGCCGCTG-CACT-CCTAGGCCGCT-TGGGCCTCGTAG-CCTA-CTCCAGC-GAC


LYC.ES_H      ACCACCTTTT
TRI.AE_C      CACCATC---


[Download ClustalW]

#843

Mean pairwise ID: 35.18%


CAE.BRI.      ACC-GGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.BRI.      GAGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAG
TRY.BR_A      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.BRI.      CGCTGCGTCGCCAG-GGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
TRY.BR_A      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.BRI.      GTGCAC-GGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCG-GTGCAGTGGCCG
TRY.BR_A      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAG


CAE.BRI.      GATAGCGCTTGTGAGTTGT--CGCT-CGCCCACAG-CCTCTCTGATACCTTCAGACCACT
TRY.BR_A      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.BRI.      TGTCATT
TRY.BR_A      G------


[Download ClustalW]

#844

Mean pairwise ID: 35.18%


CAE.EL_C      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.EL_C      GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
TRY.BR_B      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.EL_C      CGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTG
TRY.BR_B      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.EL_C      GTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCG-GTGCAGTGGCCG
TRY.BR_B      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAG


CAE.EL_C      GACAGCGCTTGTGAGTTGA--CACG-TATACACAG-CCTTCTCAATACCTTCAGACCACT
TRY.BR_B      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.EL_C      TGTCACT
TRY.BR_B      GTTT---


[Download ClustalW]

#845

Mean pairwise ID: 35.22%


ORI.CUN.      GCC-GGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGCCGGAG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---------CGTGTGGCATAAACAATGT-


ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG-----TCGTGC-GCTATGCCGATCGGGTGTC
TET.ROS.      --AGTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


ORI.CUN.      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


ORI.CUN.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.ROS.      AAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTG


ORI.CUN.      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGGGCAACA
TET.ROS.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--GCTAAT-CG-GTTCTG-CTATTC---


ORI.CUN.      TAGCGAGACCCTGTCTCC
TET.ROS.      -TGATCAGACACT-----


[Download ClustalW]

#846

Mean pairwise ID: 35.22%


GAL.GAL.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGCCCGCCG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---------TATGTGGCATAAACAATGT-


GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG-----CAGTGC-GCTATGCCGAGCGGGCGTC
TET.THE.      -AGGTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


GAL.GAL.      CGCGCTAAGGCCGGCATCAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCT
TET.THE.      CGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTA


GAL.GAL.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCCGGTCA
TET.THE.      AAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTG


GAL.GAL.      GTAACGGGATCGCGCCTGTGA-ATAGC--CACTG---CAGCGTAG----CCTGGGCAACA
TET.THE.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--ACTAAT-CG-GTTCTA-CTATCA---


GAL.GAL.      TAGCGAGACCCTGTCTCC
TET.THE.      -AAGCCAGACATT-----


[Download ClustalW]

#847

Mean pairwise ID: 35.22%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


ZEA.MA_E      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
HOM.SA_A      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_E      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
HOM.SA_A      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_E      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCG
HOM.SA_A      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_E      GCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
HOM.SA_A      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_E      AGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
HOM.SA_A      CAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#848

Mean pairwise ID: 35.22%


ZEA.MA_B      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGCGCGG
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


ZEA.MA_B      ATGC-TTTG--CGATGGT---TTCTG-GGCCTGGGCTCGT--TGTGACTCTAGCCGGCT-
XEN.LAE.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC----GATCGGGT


ZEA.MA_B      TGCCCATCCCAAGTTGGTAGTGTCTGACGGGG-CTCTAGCGAAAGCTTTGGGTCTCTG-C
XEN.LAE.      G-TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCT-CGGATCACCAGG


ZEA.MA_B      AGAC-CT-ACAGCGGCAGGAATGGCGTAAGGCTGGCTTCACAGAGCAGCGATCACTCGCC
XEN.LAE.      TTG-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-CCC


ZEA.MA_B      CACTTCCAACGGTGGGAGGATAACA-AGCCGCTG-CACT--TTGAGCCCAACACAGACC-
XEN.LAE.      CGTGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGA


ZEA.MA_B      CAGATCC-TCT---CTTA-GCAAACCACCATCTTT
XEN.LAE.      ACAGCCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#849

Mean pairwise ID: 35.22%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


ZEA.MA_E      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
HOM.SA_B      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATGGGG


ZEA.MA_E      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
HOM.SA_B      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_E      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCG
HOM.SA_B      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_E      GCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
HOM.SA_B      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_E      AGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
HOM.SA_B      CAG-CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#850

Mean pairwise ID: 35.22%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


ZEA.MA_D      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
HOM.SA_A      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_D      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
HOM.SA_A      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_D      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
HOM.SA_A      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_D      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
HOM.SA_A      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_D      AGAG-CC-TCA---CTAA-GCAGACCACCATCTT-
HOM.SA_A      CAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#851

Mean pairwise ID: 35.24%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG-----TGGGGACTATAAGATGGTGGAA
CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_G      CAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGC
CAE.EL_D      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTCG-TCTACGTC----GACCGAGCG-T


ARA.TH_G      CCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT
CAE.EL_D      CCGTGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCA


ARA.TH_G      -AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_D      TAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


ARA.TH_G      AGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC-
CAE.EL_D      TGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG---C


ARA.TH_G      TCGTAA--CCCGC-TTGAACCACCATTTT---
CAE.EL_D      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#852

Mean pairwise ID: 35.24%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG-----TGGGGACAATAAGGTGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_D      CAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


ARA.TH_D      CCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT
CAE.EL_A      CCGTGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCA


ARA.TH_D      -AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTAC
CAE.EL_A      TAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


ARA.TH_D      AGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG---C


ARA.TH_D      TCGATC---TCTC-CTGGACCACCACTTT---
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#853

Mean pairwise ID: 35.26%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_K      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_K      CCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_K      T-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_K      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CC


LYC.ES_K      TTGCT---CCAA--TAAACAACCACCTTT
FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#854

Mean pairwise ID: 35.26%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG------TGGGGGCATTGAGGCGGTGTG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-


TRI.AE_B      GATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-T
RAT.NOR.      GGATCGATTGAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGTG


TRI.AE_B      GCCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-
RAT.NOR.      -TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


TRI.AE_B      CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


TRI.AE_B      CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-C
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAGCC


TRI.AE_B      CCCGC--CAT-A-GCAGACCACCATCTTT
RAT.NOR.      TGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#855

Mean pairwise ID: 35.26%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_H      T-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_H      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_H      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTG
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_H      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CC


LYC.ES_H      TTGCT---CCAA-TAAACAACCACCTTTT
FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#856

Mean pairwise ID: 35.26%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_O      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_O      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_O      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_O      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCAA--C


LYC.ES_O      GCTGCT---CCAA-TTAAACCACCACTTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT


[Download ClustalW]

#857

Mean pairwise ID: 35.26%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG------TGGGGGCATTGAGGCGGTGTG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-


TRI.AE_B      GATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-T
ORI.CUN.      GGATCGCTTGAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC---GATCGGGTG


TRI.AE_B      GCCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-
ORI.CUN.      -TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


TRI.AE_B      CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


TRI.AE_B      CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-C
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAGCC


TRI.AE_B      CCCGC--CAT-A-GCAGACCACCATCTTT
ORI.CUN.      TGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#858

Mean pairwise ID: 35.28%


ARA.TH_E      GTC-GAGCTAAGTAACATGAGCTTGTAACCCATG-TGGGGACATTTAGATGGTGGAACAC
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


ARA.TH_E      --TG--GTTCGGG--TCCACG-GGCC---GGTTCTGTTGTTGGCATGTTTCTGGGC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


ARA.TH_E      CCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT
TET.THE.      CCGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATT


ARA.TH_E      -AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTAC
TET.THE.      AAAGA-GCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


ARA.TH_E      AGCAGTGGACGGATCACA-GTTTAGCGTCGC--TCAGAACCACTATGGCCTGCTGGT--C
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-


ARA.TH_E      CGATC-TCAT-ATGAACCACCATTTT
TET.THE.      CTATCA--AAGCCA-GACATT-----


[Download ClustalW]

#859

Mean pairwise ID: 35.28%


LYC.ES_B      GTC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA-TGGGGGCATTAATGTGGTGGAATG-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_B      -TTG-GGCTGTA--CCAGAT-GGTT---GGGCTTGGT--GGGCTAATTTCTGACT-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_B      CTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCGT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_B      -AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAACGATAAGTTTCCGCTCTAA
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_B      GCGGTGGAAGGATAACG-AGTCGGTGTTCT--CTGAGTCCAGTAATGCCTGATGG---GC
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-C


LYC.ES_B      TGCT-CTAA-TTAAACCACCACTTTT
TET.ROS.      TATTC--TGATCA-GACACT------


[Download ClustalW]

#860

Mean pairwise ID: 35.28%


ARA.TH_F      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG-TGGGGACATTAAGATGGTGGGACAC
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


ARA.TH_F      --TG-GTTCGGT--TCCTCG-GATC---GGTTCTGATGTGGGCATGTTTCTGAGC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


ARA.TH_F      CAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTCT
TET.ROS.      CGTTCCAAACAGTGAGTTGCTAT-GGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


ARA.TH_F      -AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTAC
TET.ROS.      AAAGA-GCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTAT


ARA.TH_F      AGCAGTGGACGGATCACG-GTTTAGCGTCGC--TCAGAACCACTATGGCCTGCTGGT--C
TET.ROS.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-


ARA.TH_F      CGATC-TCAT-ATGAACCACCATTTT
TET.ROS.      CTATTC--TGATCA-GACACT-----


[Download ClustalW]

#861

Mean pairwise ID: 35.29%


ORY.SA_A      GCCGAGCTCAGTAGCGAGAGCCTGTAACCCAAG-----CGGGGGCACTAAAGGTGGCTGC
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC----TGAGGCTGGC-


ORY.SA_A      GGATGT-TTGGTGTGGATTCTG-ATCCTG-GGCCCCATGTTGTTGTAATC-TTGCTGGCT
FUG.RUB.      -GGATCGCTT--GAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC--GATCGGG


ORY.SA_A      -TGCCCGTTCCAAGTTGCGTAGTGGGCCGGAGGGGCTTTGGCGAAGGCCTTTGCTTTGCT
FUG.RUB.      TG-TCCGTACTAAGTTC-GGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAG


ORY.SA_A      TCTCCGGCCCT-AAAGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGATCACT
FUG.RUB.      GTCG-----CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGC


ORY.SA_A      GCCCGCTTCCATCGGTGGAAGGATAACA-GGCTGCTG-CACC--TTGGGCCCGCTTCTGG
FUG.RUB.      CCCCGTGCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GT


ORY.SA_A      CC-CAGAGT-CCCTCT---ACAA--CAGACCACCATCTTT
FUG.RUB.      AGTTCAA--CCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#862

Mean pairwise ID: 35.33%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


ZEA.MA_G      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
CAN.SPE.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GATCGGG


ZEA.MA_G      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
CAN.SPE.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_G      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCG
CAN.SPE.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG


ZEA.MA_G      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
CAN.SPE.      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCC


ZEA.MA_G      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
CAN.SPE.      AG-CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#863

Mean pairwise ID: 35.33%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


ZEA.MA_D      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
CAN.SPE.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC----GATCGGG


ZEA.MA_D      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
CAN.SPE.      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_D      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
CAN.SPE.      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_D      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
CAN.SPE.      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_D      AGAG-CC-TCA---CTAA-GCAGACCACCATCTT
CAN.SPE.      CAG-CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#864

Mean pairwise ID: 35.33%


ZEA.MA_F      NCCGAGCTCTGTAGCGAGAGCTTGTAACCTAAG-----CGGGGGCATTAAGGTGGTGTGG
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G


ZEA.MA_F      ATGT-TTCC--TGACGGA---TTCTG-GGCCTGGGCTTGT-ATGTGCCACTGGCCGGCC-
FUG.RUB.      GATCGCTT-GAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC----GATCGGGT


ZEA.MA_F      TGCCCGTTCCAAGTTGGTTGTGGCTGGTGGGG-CTCGGGCGAAGGCCTGGGCCTCT-TTA
FUG.RUB.      G-TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGT


ZEA.MA_F      GACCT-GAAGCGGCAGGCATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCCG
FUG.RUB.      CG-CCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGC-CCCCG


ZEA.MA_F      CTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CATT--GCAAGCCCAACTCGGTC--CA
FUG.RUB.      TGCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTC


ZEA.MA_F      GAG-CC-TCA---TTAA-ACAGACCACCATCTTT
FUG.RUB.      AA-CCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#865

Mean pairwise ID: 35.33%


CAE.EL_D      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT-AGATAAGTGTGGAT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA------TATGTGGCATAAACAATGT--AG


CAE.EL_D      GGAGTGAGAGGAGGAGTCCTGTGTATG----TCGTCG-TCTACGTCGACCGAGCGTCCGT
TET.THE.      GTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGC


CAE.EL_D      GCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAG
TET.THE.      TCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAG


CAE.EL_D      GAGTCGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTGGTGCAGTG
TET.THE.      AGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTG


CAE.EL_D      GCCGGACCGCGCTTGTAA-GTTGA--CACA--CATACACAG----CCTTCTCGATACCTT
TET.THE.      GAAGGATAACATACTCA-TTAACTGTCAA-ACTAAT-CG-GTTCTA-CTATCA----AAG


CAE.EL_D      CAGACCACTTATCATTT
TET.THE.      CCAGACATT--------


[Download ClustalW]

#866

Mean pairwise ID: 35.33%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG-----TGGGGGCATTAAAGTGATGTGA


CAE.EL_D      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTCG-TCTACGTC---GACCGAGCG
TRI.AE_A      ACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-C


CAE.EL_D      -TCCGTGCCAAGCGC-TACGT-CACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGG
TRI.AE_A      GCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CG


CAE.EL_D      GTGCATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGC
TRI.AE_A      GTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGC


CAE.EL_D      GTGGTGCAGTGGCCGGACC-GCGCTTGT--AA-GTTGA--CACA-------CATACACAG
TRI.AE_A      TTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGCA


CAE.EL_D      -CCTTCTCGATACCTTCAG-ACCACTTATCATTT
TRI.AE_A      G--CCTAC---TCCA-GCAGACCACC--------


[Download ClustalW]

#867

Mean pairwise ID: 35.35%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAG-----TGAGGGTATCAAAGTGGTTGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


CIN.HYB.      CT--TTGA--GCTTGGC--TTAGCT-AGTTGGGTCTGTA--GACACCGCACCTGGCT-TG
FUG.RUB.      ATCGCTT-GAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-


CIN.HYB.      CCCGTTCCAAGTCGAGAGTGGGTTCATGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCT
FUG.RUB.      TCCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCG


CIN.HYB.      TT-AGAATCGGGGGGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTC
FUG.RUB.      CCTAAGG-AGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGC


CIN.HYB.      TCGACTGTGGAAGGATTACA-AGCCGGAGTGTC---TTAGGCTCATATAACCAG--CCTG
FUG.RUB.      CGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCAA-


CIN.HYB.      G--CTAGC---CCAA-CAGGACACCCATTT-
FUG.RUB.      -CCTGAGTAACACAGCGGG-ACTCAGTCTTT


[Download ClustalW]

#868

Mean pairwise ID: 35.35%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG------TGAGGGCATCAGTGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_C      ATG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_C      CCCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_C      CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_C      GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_C      -GCTGTT---CTAG-TTAAACTACCACATTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#869

Mean pairwise ID: 35.35%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG------TGAGGGCATCAGTGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_C      ATG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_C      CCCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_C      CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_C      GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_C      -GCTGTT---CTAG-TTAAACTACCACATTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#870

Mean pairwise ID: 35.35%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG------TGGGGACATTTAGATGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


ARA.TH_E      ACAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_E      CCCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTC
HOM.SA_A      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_E      T-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA
HOM.SA_A      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_E      CAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_E      -CCGATC---TCAT-ATGAACCACCATTTT-
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#871

Mean pairwise ID: 35.35%


HUM.LU_C      ---GGTCTTAGCAACTTGGTCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


HUM.LU_C      CT--TTG--GGTCAAC--CCAGTG-GTNCGGGNCCAGTGCTAGCTGCTTACCCGGC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


HUM.LU_C      CCATTCCAAGCCGGGAGGTGGGCTGAGGGACCTGGGCGAAGGCTNNNGGNGCGCA-CTCC
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


HUM.LU_C      T-AGACTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


HUM.LU_C      GGCAGTGGAAGGATAACG-GGCCGGTG-CGCC--TTGAGCCAACACTGTTC-AACTGGG-
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG---C


HUM.LU_C      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.BRI.      CTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#872

Mean pairwise ID: 35.35%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


ARA.TH_F      CAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


ARA.TH_F      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT-
XEN.LAE.      CCGCACTAAGTTCGGTATCAATAT-GGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


ARA.TH_F      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
XEN.LAE.      TCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGC


ARA.TH_F      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
XEN.LAE.      CGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--


ARA.TH_F      T-CCGATC---TCAT-ATGAACCACCATTTT
XEN.LAE.      -CCTGAACAACACAGCGAG-ACACAGTTCT-


[Download ClustalW]

#873

Mean pairwise ID: 35.44%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG------TGGGGGCAACAATGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_F      ATG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-T
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC-----GATCGGGTG


LYC.ES_F      GCCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCC
HOM.SA_A      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


LYC.ES_F      TTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC
HOM.SA_A      GCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


LYC.ES_F      TGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGAT
HOM.SA_A      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG---------CACTCCAG


LYC.ES_F      AG-GTTGCC----TAA-TTAAACCATCACTTTT
HOM.SA_A      --CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#874

Mean pairwise ID: 35.44%


CAE.EL_B      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT-AGATAAGTGTGGAT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA------TATGTGGCATAAACAATGT--AG


CAE.EL_B      GGAGTGAGAGGAGGAGTCCTGTGTATG----TCGTTG-TCAACGTCGACCGAGCGTCCGT
TET.THE.      GTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGC


CAE.EL_B      GCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG
TET.THE.      TCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAG


CAE.EL_B      GAGTGGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
TET.THE.      AGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTG


CAE.EL_B      GCCGGACTGCGCTTGTGA-GTTGA--CACG--TATACACAG----CCTTCTCAATACCTT
TET.THE.      GAAGGATAACATACTCA-TTAACTGTCAA-ACTAAT-CG-GTTCTA-CTATCA----AAG


CAE.EL_B      CAGACCACTTGTTTTT
TET.THE.      CCAGACATT-------


[Download ClustalW]

#875

Mean pairwise ID: 35.44%


CAE.BRI.      ACC-GGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGT-AGACAAGTGTGGAT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA------TATGTGGCATAAACAATGT--AG


CAE.BRI.      GGAGTGAAGGGAGGAGTCCTGTGGGTG----TTGTCG-GCAACGGCGACCGAGCGTCCGT
TET.THE.      GTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGC


CAE.BRI.      GCCAAGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAG
TET.THE.      TCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAG


CAE.BRI.      GAGTGGTGCAC-GGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTG
TET.THE.      AGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTG


CAE.BRI.      GCCGGATAGCGCTTGTGA-GTTGT--CGCT--CGCCCACAG----CCTCTCTGATACCTT
TET.THE.      GAAGGATAACATACTCA-TTAACTGTCAA-ACTAAT-CG-GTTCTA-CTATCA----AAG


CAE.BRI.      CAGACCACTTGTCATT
TET.THE.      CCAGACATT-------


[Download ClustalW]

#876

Mean pairwise ID: 35.44%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG------TGGGGGCAACAATGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_F      ATG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-T
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC-----GATCGGGTG


LYC.ES_F      GCCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCC
RAT.RAT.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


LYC.ES_F      TTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC
RAT.RAT.      GCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


LYC.ES_F      TGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGAT
RAT.RAT.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG---------CACTCCAG


LYC.ES_F      AG-GTTGCC----TAA-TTAAACCATCACTTTT
RAT.RAT.      --CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#877

Mean pairwise ID: 35.44%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG------TGGGGGCAACAATGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_F      ATG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-T
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC-----GATCGGGTG


LYC.ES_F      GCCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCC
ORI.CUN.      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


LYC.ES_F      TTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC
ORI.CUN.      GCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


LYC.ES_F      TGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGAT
ORI.CUN.      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG---------CACTCCAG


LYC.ES_F      AG-GTTGCC----TAA-TTAAACCATCACTTTT
ORI.CUN.      --CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#878

Mean pairwise ID: 35.44%


ZEA.MA_C      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGTG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


ZEA.MA_C      GATGC-TTG---GTACCGT--GTCTT-TGCCTGGGTTCATGGTGTGCCTTTGTTGGCC-T
HOM.SA_B      GGATCGCTTGAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATGGGGTG


ZEA.MA_C      GCCCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTG
HOM.SA_B      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGG-GGGACCACCAGGT


ZEA.MA_C      GACCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGC
HOM.SA_B      TG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGT


ZEA.MA_C      TATTAACGGTGGAAGGATAACA-GGCCACTG-CAGC--ATGGGCTCGCTTAAGGCC-TAG
HOM.SA_B      GCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCA


ZEA.MA_C      ACTTC-ATA---CTAAAGCAGACCACCATTTTT
HOM.SA_B      G-CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#879

Mean pairwise ID: 35.45%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_J      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_J      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_J      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_J      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_J      TTGCT---CCAA--TAAACAACCACCTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#880

Mean pairwise ID: 35.45%


ZEA.MA_C      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGTGGATG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


ZEA.MA_C      C-TTG---GTACCGT--GTCTT-TGCCT--GGGTTCATGGTGTGCCTTTGTTGGCC-TGC
TET.THE.      GTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT---AAGAGTGTG-C


ZEA.MA_C      CCGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGGA
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAG-GACTCCACCAGGGCA


ZEA.MA_C      CCT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTA
TET.THE.      -TTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTT


ZEA.MA_C      TTAACGGTGGAAGGATAACA-GGCCACTGCAGC--ATGGGCTCGCTTAAGGCCTAGAC--
TET.THE.      GTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------ACTAATCG-GTTC


ZEA.MA_C      -TTC-ATA-CTAAAGCAGACCACCATTTTT
TET.THE.      TA-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#881

Mean pairwise ID: 35.45%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_O      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_O      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_O      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_O      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACAG--


LYC.ES_O      -GCTGCT---CCAA-TTAAACCACCACTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT-


[Download ClustalW]

#882

Mean pairwise ID: 35.45%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_G      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_G      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_G      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_G      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCAA--C


LYC.ES_G      GCTGCT---CCAA-TTAAACCACCACTTTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#883

Mean pairwise ID: 35.45%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


LYC.ES_H      T-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


LYC.ES_H      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTCG
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


LYC.ES_H      T-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


LYC.ES_H      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--CC


LYC.ES_H      TTGCT---CCAA-TAAACAACCACCTTTT-
CAE.BRI.      TCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#884

Mean pairwise ID: 35.45%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG------TGGGGACAATAAGGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


ARA.TH_D      ACAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


ARA.TH_D      CCCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_D      T-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA
HOM.SA_B      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_D      CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_D      -TCGATC---TCTC-CTGGACCACCACTTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#885

Mean pairwise ID: 35.45%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAGATGGG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


HUM.JA_A      ACT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


HUM.JA_A      CCCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


HUM.JA_A      CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


HUM.JA_A      CGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CAGCGTAG---C


HUM.JA_A      TGCACT--CTTAA-TCAGACCATCTCTTTT
GAL.GAL.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#886

Mean pairwise ID: 35.45%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_A      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_A      CCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_A      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCTG
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_A      TGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_A      TTGCT---CCAA--TAAACAACCACCTTT-
CAE.EL_C      TTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#887

Mean pairwise ID: 35.45%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG------TGGGGACTATAAGATGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


ARA.TH_G      ACAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_G      CCCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGC
RAT.NOR.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_G      T-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
RAT.NOR.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_G      CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_G      -TCGTAA--CCCGC-TTGAACCACCATTTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#888

Mean pairwise ID: 35.45%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


HUM.LU_B      AC-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_B      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_B      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTC
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.LU_B      CTGACT--CTTAA-TCGGACCATTTCCTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#889

Mean pairwise ID: 35.50%


CAE.EL_B      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.EL_B      GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
TRY.BR_B      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.EL_B      CGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAGGAGTG
TRY.BR_B      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.EL_B      GTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCG-GTGCAGTGGCCG
TRY.BR_B      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAG


CAE.EL_B      GACTGCGCTTGTGAGTTGA--CACG-TATACACAG-CCTTCTCAATACCTTCAGACCACT
TRY.BR_B      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.EL_B      TGTTTTT
TRY.BR_B      GTTT---


[Download ClustalW]

#890

Mean pairwise ID: 35.50%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
TRY.BR_A      AGCCGGAGCG-CAT--TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT-AGCGGG


DRO.MEL.      TGAGGCTGGGATCTACTGCGTAGCGGACCAG-CTCATGTTGACGGAACGTCCGCACTAAG
TRY.BR_A      GACGTCTTGGA---CAAGCGGGG---GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


DRO.MEL.      CTTGCCATCAATAT-GGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGG
TRY.BR_A      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


DRO.MEL.      ATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGT-AGGCAGTAGTGG
TRY.BR_A      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCGAG


DRO.MEL.      GATAGCGTACCGGAGTGGA--CTGC-CGTTAT-CAG-CCCAACCGATATGGTTGGACCAC
TRY.BR_A      AAGCACACCGAGGAGCATCTCAGGAC-TTTGCGC--CCCAAG-TGT--CGTCGCG-AGGC


DRO.MEL.      AATCTTT
TRY.BR_A      GG-----


[Download ClustalW]

#891

Mean pairwise ID: 35.52%


ZEA.MA_E      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


ZEA.MA_E      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
XEN.LAE.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC----GATCGGGT


ZEA.MA_E      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
XEN.LAE.      G-TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGT


ZEA.MA_E      GAC-CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCG
XEN.LAE.      TG-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-CCCC


ZEA.MA_E      GCTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
XEN.LAE.      GTGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAA


ZEA.MA_E      AGAG-CC-TCA---CTAA-GCAGACCACCATCTTT
XEN.LAE.      CAG-CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#892

Mean pairwise ID: 35.54%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG-----TGGGGACATTAAGATGGTGGGA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_F      CAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_F      CCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTTC
CAE.EL_B      CCGTGCCAAGCGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


ARA.TH_F      T-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTA
CAE.EL_B      ATAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCG


ARA.TH_F      CAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
CAE.EL_B      GTGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---


ARA.TH_F      -CCGATC---TCAT-ATGAACCACCATTTT--
CAE.EL_B      CCTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#893

Mean pairwise ID: 35.54%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_E      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_E      CCCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_E      CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_E      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_E      -GCTGTT---CTAG-TTAAACTACCACATTTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC--


[Download ClustalW]

#894

Mean pairwise ID: 35.54%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_E      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_E      CCCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_E      CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_E      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_E      -GCTGTT---CTAG-TTAAACTACCACATTTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT--


[Download ClustalW]

#895

Mean pairwise ID: 35.56%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_A      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_A      CCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_A      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCTG
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_A      TGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-G
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CC


LYC.ES_A      TTGCT---CCAA--TAAACAACCACCTTT
FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#896

Mean pairwise ID: 35.56%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG------TGGGGGCATTGAGGCGGTGTG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


TRI.AE_B      GATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-T
CAN.SPE.      GGATCGCTTGAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC---GATCGGGTG


TRI.AE_B      GCCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-
CAN.SPE.      -TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


TRI.AE_B      CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


TRI.AE_B      CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-C
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAGCC


TRI.AE_B      CCCGC--CAT-A-GCAGACCACCATCTTT
CAN.SPE.      TGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#897

Mean pairwise ID: 35.56%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_J      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_J      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_J      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_J      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA--CC


LYC.ES_J      TTGCT---CCAA--TAAACAACCACCTTT
FUG.RUB.      TGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#898

Mean pairwise ID: 35.56%


ZEA.MA_H      NCCGAGCTCTGTAGCGAGTGCTTGTAACCCGAGCGGGGGCAATAAGGTAGTGTGGATGTC
LYC.ES_L      ----------------------------------------------------------GT


ZEA.MA_H      AATTGT-GGT-GCATGTGCCTGGGTCTA--GTGCTACAA-ACTGTGGACCACCCATTCCA
LYC.ES_L      TG-GGTTGACCCAGATGGTTG-GGTTCGGT--AGGCTTATAGTCTGGCCTGCCCTCTCCA


ZEA.MA_H      AGTTGCGTAGTGGGTTTCGGATGCCTTGGCGAAAGCT-TTG-CATCC-CAACACTAAAGT
LYC.ES_L      AGCAT-GGAGTTGGATCACGTGGCTTAGTCGAAAGACCTGGGTTGCTTGATTCCTAAAGT


ZEA.MA_H      GGCGGACATTGCGTGAGGCTGGCTTCATAGAGCAGCGAGTACCGCCCGCCACCAGCGGTG
LYC.ES_L      GGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAACAGCTTCCGCTCTGTGCAGTG


ZEA.MA_H      GAAGGATAATGAGTCGCTATGCT-ATAGGCCCAAT-------------------------
LYC.ES_L      GAAGGATAACGGGTCAGTGCTC-AGCGAGTCC-AGTTAACGCCCTGATGGGCTGCTCCAA


ZEA.MA_H      ---------------
LYC.ES_L      CTAAACCACCACTTT


[Download ClustalW]

#899

Mean pairwise ID: 35.61%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG------CGGGGGCAATAAGGTGGTGTT
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-


ORY.SA_B      GGATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGC
CAN.SPE.      -GGATCGCTT--GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC---GATCGG


ORY.SA_B      C-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCC
CAN.SPE.      GTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCTCCCGGGAGCGGGGGACCACC


ORY.SA_B      CTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCC
CAN.SPE.      AGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ORY.SA_B      CGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-
CAN.SPE.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ORY.SA_B      C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
CAN.SPE.      CCAG--CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#900

Mean pairwise ID: 35.61%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG------CGGGGGCAATAAGGTGGTGTT
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


ORY.SA_B      GGATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGC
HOM.SA_B      -GGATCGCTT--GAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATGGG


ORY.SA_B      C-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCC
HOM.SA_B      GTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCTCCCGGGAGCGGGGGACCACC


ORY.SA_B      CTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCC
HOM.SA_B      AGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ORY.SA_B      CGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-
HOM.SA_B      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ORY.SA_B      C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
HOM.SA_B      CCAG--CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#901

Mean pairwise ID: 35.61%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG------CGGGGGCAATAAGGTGGTGTT
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


ORY.SA_B      GGATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGC
RAT.RAT.      -GGATCGCTT--GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGG


ORY.SA_B      C-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCC
RAT.RAT.      GTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCTCCCGGGAGCGGGGGACCACC


ORY.SA_B      CTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCC
RAT.RAT.      AGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ORY.SA_B      CGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-
RAT.RAT.      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ORY.SA_B      C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
RAT.RAT.      CCAG--CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#902

Mean pairwise ID: 35.63%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGT-G
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG-----TGGGGGCATTAAAGTGATGTGA


CAE.EL_A      GATGGAGT-GAGAGGAGGAGTCCTGTGTATG--TCGTTG-TCTACGTC---GACCGAGCG
TRI.AE_A      ACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-C


CAE.EL_A      -TCCGTGCCAAGCGC-TACGT-CACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGG
TRI.AE_A      GCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CG


CAE.EL_A      GTGCATAAGGAGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGC
TRI.AE_A      GTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGC


CAE.EL_A      GTGGTGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG
TRI.AE_A      TTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGCA


CAE.EL_A      -CCTTCTCGATACCTTCAG-ACCACTTATCATTT
TRI.AE_A      G--CCTAC---TCCA-GCAGACCACC--------


[Download ClustalW]

#903

Mean pairwise ID: 35.63%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


ZEA.MA_G      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
HOM.SA_B      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATGGGG


ZEA.MA_G      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
HOM.SA_B      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_G      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCG
HOM.SA_B      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG


ZEA.MA_G      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
HOM.SA_B      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCC


ZEA.MA_G      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
HOM.SA_B      AG-CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#904

Mean pairwise ID: 35.63%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


ZEA.MA_G      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
HOM.SA_A      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATCGGG


ZEA.MA_G      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
HOM.SA_A      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_G      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCG
HOM.SA_A      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG


ZEA.MA_G      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
HOM.SA_A      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCC


ZEA.MA_G      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
HOM.SA_A      AG-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#905

Mean pairwise ID: 35.63%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG------CGGGGGCATTAAGGTGGTGCG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


ZEA.MA_D      GATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC
HOM.SA_B      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC----GATGGGG


ZEA.MA_D      -TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CC
HOM.SA_B      TG-TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGG


ZEA.MA_D      AGACCT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
HOM.SA_B      TTG-CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-TCCC


ZEA.MA_D      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
HOM.SA_B      GTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTC


ZEA.MA_D      AGAG-CC-TCA---CTAA-GCAGACCACCATCTT
HOM.SA_B      CAG-CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#906

Mean pairwise ID: 35.65%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG-----TGGGGACATTTAGATGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_E      CAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_E      CCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT
CAE.EL_B      CCGTGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCA


ARA.TH_E      -AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTAC
CAE.EL_B      TAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


ARA.TH_E      AGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


ARA.TH_E      CCGATC---TCAT-ATGAACCACCATTTT--
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#907

Mean pairwise ID: 35.65%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG------TGGGGACTATAAGATGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


ARA.TH_G      ACAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_G      CCCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGC
RAT.RAT.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_G      T-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
RAT.RAT.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_G      CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_G      -TCGTAA--CCCGC-TTGAACCACCATTTT-
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#908

Mean pairwise ID: 35.65%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG------TGAGGGCATCAGTGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_C      ATG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_C      CCCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_C      CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_C      GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_C      -GCTGTT---CTAG-TTAAACTACCACATTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#909

Mean pairwise ID: 35.65%


TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG-----TGGGGGCATTAAAGTGATGTGA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


TRI.AE_A      ACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-C
XEN.LAE.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC---GATCGGGTG


TRI.AE_A      GCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CG
XEN.LAE.      -TCCGCACTAAGTTC-GGTAT-CAATAT-GGTGTTCCTGGGGGAGCCTCGGATCACCAGG


TRI.AE_A      GTC-CATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG
XEN.LAE.      TTGCTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCG


TRI.AE_A      CTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGC
XEN.LAE.      TGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACA


TRI.AE_A      AG--CCTAC---TCCA-GCAGACCACC----
XEN.LAE.      G-CCTGAACAACACAGCGAG-ACACAGTTCT


[Download ClustalW]

#910

Mean pairwise ID: 35.65%


ARA.TH_F      GTCGAGCTAAGTAACAATAGCTTGTAACCCATG------TGGGGACATTAAGATGGTGGG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


ARA.TH_F      ACAC--TG--GTTCGGT--TCCTCG-GATCGGTTCTGATGTGGGCATGTTTCTGAGC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


ARA.TH_F      CCCAGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTTGCA--GGTT
HOM.SA_B      TCCGCACTAAGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_F      CT-AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTT
HOM.SA_B      CCTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


ARA.TH_F      ACAGCAGTGGACGGATCACG-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGG
HOM.SA_B      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--


ARA.TH_F      T-CCGATC---TCAT-ATGAACCACCATTTT
HOM.SA_B      -CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#911

Mean pairwise ID: 35.65%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_E      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_E      CCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_E      T-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_E      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--C


LYC.ES_E      GCTGTT---CTAG-TTAAACTACCACATTTT
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#912

Mean pairwise ID: 35.67%


LYC.ES_O      GCC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG-TGGGGATGTTAAGGTGGTGGAATA-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_O      -TTG--GGCTGTC--CCAGAT-GGCTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_O      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_O      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_O      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCCTGATGG--
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA-------ACTAATCG-GTTCT


LYC.ES_O      -GCTGCT-CCAA-TTAAACCACCACTTT
TET.THE.      A-CTATCA--AAGCCA-GACATT-----


[Download ClustalW]

#913

Mean pairwise ID: 35.69%


CAE.EL_D      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT--T---CGGGGGCTAACCAGGCTT--AGCG


CAE.EL_D      AGTGAGAGGAGGAGTCCTGTGTATG-TCGTCGTCTACGTCGACCGAGCGTCCGTGCCAAG
LEI.MAJ.      GGGAGGACGTGGA--CCAGCGAGGGTGATTTGC-TGCGTTGACGTGGTGCTC-TGCTTGG


CAE.EL_D      CGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG-CATAAGGAGT
LEI.MAJ.      CTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCG


CAE.EL_D      CGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTG-GTGCAGTGGCC
LEI.MAJ.      AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCA


CAE.EL_D      GGACCGCGCTTGTAAGTTGA--CACA---CATACACAG-CCTTCTCGATACCTTCAGACC
LEI.MAJ.      GAATCACACCGCGGAGCATGTCC---GCACTTGAGC--CCCACGCTT---CGTCGCG-AA


CAE.EL_D      ACTTATCATTT
LEI.MAJ.      GCCTT------


[Download ClustalW]

#914

Mean pairwise ID: 35.69%


ARA.TH_A      GTC-GAGCTAAGTAACAATAGCTTGTAACCCATG-TGGGGACATTAAGATGGTGGGACAC
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


ARA.TH_A      -TG-GTTCGGT--TCCTCG-GATC---GGTTCTGATGTGGGCATGTTTCTGAGC-TGCCC
TET.ROS.      TTAGAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CCC


ARA.TH_A      AGTCCAAGCTGTGAGTAATTAGTGTTGAGTTGAGCGAAGGCTTGGCTCATGCAGGTTCT-
TET.ROS.      GTTCCAAACAGTGAGTTGCTAT-GGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


ARA.TH_A      AGAGTCGGAGGGTAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACTTCCCGCTTACA
TET.ROS.      AAGA-GCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


ARA.TH_A      GCAGTGGACGGATCACG-GTTTAGCGTCGC--TCAGAACCACTATGGCCTGCTGG---TC
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-C


ARA.TH_A      CGAT-CTCATATGAACCACCATTTT
TET.ROS.      TATTC--TGATCA-GACACT-----


[Download ClustalW]

#915

Mean pairwise ID: 35.71%


CAE.EL_A      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.EL_A      GAGTGAGAGGAGGAGTCCTGTGTATGTCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAG
TRY.BR_B      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.EL_A      CGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCATAAGGAGTC
TRY.BR_B      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.EL_A      GTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTG-GTGCAGTGGCCG
TRY.BR_B      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAG


CAE.EL_A      GACCGCGCTTGTGAGTTGA--CACA-CATACGCAG-CCTTCTCGATACCTTCAGACCACT
TRY.BR_B      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.EL_A      TATCATTT
TRY.BR_B      GTTT----


[Download ClustalW]

#916

Mean pairwise ID: 35.71%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG-----CGGGGGCAATAAGGTGGTGTTG
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC--


ORY.SA_B      GATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC
FUG.RUB.      GGATCGCTT--GAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC---GATCGGG


ORY.SA_B      -CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCC
FUG.RUB.      TG-TCCGTACTAAGTTC-GGTAT--CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCA


ORY.SA_B      TGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCCC
FUG.RUB.      GGTCGCCTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCC


ORY.SA_B      GCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-C
FUG.RUB.      GTGCCGCTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTT


ORY.SA_B      -AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
FUG.RUB.      CAA--CCTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#917

Mean pairwise ID: 35.74%


LYC.ES_F      GCCGAGCTTTGTAACGTGGGCTTGTAACCCGAG------TGGGGGCAACAATGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_F      ATG--TTG--GGTCCAT--CTTGAT-GGATGGGCTTGAA--GGGCTAATGTTCTGGCC-T
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC-----GATGGGGTG


LYC.ES_F      GCCCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCC
HOM.SA_B      -TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTT


LYC.ES_F      TTT-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTC
HOM.SA_B      GCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGC


LYC.ES_F      TGTGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACC-TGAT
HOM.SA_B      TGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG---------CACTCCAG


LYC.ES_F      AG-GTTGCC----TAA-TTAAACCATCACTTTT
HOM.SA_B      --CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#918

Mean pairwise ID: 35.74%


RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG------TGGGGGCATTAAAGTGATGTG


RAT.RAT.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGT
TRI.AE_A      AACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-


RAT.RAT.      G-TCCGCACTAAGTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAG
TRI.AE_A      CGCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-C


RAT.RAT.      GTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG
TRI.AE_A      GGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG


RAT.RAT.      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCA
TRI.AE_A      CTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGC


RAT.RAT.      G-CCTGGGCAACATAGCGAG-ACCCCGTCTCTT
TRI.AE_A      AG--CCTAC---TCCA-GCAGACCACC------


[Download ClustalW]

#919

Mean pairwise ID: 35.74%


HOM.SA_A      GCC-GGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGCTGGAG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---------CGTGTGGCATAAACAATGT-


HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTC
TET.ROS.      --AGTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


HOM.SA_A      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


HOM.SA_A      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.ROS.      AAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTG


HOM.SA_A      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGTGCAACA
TET.ROS.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--GCTAAT-CG-GTTCTG-CTATTC---


HOM.SA_A      TAGCGAGACCCCGTCTCTT
TET.ROS.      -TGATCAGACACT------


[Download ClustalW]

#920

Mean pairwise ID: 35.76%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


HUM.LU_B      AC-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_B      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_B      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTC
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.LU_B      CTGACT--CTTAA-TCGGACCATTTCCTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#921

Mean pairwise ID: 35.76%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_K      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_K      CCCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_K      CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_K      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_K      GTTGCT---CCAA--TAAACAACCACCTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#922

Mean pairwise ID: 35.76%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


HUM.LU_B      AC-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_B      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_B      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTC
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.LU_B      CTGACT--CTTAA-TCGGACCATTTCCTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#923

Mean pairwise ID: 35.76%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


HUM.LU_B      AC-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_B      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_B      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTC
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.LU_B      CTGACT--CTTAA-TCGGACCATTTCCTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#924

Mean pairwise ID: 35.76%


CAE.EL_C      ACC-GAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGT-AGATGAGTGTGGAT
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA------TATGTGGCATAAACAATGT--AG


CAE.EL_C      GGAGTGAGAGGAGGAGTCCTGTGTATG----TCGTTG-TCAACGTCGACCGAGCGTCCGT
TET.THE.      GTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGC


CAE.EL_C      GCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCATAAG
TET.THE.      TCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTAAAG


CAE.EL_C      GAGTGGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCGGTGCAGTG
TET.THE.      AGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTGGTG


CAE.EL_C      GCCGGACAGCGCTTGTGA-GTTGA--CACG--TATACACAG----CCTTCTCAATACCTT
TET.THE.      GAAGGATAACATACTCA-TTAACTGTCAA-ACTAAT-CG-GTTCTA-CTATCA----AAG


CAE.EL_C      CAGACCACTTGTCACT
TET.THE.      CCAGACATT-------


[Download ClustalW]

#925

Mean pairwise ID: 35.76%


CAE.BRI.      ACC-GGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGT-AGACAAGTGTGGAT
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT------CGTGTGGCATAAACAATGT---A


CAE.BRI.      GGAGTGAAGGGAGGAGTCCTGTGGGTG----TTGTCG-GCAACGGCGACCGAGCGTCCGT
TET.ROS.      GTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGT


CAE.BRI.      GCCAAGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAG
TET.ROS.      TCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAAAG


CAE.BRI.      GAGTGGTGCAC-GGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCGGTGCAGTG
TET.ROS.      AGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGGTG


CAE.BRI.      GCCGGATAGCGCTTGTGA-GTTGT--CGCT--CGCCCACAG----CCTCTCTGATACCTT
TET.ROS.      GAAGGATAACATACTCA-TTAACTGTCAA-GCTAAT-CG-GTTCTG-CTATTC----TGA


CAE.BRI.      CAGACCACTTGTCATT
TET.ROS.      TCAGACACT-------


[Download ClustalW]

#926

Mean pairwise ID: 35.76%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_K      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_K      CCCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_K      CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_K      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_K      GTTGCT---CCAA--TAAACAACCACCTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#927

Mean pairwise ID: 35.76%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


HUM.LU_B      C-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


HUM.LU_B      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


HUM.LU_B      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


HUM.LU_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTC
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG------CAGAACAG---C


HUM.LU_B      CTGACT--CTTAA-TCGGACCATTTCCTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#928

Mean pairwise ID: 35.76%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_K      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_K      CCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_K      T-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_K      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_K      TTGCT---CCAA--TAAACAACCACCTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#929

Mean pairwise ID: 35.76%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG-----TGAGGGCATCAGTGTGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


LYC.ES_C      TG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


LYC.ES_C      CCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCC
FUG.RUB.      CCGTACTAAGTTCGGTAT-CGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


LYC.ES_C      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTG
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


LYC.ES_C      TGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG-
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCAA--C


LYC.ES_C      GCTGTT---CTAG-TTAAACTACCACATTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#930

Mean pairwise ID: 35.76%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG-----TGGGGACAATAAGGTGGTGGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


ARA.TH_D      CAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


ARA.TH_D      CCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATT-C
XEN.LAE.      CCGCACTAAGTTCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGCT


ARA.TH_D      T-AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTA
XEN.LAE.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


ARA.TH_D      CAGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG---


ARA.TH_D      -TCGATC---TCTC-CTGGACCACCACTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT-


[Download ClustalW]

#931

Mean pairwise ID: 35.76%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_H      T-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_H      CCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_H      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_H      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--C


LYC.ES_H      GTTGCT---CCAA-TAAACAACCACCTTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#932

Mean pairwise ID: 35.76%


FUG.RUB.      GCC-GGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACT-GGGAGGC-TGAGGCTGGCGG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT--------CGTGTGGCATAAACAATGT--


FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT-----CAGCGG-ACTATGTCGATCGGGTGTCC
TET.ROS.      -AGTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCC


FUG.RUB.      GTACTAAGTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCCTA
TET.ROS.      GTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTAA


FUG.RUB.      AGGAGGGGTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCCGCTCAG
TET.ROS.      AGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTGG


FUG.RUB.      TAGTGGGATCGCGCCCGTGA-ATAGA--CGCT--GTAGTTCAA----CCTGAGTAACACA
TET.ROS.      TGGAAGGATAACATACTCA-TTAACTGTCAA-GCTAAT-CG-GTTCTG-CTATTC----T


FUG.RUB.      GCGGGACTCAGTCTTT
TET.ROS.      GATCAGACACT-----


[Download ClustalW]

#933

Mean pairwise ID: 35.76%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


HUM.LU_B      AC-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.LU_B      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_B      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTC
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.LU_B      CTGACT--CTTAA-TCGGACCATTTCCTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#934

Mean pairwise ID: 35.76%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_K      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_K      CCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_K      CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_K      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--C


LYC.ES_K      GTTGCT---CCAA--TAAACAACCACCTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#935

Mean pairwise ID: 35.78%


LYC.ES_C      GCC-GAGCTCAGTAGCGTGGGCTTGTAACTCAAG-TGAGGGCATCAGTGTGGTGGAATG-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_C      -TTG-AACATGC--CCAGAA-GGTA---GGGCTTGT--GTGACAATTCTCTGGCC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_C      CTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCCT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_C      -AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTGT
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_C      GCAGTGGAAGGATAACG-AGCCAGTGTCAT--ATAAGTTCAACGAATGTCTGATGG---G
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GTTCTG-


LYC.ES_C      CTGTT-CTAG-TTAAACTACCACATTT
TET.ROS.      CTATTC--TGATCA-GACACT------


[Download ClustalW]

#936

Mean pairwise ID: 35.81%


CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATGAGTGTGGATGG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT--T---CGGGGGCTAACCAGGCTT--AGCG


CAE.EL_C      AGTGAGAGGAGGAGTCCTGTGTATG-TCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
LEI.MAJ.      GGGAGGACGTGGA--CCAGCGAGGGTGATTTGC-TGCGTTGACGTGGTGCTC-TGCTTGG


CAE.EL_C      CGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTG-CATAAGGAGT
LEI.MAJ.      CTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCG


CAE.EL_C      GGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCG-GTGCAGTGGCC
LEI.MAJ.      AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCA


CAE.EL_C      GGACAGCGCTTGTGAGTTGA--CACG---TATACACAG-CCTTCTCAATACCTTCAGACC
LEI.MAJ.      GAATCACACCGCGGAGCATGTCC---GCACTTGAGC--CCCACGCTT---CGTCGCG-AA


CAE.EL_C      ACTTGTCACT
LEI.MAJ.      GCCTT-----


[Download ClustalW]

#937

Mean pairwise ID: 35.84%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_E      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_E      CCCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_E      CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_E      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_E      -GCTGTT---CTAG-TTAAACTACCACATTTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT--


[Download ClustalW]

#938

Mean pairwise ID: 35.84%


RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGA-
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG------TGGGGGCATTAAAGTGATGTG


RAT.NOR.      GGATCGATT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGT
TRI.AE_A      AACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-


RAT.NOR.      G-TCCGCACTAAGTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAG
TRI.AE_A      CGCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-C


RAT.NOR.      GTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG
TRI.AE_A      GGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG


RAT.NOR.      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCA
TRI.AE_A      CTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGC


RAT.NOR.      G-CCTGGGCAACATAGCGAG-ACCC-GTCTCT
TRI.AE_A      AG--CCTAC---TCCA-GCAGACCACC-----


[Download ClustalW]

#939

Mean pairwise ID: 35.84%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG-----TGGGGACTATAAGATGGTGGAA
CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_G      CAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGC
CAE.EL_A      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCTACGTC----GACCGAGCG-T


ARA.TH_G      CCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT
CAE.EL_A      CCGTGCCAAGCGCTACGTCACCAGGGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTGCA


ARA.TH_G      -AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_A      TAAGG-AGTCGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCGACCGCGTGG


ARA.TH_G      AGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC-
CAE.EL_A      TGCAGTGGCCGGACC-GCGCTTGT--GA-GTTGA--CACA-------CATACGCAG---C


ARA.TH_G      TCGTAA--CCCGC-TTGAACCACCATTTT---
CAE.EL_A      CTTCTCGATACCTTCAG-ACCACTTATCATTT


[Download ClustalW]

#940

Mean pairwise ID: 35.84%


ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGA-
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG------TGGGGGCATTAAAGTGATGTG


ORI.CUN.      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TCGTGC-GCTATGCC---GATCGGGT
TRI.AE_A      AACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-


ORI.CUN.      G-TCCGCACTAAGTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAG
TRI.AE_A      CGCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-C


ORI.CUN.      GTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG
TRI.AE_A      GGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG


ORI.CUN.      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCA
TRI.AE_A      CTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGC


ORI.CUN.      G-CCTGGGCAACATAGCGAG-ACCCTGTCTCC
TRI.AE_A      AG--CCTAC---TCCA-GCAGACCACC-----


[Download ClustalW]

#941

Mean pairwise ID: 35.85%


RAT.NOR.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGACAGGAG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---------CGTGTGGCATAAACAATGT-


RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTC
TET.ROS.      --AGTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


RAT.NOR.      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


RAT.NOR.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.ROS.      AAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTG


RAT.NOR.      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGGGCAACA
TET.ROS.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--GCTAAT-CG-GTTCTG-CTATTC---


RAT.NOR.      TAGCGAGACCC-GTCTCT
TET.ROS.      -TGATCAGACACT-----


[Download ClustalW]

#942

Mean pairwise ID: 35.85%


CAN.SPE.      GCC-GGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGCAGGAG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---------CGTGTGGCATAAACAATGT-


CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG-----CAGTGC-GCTATGCCGATCGGGTGTC
TET.ROS.      --AGTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


CAN.SPE.      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


CAN.SPE.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.ROS.      AAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTG


CAN.SPE.      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGTGCAACA
TET.ROS.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--GCTAAT-CG-GTTCTG-CTATTC---


CAN.SPE.      TAGCGAGACCCCGTCTCT
TET.ROS.      -TGATCAGACACT-----


[Download ClustalW]

#943

Mean pairwise ID: 35.87%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG------TGGGGGCATTGAGGCGGTGTG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGA-


TRI.AE_B      GATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-T
RAT.RAT.      GGATCGCTTGAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGTG


TRI.AE_B      GCCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-
RAT.RAT.      -TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


TRI.AE_B      CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


TRI.AE_B      CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-C
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAGCC


TRI.AE_B      CCCGC--CAT-A-GCAGACCACCATCTTT
RAT.RAT.      TGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#944

Mean pairwise ID: 35.87%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG-----TGGGGACATTTAGATGGTGGAA
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGCGG


ARA.TH_E      CAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TGC
FUG.RUB.      ATCGCTTGAGCTCAGGAGTTCTGGGCTT--CAGCGG-ACTATGTC----GATCGGGTG-T


ARA.TH_E      CCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT
FUG.RUB.      CCGTACTAAGTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGCC


ARA.TH_E      -AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTAC
FUG.RUB.      TAAGG-AGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


ARA.TH_E      AGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT-
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT-------GTAGTTCAA---C


ARA.TH_E      CCGATC---TCAT-ATGAACCACCATTTT
FUG.RUB.      CTGAGTAACACAGCGGG-ACTCAGTCTTT


[Download ClustalW]

#945

Mean pairwise ID: 35.87%


LYC.ES_F      GCC-GAGCTTTGTAACGTGGGCTTGTAACCCGAG-TGGGGGCAACAATGTGGTGGAATG-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_F      -TTG-GGTCCAT--CTTGAT-GGATG---GGCTTGAA--GGGCTAATGTTCTGGCC-TGC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT-----AAGAGTGTG-C


LYC.ES_F      CCTGTCCAAGCACAGAGTTGGGTCAAGTGGTCTATACGAAAGTATAG-CCACTTGGCCTT
TET.ROS.      CCGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCAT


LYC.ES_F      T-AGAGTGGGATGGACTGCGTGAGGCTGGTTTCACAGAGCAACGACTAGTCCCCGCTCTG
TET.ROS.      TAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTAT


LYC.ES_F      TGCAGTGGAAGGATCACG-GGCTAGTGCTCT---TTGAGTCCTAACAAAAACCTGATAG-
TET.ROS.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA--------GCTAATCG-GTTC


LYC.ES_F      --GTTGCC-TAA-TTAAACCATCACTTTT
TET.ROS.      TG-CTATTC-TGATCA-GACACT------


[Download ClustalW]

#946

Mean pairwise ID: 35.91%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG------CGGGGGCAATAAGGTGGTGTT
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


ORY.SA_B      GGATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGC
HOM.SA_A      -GGATCGCTT--GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGG


ORY.SA_B      C-CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCC
HOM.SA_A      GTG-TCCGCACTAAGTTC-GGCAT--CAATATGGTGACCTCCCGGGAGCGGGGGACCACC


ORY.SA_B      CTGCACCT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCC
HOM.SA_A      AGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCC


ORY.SA_B      CGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-
HOM.SA_A      CGTGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACT


ORY.SA_B      C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
HOM.SA_A      CCAG--CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#947

Mean pairwise ID: 35.91%


ORY.SA_B      GCCGAGCCAGGTAGCGTTGGCTTGTCACCCGAG-----CGGGGGCAATAAGGTGGTGTTG
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC--


ORY.SA_B      GATGC-CTGGTC-GTTTGCG---CTTGG-GGTCTGCGCCTGTGGTTTGCACTATGCGGCC
XEN.LAE.      GGATCGCTT--GAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC---GATCGGG


ORY.SA_B      -CGCCCGTTCCAAGTTGCGTAGCGTGTGTG-GGGCGCCTGGGCGAAGGCTCGAGCGTCCC
XEN.LAE.      TG-TCCGCACTAAGTTC-GGTAT--CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCA


ORY.SA_B      TGCAC-CT-AGAGTGGCGGGTATTGCGTGAGGCTGGTTTCACAGAGCAGCGAGTACCGCC
XEN.LAE.      GGTTGCTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCC


ORY.SA_B      CGCTTCCAACGGTGGAAGGATAACG-GGCCGCTG-CAGC--CCTGGCCCGCTTCCGGCC-
XEN.LAE.      CGTGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGA


ORY.SA_B      C-AAGT-GCCTTC---CATG-GCAGACCACCACCTTT
XEN.LAE.      ACAG--CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#948

Mean pairwise ID: 35.93%


ZEA.MA_D      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


ZEA.MA_D      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
XEN.LAE.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC----GATCGGGT


ZEA.MA_D      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
XEN.LAE.      G-TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGT


ZEA.MA_D      GAC-CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTCGCCC
XEN.LAE.      TG-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAAC-CCCC


ZEA.MA_D      GCTTCCAACGGTGGGAGGATAACA-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-C
XEN.LAE.      GTGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAA


ZEA.MA_D      AGAG-CC-TCA---CTAA-GCAGACCACCATCTT
XEN.LAE.      CAG-CCTGAACAACACAGCGAG-ACACAGTTCT-


[Download ClustalW]

#949

Mean pairwise ID: 35.93%


ZEA.MA_G      NCCGAGCTCTGTAGCGAGAGCTTGTAACCCGAG-----CGGGGGCATTAAGGTGGTGCGG
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


ZEA.MA_G      ATTC-TTTG--CGATGGCT--TTCTG-GGCCCGGGCTCGCTATGTGCCTTTGGCCGGCC-
XEN.LAE.      GATCGCTT-GAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC----GATCGGGT


ZEA.MA_G      TGCCCGTCCCAAGTTGGTAGTGGCTGGCGGAGGCTTTAGCGGAAGCTTTGGTCTCT-CCA
XEN.LAE.      G-TCCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGT


ZEA.MA_G      GAC-CT-GAAGTGGCAGGAATGGCGTGAGGCTGGCTTCACAGAGCAGCGATCACTGCCCG
XEN.LAE.      TG-CTCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCG


ZEA.MA_G      CTTCCAACGGTGGGAGGATAACG-GGCCGCTG-CACT--TCGAGCCCAACTCAGGCC-CA
XEN.LAE.      TGCCGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAAC


ZEA.MA_G      GAG-CC-TCA---CTAA-GCAGACCACCATCTTT
XEN.LAE.      AG-CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#950

Mean pairwise ID: 35.95%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_G      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_G      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_G      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_G      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_G      -GCTGCT---CCAA-TTAAACCACCACTTTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#951

Mean pairwise ID: 35.95%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


LYC.ES_E      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


LYC.ES_E      CCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


LYC.ES_E      T-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


LYC.ES_E      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCACAG--C


LYC.ES_E      GCTGTT---CTAG-TTAAACTACCACATTTT
CAE.BRI.      CTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#952

Mean pairwise ID: 35.95%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG------TGAGGGCATCAGTGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_C      ATG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_C      CCCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_C      CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_C      GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_C      -GCTGTT---CTAG-TTAAACTACCACATTT
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#953

Mean pairwise ID: 35.95%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_G      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_G      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_G      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_G      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_G      -GCTGCT---CCAA-TTAAACCACCACTTTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#954

Mean pairwise ID: 35.95%


HUM.JA_B      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


HUM.JA_B      CT--TTA--GTTCGGC--CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


HUM.JA_B      CCATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


HUM.JA_B      T-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTC
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


HUM.JA_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTGAG-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


HUM.JA_B      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#955

Mean pairwise ID: 35.95%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG-----TGGGGACAATAAGGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


ARA.TH_D      CAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_D      CCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT
CAE.EL_C      CCGTGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCA


ARA.TH_D      -AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTAC
CAE.EL_C      TAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


ARA.TH_D      AGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


ARA.TH_D      TCGATC---TCTC-CTGGACCACCACTTT--
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#956

Mean pairwise ID: 35.95%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG------TGAGGGCATCAGTGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_C      ATG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_C      CCCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_C      CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_C      GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_C      -GCTGTT---CTAG-TTAAACTACCACATTT
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#957

Mean pairwise ID: 35.95%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_G      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_G      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_G      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_G      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--C


LYC.ES_G      GCTGCT---CCAA-TTAAACCACCACTTTT-
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#958

Mean pairwise ID: 35.98%


HUM.JA_B      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG-TGGGGGCATGTGGGAAATGGGACT-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


HUM.JA_B      -TTA--GTTCGGC--CCATTG-GATC---GGATCCAGTGTTAGCTGCTTGCTGGGC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


HUM.JA_B      CCATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


HUM.JA_B      T-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTC
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


HUM.JA_B      GGCAGTGGAAGGATAACG-GGCCGGTGCTGC--TTGGACCCACCATGGTTCACTGAG--C
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAATCG-GTTCTA-


HUM.JA_B      TGACT-CTTAA-TAGGACCATTTCTTTT
TET.THE.      CTATCA---AAGCCA-GACATT------


[Download ClustalW]

#959

Mean pairwise ID: 36.00%


ARA.TH_E      GTC-GAGCTAAGTAACATGAGCTTGTAACCCATG-TGGGGACATTTAGATGGTGGAACAC
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


ARA.TH_E      --TG-GTTCGGG--TCCACG-GGCC---GGTTCTGTTGTTGGCATGTTTCTGGGC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


ARA.TH_E      CAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTCT-
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


ARA.TH_E      AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTACA
TET.ROS.      AAGA-GCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


ARA.TH_E      GCAGTGGACGGATCACA-GTTTAGCGTCGC--TCAGAACCACTATGGCCTGCTGGT--CC
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-C


ARA.TH_E      GATC-TCAT-ATGAACCACCATTTT
TET.ROS.      TATTC--TGATCA-GACACT-----


[Download ClustalW]

#960

Mean pairwise ID: 36.05%


HOM.SA_A      GCC-GGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGCTGGAG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---------TATGTGGCATAAACAATGT-


HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTC
TET.THE.      -AGGTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


HOM.SA_A      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.THE.      CGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTA


HOM.SA_A      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.THE.      AAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTG


HOM.SA_A      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGTGCAACA
TET.THE.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--ACTAAT-CG-GTTCTA-CTATCA---


HOM.SA_A      TAGCGAGACCCCGTCTCTT
TET.THE.      -AAGCCAGACATT------


[Download ClustalW]

#961

Mean pairwise ID: 36.05%


RAT.RAT.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGACAGAG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---------CGTGTGGCATAAACAATGT-


RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTC
TET.ROS.      --AGTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


RAT.RAT.      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


RAT.RAT.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.ROS.      AAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTG


RAT.RAT.      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGGGCAACA
TET.ROS.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--GCTAAT-CG-GTTCTG-CTATTC---


RAT.RAT.      TAGCGAGACCCCGTCTCTT
TET.ROS.      -TGATCAGACACT------


[Download ClustalW]

#962

Mean pairwise ID: 36.06%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_J      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_J      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_J      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_J      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_J      TTGCT---CCAA--TAAACAACCACCTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#963

Mean pairwise ID: 36.06%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_H      AT-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_H      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_H      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_H      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_H      GTTGCT---CCAA-TAAACAACCACCTTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#964

Mean pairwise ID: 36.06%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_A      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_A      CCCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_A      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_A      GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_A      GTTGCT---CCAA--TAAACAACCACCTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#965

Mean pairwise ID: 36.06%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_K      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_K      CCCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_K      CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_K      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_K      GTTGCT---CCAA--TAAACAACCACCTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#966

Mean pairwise ID: 36.06%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_O      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_O      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_O      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_O      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_O      -GCTGCT---CCAA-TTAAACCACCACTTT
RAT.NOR.      CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#967

Mean pairwise ID: 36.06%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_A      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_A      CCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_A      T-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCTG
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_A      TGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG--CC


LYC.ES_A      TTGCT---CCAA--TAAACAACCACCTTT-
CAE.EL_B      TTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#968

Mean pairwise ID: 36.06%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_A      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_A      CCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_A      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_A      GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--C


LYC.ES_A      GTTGCT---CCAA--TAAACAACCACCTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#969

Mean pairwise ID: 36.06%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


HUM.LU_B      AC-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


HUM.LU_B      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.LU_B      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCC
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.LU_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTC
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.LU_B      CTGACT--CTTAA-TCGGACCATTTCCTTT
HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#970

Mean pairwise ID: 36.06%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_J      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_J      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_J      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_J      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_J      GTTGCT---CCAA--TAAACAACCACCTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#971

Mean pairwise ID: 36.06%


ARA.TH_E      GTCGAGCTAAGTAACATGAGCTTGTAACCCATG------TGGGGACATTTAGATGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


ARA.TH_E      ACAC--TG--GTTCGGG--TCCACG-GGCCGGTTCTGTTGTTGGCATGTTTCTGGGC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


ARA.TH_E      CCCAGTCCAAGCTGTGAGTAAGACGTGTGTGTCAAGCGAAGGCTTGGCTCAAACGGCTTC
HOM.SA_B      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_E      T-AAAGTTGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCGCTTA
HOM.SA_B      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_E      CAGCAGTGGACGGATCACA-GTTTAGCG-TCGC--TCAGAACCACTATGGCC-TGCTGGT
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_E      -CCGATC---TCAT-ATGAACCACCATTTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#972

Mean pairwise ID: 36.06%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


LYC.ES_A      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_A      CCCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_A      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_A      GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_A      GTTGCT---CCAA--TAAACAACCACCTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#973

Mean pairwise ID: 36.06%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_H      AT-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_H      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_H      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_H      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_H      GTTGCT---CCAA-TAAACAACCACCTTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#974

Mean pairwise ID: 36.06%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_O      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_O      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_O      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_O      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_O      -GCTGCT---CCAA-TTAAACCACCACTTT
ORI.CUN.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#975

Mean pairwise ID: 36.06%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


LYC.ES_J      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


LYC.ES_J      CCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


LYC.ES_J      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


LYC.ES_J      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG--C


LYC.ES_J      GTTGCT---CCAA--TAAACAACCACCTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#976

Mean pairwise ID: 36.06%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


LYC.ES_J      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_J      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_J      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_J      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_J      GTTGCT---CCAA--TAAACAACCACCTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#977

Mean pairwise ID: 36.13%


CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT--T---CGGGGGCTAACCAGGCTT--AGCG


CAE.EL_B      AGTGAGAGGAGGAGTCCTGTGTATG-TCGTTGTCAACGTCGACCGAGCGTCCGTGCCAAG
LEI.MAJ.      GGGAGGACGTGGA--CCAGCGAGGGTGATTTGC-TGCGTTGACGTGGTGCTC-TGCTTGG


CAE.EL_B      CGCTGCGTCACCAG-GGGATGACTGTCGGAAGATGGTCAGTCCCGGGTG-CATAAGGAGT
LEI.MAJ.      CTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCG


CAE.EL_B      GGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCCACCGCGCG-GTGCAGTGGCC
LEI.MAJ.      AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCA


CAE.EL_B      GGACTGCGCTTGTGAGTTGA--CACG---TATACACAG-CCTTCTCAATACCTTCAGACC
LEI.MAJ.      GAATCACACCGCGGAGCATGTCC---GCACTTGAGC--CCCACGCTT---CGTCGCG-AA


CAE.EL_B      ACTTGTTTTT
LEI.MAJ.      GCCTT-----


[Download ClustalW]

#978

Mean pairwise ID: 36.14%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_E      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_E      CCCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_E      CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_E      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_E      -GCTGTT---CTAG-TTAAACTACCACATTTT
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT-


[Download ClustalW]

#979

Mean pairwise ID: 36.14%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_E      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_E      CCCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_E      CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_E      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_E      -GCTGTT---CTAG-TTAAACTACCACATTTT
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT-


[Download ClustalW]

#980

Mean pairwise ID: 36.14%


HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG------TGGGGGCATTAAAGTGATGTG


HOM.SA_B      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATGGGGT
TRI.AE_A      AACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-


HOM.SA_B      G-TCCGCACTAAGTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAG
TRI.AE_A      CGCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-C


HOM.SA_B      GTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG
TRI.AE_A      GGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG


HOM.SA_B      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCA
TRI.AE_A      CTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGC


HOM.SA_B      G-CCTGAGCAACATAGCGAG-ACCCCGTCTCT
TRI.AE_A      AG--CCTAC---TCCA-GCAGACCACC-----


[Download ClustalW]

#981

Mean pairwise ID: 36.14%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG------TGGAGACAATAAGGGGATGGG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


ARA.TH_C      ACG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_C      CCCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAA
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


ARA.TH_C      G--CCGCT---CCGA-TTGGACCATCACTTT-
HOM.SA_A      -CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#982

Mean pairwise ID: 36.14%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG------TGGAGACAATAAGGGGATGGG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


ARA.TH_C      ACG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_C      CCCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAA
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


ARA.TH_C      G--CCGCT---CCGA-TTGGACCATCACTTT-
RAT.RAT.      -CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#983

Mean pairwise ID: 36.16%


HOM.SA_B      GCC-GGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGTGGGAG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---------CGTGTGGCATAAACAATGT-


HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG-----TAGTGC-GCTATGCCGATGGGGTGTC
TET.ROS.      --AGTTA--GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


HOM.SA_B      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.ROS.      CGTTCCAAACAGTGAGTTGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATTA


HOM.SA_B      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.ROS.      AAGAGCTGAGGAACCGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTATTGTG


HOM.SA_B      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGAGCAACA
TET.ROS.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--GCTAAT-CG-GTTCTG-CTATTC---


HOM.SA_B      TAGCGAGACCCCGTCTCT
TET.ROS.      -TGATCAGACACT-----


[Download ClustalW]

#984

Mean pairwise ID: 36.16%


CAN.SPE.      GCC-GGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGCAGGAG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---------TATGTGGCATAAACAATGT-


CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG-----CAGTGC-GCTATGCCGATCGGGTGTC
TET.THE.      -AGGTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


CAN.SPE.      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.THE.      CGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTA


CAN.SPE.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.THE.      AAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTG


CAN.SPE.      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGTGCAACA
TET.THE.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--ACTAAT-CG-GTTCTA-CTATCA---


CAN.SPE.      TAGCGAGACCCCGTCTCT
TET.THE.      -AAGCCAGACATT-----


[Download ClustalW]

#985

Mean pairwise ID: 36.16%


ORI.CUN.      GCC-GGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGCCGGAG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---------TATGTGGCATAAACAATGT-


ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG-----TCGTGC-GCTATGCCGATCGGGTGTC
TET.THE.      -AGGTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


ORI.CUN.      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.THE.      CGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTA


ORI.CUN.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.THE.      AAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTG


ORI.CUN.      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGGGCAACA
TET.THE.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--ACTAAT-CG-GTTCTA-CTATCA---


ORI.CUN.      TAGCGAGACCCTGTCTCC
TET.THE.      -AAGCCAGACATT-----


[Download ClustalW]

#986

Mean pairwise ID: 36.16%


GAL.GAL.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGCTGAGCCCGCCGG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---T-----CGGGGGCTGATCCCGCTT--


GAL.GAL.      ATCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTA
TRY.BR_A      AGCGGGGACGTCTTGGA--CAAGCGGGGGTTCTGT-TGCGTTGACTTGGTGTTC-TGCTT


GAL.GAL.      AGGCCGGCATCAATAT-GGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAG
TRY.BR_A      GGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT


GAL.GAL.      GGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCC-GGTCAGTAAC
TRY.BR_A      GGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCG


GAL.GAL.      GGGATCGCGCCTGTGAATAGC--CACTG-CAGCGTAG-CCTGGGCAACATAGCGAGACCC
TRY.BR_A      AGAAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGG


GAL.GAL.      TGTCTCC
TRY.BR_A      CGG----


[Download ClustalW]

#987

Mean pairwise ID: 36.16%


CAE.BRI.      ACC-GGGTGTCGTGGCGGGCGCCTGTGAGTCAGCTTCTTGACGGTAGACAAGTGTGGATG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT--AGC


CAE.BRI.      GAGTGAAGGGAGGAGTCCTGTGGGTGTTGTCGGCAACGGCGACCGAGCGTCCGTGCCAAG
TRY.BR_B      GGGGACGTCTTGGA--CAAGCGGGG-GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


CAE.BRI.      CGCTGCGTCGCCAG-GGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGCATAAGGAGTG
TRY.BR_B      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


CAE.BRI.      GTGCAC-GGCTCAGGGCCGAAAGGCAGCAGGCAAAAGCCACCGCGCG-GTGCAGTGGCCG
TRY.BR_B      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAG


CAE.BRI.      GATAGCGCTTGTGAGTTGT--CGCT-CGCCCACAG-CCTCTCTGATACCTTCAGACCACT
TRY.BR_B      AAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGGCG


CAE.BRI.      TGTCATT
TRY.BR_B      GTTT---


[Download ClustalW]

#988

Mean pairwise ID: 36.17%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG------TGGGGGCATTGAGGCGGTGTG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGA-


TRI.AE_B      GATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-T
HOM.SA_B      GGATCGCTTGAGCCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATGGGGTG


TRI.AE_B      GCCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-
HOM.SA_B      -TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


TRI.AE_B      CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


TRI.AE_B      CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-C
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAGCC


TRI.AE_B      CCCGC--CAT-A-GCAGACCACCATCTTT
HOM.SA_B      TGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#989

Mean pairwise ID: 36.17%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG------TGGGGGCATTGAGGCGGTGTG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-


TRI.AE_B      GATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-T
HOM.SA_A      GGATCGCTTGAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGTG


TRI.AE_B      GCCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-
HOM.SA_A      -TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


TRI.AE_B      CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


TRI.AE_B      CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-C
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAGCC


TRI.AE_B      CCCGC--CAT-A-GCAGACCACCATCTTT
HOM.SA_A      TGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#990

Mean pairwise ID: 36.25%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_G      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_G      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_G      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_G      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_G      -GCTGCT---CCAA-TTAAACCACCACTTTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#991

Mean pairwise ID: 36.25%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


HUM.LU_A      ACT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


HUM.LU_A      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


HUM.LU_A      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


HUM.LU_A      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACTAGG
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG---


HUM.LU_A      -CTGACT--CTTAA-TAGGACCATTTCTTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#992

Mean pairwise ID: 36.25%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG-----TGGGGACTATAAGATGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


ARA.TH_G      CAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_G      CCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT
CAE.EL_C      CCGTGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCA


ARA.TH_G      -AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_C      TAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


ARA.TH_G      AGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


ARA.TH_G      TCGTAA--CCCGC-TTGAACCACCATTTT--
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#993

Mean pairwise ID: 36.25%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG------TGGGGACTATAAGATGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


ARA.TH_G      ACAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_G      CCCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGC
HOM.SA_A      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_G      T-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
HOM.SA_A      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_G      CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_G      -TCGTAA--CCCGC-TTGAACCACCATTTT-
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#994

Mean pairwise ID: 36.25%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG------TGAGGGCATCAGTGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_C      ATG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_C      CCCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_C      CT-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_C      GTGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_C      -GCTGTT---CTAG-TTAAACTACCACATTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#995

Mean pairwise ID: 36.25%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_O      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_O      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_O      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_O      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_O      -GCTGCT---CCAA-TTAAACCACCACTTT-
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#996

Mean pairwise ID: 36.25%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG------TGGAGACAATAAGGGGATGGG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


ARA.TH_C      ACG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_C      CCCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAA
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


ARA.TH_C      G--CCGCT---CCGA-TTGGACCATCACTTT
RAT.NOR.      -CCTGGGCAACATAGCGAG-ACCC-GTCTCT


[Download ClustalW]

#997

Mean pairwise ID: 36.25%


CIN.HYB.      ACCGGGCTTGGTAACGCTAGTCTATAACTCAAGTGAGGGTATCAAAGTGGTTGAACTTTG
TRI.AE_C      ------------------------------------------------------------


CIN.HYB.      AGCTTGGCTTAGCTAGTTGGGTCTGTAGACACCGCACCTGGCTTGCCCGTTCCAAGTCG-
TRI.AE_C      ------------------------------------GGTGGTCTGCCCGTTCCAAGTTGA


CIN.HYB.      AGAGTGGGTTCA-TGTTTCCTGAGCGAAGGCTCGGGTGATGTGAGCTTT-AGAATCGGGG
TRI.AE_C      GTAGTGGACCGCTTGGGGCCTATGCGAAAGT-TGGGCCTCA-CGGTCCATAATG-TGGCA


CIN.HYB.      GGCAATGCGTTAGGCTGGTTTCACAGAGCTGCGAAAACCTCTACCTCTCGACTGTGGAAG
TRI.AE_C      GGCACCGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCTTCCAACGGTGGAAG


CIN.HYB.      GATTACAAGCCGGAGTGTC-TTAGGCTC-ATATAACCAG-CCTGGCTAGCCCAA-CAGGA
TRI.AE_C      GATAACGGGCCGCTG-CACTCCTAGGCCGCT--TGGGCCTCGTAGCCTA-CTCCAGC-GA


CIN.HYB.      CACCCATTT
TRI.AE_C      CCACCATC-


[Download ClustalW]

#998

Mean pairwise ID: 36.25%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_O      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_O      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_O      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_O      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_O      -GCTGCT---CCAA-TTAAACCACCACTTT-
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#999

Mean pairwise ID: 36.25%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_O      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_O      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_O      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_O      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--C


LYC.ES_O      GCTGCT---CCAA-TTAAACCACCACTTT--
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#1000

Mean pairwise ID: 36.28%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG-----TGGGGGCATTGAGGCGGTGTGG
FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACTGGGAGGC---TGAGGCTGGC-G


TRI.AE_B      ATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TG
FUG.RUB.      GATCGCTTGAGCTCAGGAGTTCTGGGCTT---CAGCGG-ACTATGTC---GATCGGGTG-


TRI.AE_B      CCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-C
FUG.RUB.      TCCGTACTAAGTTCGGTATCGATATGGTGCTCCTGGGGGAGCCCGGGATCACCAGGTCGC


TRI.AE_B      T-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCC
FUG.RUB.      CTAAGGAGGGGTGCCCCGGCCCAGGTCGGAA--ACGAAGCAGGTCAAAGCCCCCGTGCCG


TRI.AE_B      AACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-CC
FUG.RUB.      CTCAGTAGTGGGATC-GCGCCCGT--GA-ATAGA--CGCT--------GTAGTTCAACCT


TRI.AE_B      CCGC--CAT-A-GCAGACCACCATCTTT
FUG.RUB.      GAGTAACACAGCGGG-ACTCAGTCTTT-


[Download ClustalW]

#1001

Mean pairwise ID: 36.34%


CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG-----TGGGGGCATTAAAGTGATGTGA


CAE.BRI.      GATGGAGT-GAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC---GACCGAGCG
TRI.AE_A      ACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-C


CAE.BRI.      -TCCGTGCCAAGCGC-TGCGT-CGCCAG-GGGTCTCCGGTCGGAAGGCTGGCGGTCCCGG
TRI.AE_A      GCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CG


CAE.BRI.      GCGCATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGC
TRI.AE_A      GTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGC


CAE.BRI.      GCGGTGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG
TRI.AE_A      TTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGCA


CAE.BRI.      -CCTCTCTGATACCTTCAG-ACCACTTGTCATT
TRI.AE_A      G--CCTAC---TCCA-GCAGACCACC-------


[Download ClustalW]

#1002

Mean pairwise ID: 36.34%


HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGA-
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG------TGGGGGCATTAAAGTGATGTG


HOM.SA_A      GGATCGCTT-GAGTCCAGGAGTTCTGGGCTG---TAGTGC-GCTATGCC---GATCGGGT
TRI.AE_A      AACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-


HOM.SA_A      G-TCCGCACTAAGTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAG
TRI.AE_A      CGCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-C


HOM.SA_A      GTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG
TRI.AE_A      GGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG


HOM.SA_A      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCA
TRI.AE_A      CTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGC


HOM.SA_A      G-CCTGTGCAACATAGCGAG-ACCCCGTCTCTT
TRI.AE_A      AG--CCTAC---TCCA-GCAGACCACC------


[Download ClustalW]

#1003

Mean pairwise ID: 36.36%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_J      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_J      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_J      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_J      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_J      GTTGCT---CCAA--TAAACAACCACCTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1004

Mean pairwise ID: 36.36%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_H      AT-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_H      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_H      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_H      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_H      GTTGCT---CCAA-TAAACAACCACCTTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1005

Mean pairwise ID: 36.36%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG------TGGGGACTATAAGATGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


ARA.TH_G      ACAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_G      CCCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGC
CAN.SPE.      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_G      T-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
CAN.SPE.      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_G      CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_G      -TCGTAA--CCCGC-TTGAACCACCATTTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#1006

Mean pairwise ID: 36.36%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_A      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_A      CCCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_A      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_A      GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_A      GTTGCT---CCAA--TAAACAACCACCTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1007

Mean pairwise ID: 36.36%


RAT.RAT.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGACAGAG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---------TATGTGGCATAAACAATGT-


RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTC
TET.THE.      -AGGTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


RAT.RAT.      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.THE.      CGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTA


RAT.RAT.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.THE.      AAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTG


RAT.RAT.      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGGGCAACA
TET.THE.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--ACTAAT-CG-GTTCTA-CTATCA---


RAT.RAT.      TAGCGAGACCCCGTCTCTT
TET.THE.      -AAGCCAGACATT------


[Download ClustalW]

#1008

Mean pairwise ID: 36.36%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


LYC.ES_O      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_O      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_O      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_O      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_O      -GCTGCT---CCAA-TTAAACCACCACTTT
CAN.SPE.      CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#1009

Mean pairwise ID: 36.36%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_K      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_K      CCCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_K      CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_K      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_K      GTTGCT---CCAA--TAAACAACCACCTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1010

Mean pairwise ID: 36.36%


HUM.LU_B      ---GGCCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


HUM.LU_B      C-A-TTG--GGTCAGC--CCAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


HUM.LU_B      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCC
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


HUM.LU_B      T-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCC
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


HUM.LU_B      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--TTGGTCCACCATGT-T-CACTGGTCC
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT------CGCCCACAG---CC


HUM.LU_B      TGACT--CTTAA-TCGGACCATTTCCTTT-
CAE.BRI.      TCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#1011

Mean pairwise ID: 36.36%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_K      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_K      CCCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_K      CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_K      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_K      GTTGCT---CCAA--TAAACAACCACCTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1012

Mean pairwise ID: 36.45%


CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGA-
TRI.AE_A      NCCGAGCTCAGTTGCGAGAGCTTGTAACCCGAG------TGGGGGCATTAAAGTGATGTG


CAN.SPE.      GGATCGCTT-GAGCCCAGGAGTTCTGGGCTG---CAGTGC-GCTATGCC---GATCGGGT
TRI.AE_A      AACGC-TGTT--GTA-GCG---CTGCG-GGCCTGGTCTGGG--TGTGCTACTGCTGGCC-


CAN.SPE.      G-TCCGCACTAAGTTC-GGCAT-CAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAG
TRI.AE_A      CGCCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-C


CAN.SPE.      GTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCG
TRI.AE_A      GGTCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCG


CAN.SPE.      TGCTGATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCA
TRI.AE_A      CTTCCAACGGTGGAAGGATAATG-GGCCGCTG-CACT--CCTAGGCCAATTGGGCCTCGC


CAN.SPE.      G-CCTGTGCAACATAGCGAG-ACCCCGTCTCT
TRI.AE_A      AG--CCTAC---TCCA-GCAGACCACC-----


[Download ClustalW]

#1013

Mean pairwise ID: 36.45%


LYC.ES_E      GTCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_E      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_E      CCCTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_E      CT-AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_E      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_E      -GCTGTT---CTAG-TTAAACTACCACATTTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT--


[Download ClustalW]

#1014

Mean pairwise ID: 36.47%


LYC.ES_E      GTC-GAGCTTAGTAACGTGGGCTTGTAACCCAAG-TGGGGATGTTAAGGTGGTGGAATA-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


LYC.ES_E      -TTG-GGCTGTC--CCAGAT-GGCTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


LYC.ES_E      CTATCCAAGTACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCCT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


LYC.ES_E      -AAAGTGGGGTGGACC-CGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTGT
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


LYC.ES_E      GCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCCTGATGG---
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA-------GCTAATCG-GTTCTG


LYC.ES_E      GCTGTT-CTAG-TTAAACTACCACATTTT
TET.ROS.      -CTATTC--TGATCA-GACACT-------


[Download ClustalW]

#1015

Mean pairwise ID: 36.47%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG-----TGGGGGCATTGAGGCGGTGTGG
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTC-G


TRI.AE_B      ATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TG
XEN.LAE.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG---CACTGA-GCTATGTC---GATCGGGTG-


TRI.AE_B      CCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC--
XEN.LAE.      TCCGCACTAAGTTCGGTATCAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


TRI.AE_B      CT-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTC
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


TRI.AE_B      CAACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-C
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACAGCC


TRI.AE_B      CCCGC--CAT-A-GCAGACCACCATCTTT
XEN.LAE.      TGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#1016

Mean pairwise ID: 36.47%


LYC.ES_G      GCC-GAGCTTAGTAATGTGGGCTTGTAACCCAAA-TGGGGGCATTAATGTGGTGGAATG-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


LYC.ES_G      -TTG--GGCTGTA--CCAGAT-GGTTG---GGCTTGGT--GGGCTAATTTCTGGCC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


LYC.ES_G      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


LYC.ES_G      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


LYC.ES_G      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCCTGATGG--
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--A-TTAACTGTCAA-------ACTAATCG-GTTCT


LYC.ES_G      -GCTGCT-CCAA-TTAAACCACCACTTTT
TET.THE.      A-CTATCA--AAGCCA-GACATT------


[Download ClustalW]

#1017

Mean pairwise ID: 36.48%


HOM.SA_B      GCC-GGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGGTGGGAG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---------TATGTGGCATAAACAATGT-


HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG-----TAGTGC-GCTATGCCGATGGGGTGTC
TET.THE.      -AGGTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


HOM.SA_B      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.THE.      CGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTA


HOM.SA_B      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.THE.      AAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTG


HOM.SA_B      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGAGCAACA
TET.THE.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--ACTAAT-CG-GTTCTA-CTATCA---


HOM.SA_B      TAGCGAGACCCCGTCTCT
TET.THE.      -AAGCCAGACATT-----


[Download ClustalW]

#1018

Mean pairwise ID: 36.48%


RAT.NOR.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGC-TGAGACAGGAG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---------TATGTGGCATAAACAATGT-


RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG-----TAGTGC-GCTATGCCGATCGGGTGTC
TET.THE.      -AGGTT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCC


RAT.NOR.      CGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCT
TET.THE.      CGCTCCAAACAATGAGTTGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCATTA


RAT.NOR.      AAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCA
TET.THE.      AAGAGCTAAGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTGTTGTG


RAT.NOR.      GTAGTGGGATCGCGCCTGTGA-ATAGC--CACTG---CACTCCAG----CCTGGGCAACA
TET.THE.      GTGGAAGGATAACATACTCA-TTAACTGTCAA--ACTAAT-CG-GTTCTA-CTATCA---


RAT.NOR.      TAGCGAGACCC-GTCTCT
TET.THE.      -AAGCCAGACATT-----


[Download ClustalW]

#1019

Mean pairwise ID: 36.48%


DRO.MEL.      GACTGGAAGGTTGGCAGCTTCTGTAATCACGCTTCTGTGAGGTCTGATTGTGGGATGGCC
TRY.BR_B      AGCCGGAGCG-CAT--TGCTCTGTAACCT--T---CGGGGGCTGATCCCGCTT-AGCGGG


DRO.MEL.      TGAGGCTGGGATCTACTGCGTAGCGGACCAG-CTCATGTTGACGGAACGTCCGCACTAAG
TRY.BR_B      GACGTCTTGGA---CAAGCGGGG---GTTCTGT-TGCGTTGACTTGGTGTTC-TGCTTGG


DRO.MEL.      CTTGCCATCAATAT-GGGTGCCATGGAGGAGTCCGTGGCATTCAGGTTGGCTAAGGAGGG
TRY.BR_B      TTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGTGG


DRO.MEL.      ATGAACCGGGCCAGGGGTGAAAACCAGCAGCCAAGAGTTCCCGTGGT-AGGCAGTAGTGG
TRY.BR_B      GGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGCAG


DRO.MEL.      GATAGCGTACCGGAGTGGA--CTGC-CGTTAT-CAG-CCCAACCGATATGGTTGGACCAC
TRY.BR_B      AAGCACACCGAGGAGCATCTCAGGAC-TTTGCGC--CCCAAG-TGT--CGTCGCG-AGGC


DRO.MEL.      AATCTTT
TRY.BR_B      GGTTT--


[Download ClustalW]

#1020

Mean pairwise ID: 36.51%


TET.THE.      GCCAGGGTAGCA--ATACCTGTGTCTA-TATGTGGCATAAACAATGTAGGTT-GTGATAG
LEP.COL.      GCC-GGAGC---CTTGCTCTGTAACCTTCGGGGGCTTTCACCAGCTGAACAGGGAGCTGT


TET.THE.      ATA-GGATATGAGA-GTTTGATGAGACAGTTTGCTAAGAGTGTGCCCGCTCCAAACAATG
LEP.COL.      CT-GGACCAGCATAGG---GTGCTTG-C-GGCGTTGACGTGGTGCTC-TGCTTGGCTGTG


TET.THE.      AGTTGCTAT-----GGTGGTAACCTAGTAATAG-GACTCCACCAGGGCATTAAAGAGCTA
LEP.COL.      TGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGT-TAA-AGTAG


TET.THE.      AGGAAACGCCTCAGGCTGGCAACAGAACAGGGAAAACTTGCCGCTTG-TTGTGGTGGAAG
LEP.COL.      AGGAACTGGGTCAGGCCGGCAACGGAGCAGCCCA-CCTC-GCGCACGTCTGCCGTTGCAG


TET.THE.      GATAACATACTCA-TTAACTGTCAA-ACTAAT-CGGTTCTA-CTATCA--AAGCCAGACA
LEP.COL.      AACCACACCGCGGA-GCCTG-TCATC-ACCTGCGC-----CCCAGGCGATCCTGTG-AAG


TET.THE.      TT--
LEP.COL.      CTTT


[Download ClustalW]

#1021

Mean pairwise ID: 36.54%


FUG.RUB.      GCCGGGTACGGTGGCGCGTGCCTGTAATCCAAGCTACT-GGGAGGC-TGAGGCTGGCGGA
LEP.COL.      GCCGGAGC-----CT--TGCTCTGTAACCT----T---CGGGGGCTTTCACCAGCTG--A


FUG.RUB.      TCGCTTGAGCTCAGGA-GTTCTGGGCTT--CAGCGGACTATGTCGATCGGGTGTCCGTAC
LEP.COL.      ACAGG-GAGCTGTCT-GGACCAGCATAGGGTGCTTGC-GGCGTTGACGTGGTGCTC-TGC


FUG.RUB.      TAAGTTCGGTATCGATAT-----GGTGCTCCTGGGGGAGCCC-GGGATCACCAGGTCGCC
LEP.COL.      TTGGCTGTGTGTCGGAGGCCTCCGGGTGCCCCCTTGCAGAAGGGGCGCGCCCCCTCCGT-


FUG.RUB.      TAAGGAGGGGTGCCCCGGCCCAGGTCGGAAACGAAGCAGGTCAAAGCCCCCGTGCC-GCT
LEP.COL.      TAA-AGTAGAGGAACTGGGTCAGGCCGGCAACGGAGCAGCCCA-CCTC-GCGCACGTCTG


FUG.RUB.      CAGTAGTGGGATCGCGCCCGTGAATAGA-CGCT-GTAGTTCAACCTGAGTAACACAGCGG
LEP.COL.      CCGTTGCAGAACCACACCGCGGAGCCTGTCATCACCTGCGC--CCCAGGCGA--TCCTGT


FUG.RUB.      GACTCAGTCTTT
LEP.COL.      G-AAGCTTT---


[Download ClustalW]

#1022

Mean pairwise ID: 36.56%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG------TGGAGACAATAAGGGGATGGG
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


ARA.TH_C      ACG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


ARA.TH_C      CCCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAA
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


ARA.TH_C      G--CCGCT---CCGA-TTGGACCATCACTTT
HOM.SA_B      -CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#1023

Mean pairwise ID: 36.56%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG------TGGAGACAATAAGGGGATGGG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


ARA.TH_C      ACG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_C      CCCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAA
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


ARA.TH_C      G--CCGCT---CCGA-TTGGACCATCACTTT
ORI.CUN.      -CCTGGGCAACATAGCGAG-ACCCTGTCTCC


[Download ClustalW]

#1024

Mean pairwise ID: 36.56%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG-----TGGAGACAATAAGGGGATGGGA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


ARA.TH_C      CG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


ARA.TH_C      CCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAA
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG--------CAGAACAG--


ARA.TH_C      G--CCGCT---CCGA-TTGGACCATCACTTT
XEN.LAE.      -CCTGAACAACACAGCGAG-ACACAGTTCT-


[Download ClustalW]

#1025

Mean pairwise ID: 36.56%


ARA.TH_D      GTCGAGCTAAGTAACGAGAGCTTGTGACCCGAG-----TGGGGACAATAAGGTGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_D      CAG--TG--GTTCAAT--TCCTCG-GGTCGGACCTGATGCTGACATATATCTGAGC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_D      CCAGTCCAAGCTGTGAGTAATCTGTGTGGGTCAGGCGAAGGCTTGACTCAGGCGGATTCT
CAE.EL_B      CCGTGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCA


ARA.TH_D      -AAAGTCGGAGGGTAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACTTCCCTCTTAC
CAE.EL_B      TAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


ARA.TH_D      AGCAGTGGATGGATCATA-GTTCGAAG-TCTC--TCAGATCCACTATGGCC-CGCTGGT-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


ARA.TH_D      TCGATC---TCTC-CTGGACCACCACTTT--
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#1026

Mean pairwise ID: 36.56%


ARA.TH_C      GTCGAACTCAGTAACGCGGGCTTGTGATCCAAG------TGGAGACAATAAGGGGATGGG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


ARA.TH_C      ACG--TTG--GGTCGAT-CTCATTG-GGCCGGGTTCGGGTTGGGCTATATTCTGGCC-CG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


ARA.TH_C      CCCATTCCAAGTTGGGAGTTGAGGCATGGGCTTCGAGCGAAGGCTCGGGTCTCATGTCTT
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


ARA.TH_C      CT-AGAGTGGGGGAGACCGCGTGAGGCTGGTTTCACAGAGCAGCGTCCACCTCCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_C      TGACGGTGGAAGGATTACG-GGCCATTG-CCT---TCCGAGCCCACTATGACC-CAATAA
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


ARA.TH_C      G--CCGCT---CCGA-TTGGACCATCACTTT
CAN.SPE.      -CCTGTGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#1027

Mean pairwise ID: 36.56%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG-----TGGGGACTATAAGATGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


ARA.TH_G      CAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


ARA.TH_G      CCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGCT
CAE.EL_B      CCGTGCCAAGCGCTGCGTCACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGCA


ARA.TH_G      -AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.EL_B      TAAGG-AGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


ARA.TH_G      AGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG-------TATACACAG---C


ARA.TH_G      TCGTAA--CCCGC-TTGAACCACCATTTT--
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#1028

Mean pairwise ID: 36.56%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG-----TGGGGATGTTAAGGTGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_O      TA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_O      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_O      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_O      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--C


LYC.ES_O      GCTGCT---CCAA-TTAAACCACCACTTT--
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#1029

Mean pairwise ID: 36.56%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA-----TGGGGGCATTAATGTGGTGGAA
CAE.EL_B      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATAAGTGTGG


LYC.ES_G      TG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TGC
CAE.EL_B      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_G      CCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTCC
CAE.EL_B      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_G      T-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTTG
CAE.EL_B      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_G      TGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG-
CAE.EL_B      TGCAGTGGCCGGACT-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--C


LYC.ES_G      GCTGCT---CCAA-TTAAACCACCACTTTT-
CAE.EL_B      CTTCTCAATACCTTCAG-ACCACTTGTTTTT


[Download ClustalW]

#1030

Mean pairwise ID: 36.56%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_G      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_G      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_G      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_G      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_G      -GCTGCT---CCAA-TTAAACCACCACTTTT
RAT.RAT.      CCTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1031

Mean pairwise ID: 36.56%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_G      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_G      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_G      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_G      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_G      -GCTGCT---CCAA-TTAAACCACCACTTTT
HOM.SA_A      CCTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1032

Mean pairwise ID: 36.66%


CAE.EL_A      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTCAGCTTCTTGACGGTAGATAAGTGTGGATGG
LEI.MAJ.      GCCGGAGC----TC---TGCTCTGTAACCT--T---CGGGGGCTAACCAGGCTT--AGCG


CAE.EL_A      AGTGAGAGGAGGAGTCCTGTGTATG-TCGTTGTCTACGTCGACCGAGCGTCCGTGCCAAG
LEI.MAJ.      GGGAGGACGTGGA--CCAGCGAGGGTGATTTGC-TGCGTTGACGTGGTGCTC-TGCTTGG


CAE.EL_A      CGCTACGTCACCAG-GGGATAACTGTCGGAAGGCGGTTAGTCCCGGGTG-CATAAGGAGT
LEI.MAJ.      CTGTGTGTCGGTGTGGCTTGCCCCCCTGCAGAGGGTGGCGCGGGT-CCGCCGTTGAAGCG


CAE.EL_A      CGTGGAT-GGTTCAGGACCGAAAGGTAGCAGACAAAAGCGACCGCGTG-GTGCAGTGGCC
LEI.MAJ.      AGGGAACCGGGTCAGGCCGGAAACGGAGCAGCCCA-CCCC-ACGCACGTCCGCCGTTGCA


CAE.EL_A      GGACCGCGCTTGTGAGTTGA--CACA---CATACGCAG-CCTTCTCGATACCTTCAGACC
LEI.MAJ.      GAATCACACCGCGGAGCATGTCC---GCACTTGAGC--CCCACGCTT---CGTCGCG-AA


CAE.EL_A      ACTTATCATTT
LEI.MAJ.      GCCTT------


[Download ClustalW]

#1033

Mean pairwise ID: 36.67%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_H      AT-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_H      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_H      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_H      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_H      GTTGCT---CCAA-TAAACAACCACCTTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1034

Mean pairwise ID: 36.67%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_A      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_A      CCCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_A      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_A      GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_A      GTTGCT---CCAA--TAAACAACCACCTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1035

Mean pairwise ID: 36.67%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_H      AT-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_H      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_H      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_H      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_H      GTTGCT---CCAA-TAAACAACCACCTTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1036

Mean pairwise ID: 36.67%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_K      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_K      CCCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_K      CT-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_K      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_K      GTTGCT---CCAA--TAAACAACCACCTTT
HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1037

Mean pairwise ID: 36.67%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


LYC.ES_J      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_J      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_J      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_J      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_J      GTTGCT---CCAA--TAAACAACCACCTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1038

Mean pairwise ID: 36.67%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAGATGGG
ORI.CUN.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCCGGAG


HUM.JA_A      ACT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TG
ORI.CUN.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TCGTGC-GCTATGCC----GATCGGGTG-


HUM.JA_A      CCCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC
ORI.CUN.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.JA_A      CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT
ORI.CUN.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.JA_A      CGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-
ORI.CUN.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.JA_A      TGCACT--CTTAA-TCAGACCATCTCTTTT
ORI.CUN.      CTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#1039

Mean pairwise ID: 36.67%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAGATGGGA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


HUM.JA_A      CT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


HUM.JA_A      CCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


HUM.JA_A      CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


HUM.JA_A      CGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG------CAGAACAG---C


HUM.JA_A      TGCACT--CTTAA-TCAGACCATCTCTTTT
XEN.LAE.      CTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#1040

Mean pairwise ID: 36.67%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_A      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_A      CCCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_A      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_A      GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_A      GTTGCT---CCAA--TAAACAACCACCTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1041

Mean pairwise ID: 36.67%


ARA.TH_G      GTCGAGCTATGTAACGAGAGCTTGTAACCCAAG------TGGGGACTATAAGATGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


ARA.TH_G      ACAC--TG--GATCGGC--CCA-CG-GGTCGGATTTGTTGTTGGCATAGGTCTGGAC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


ARA.TH_G      CCCAATCCAAGCTGTGAGTGAACCGTATGAACCAAGCGAAGGTTTGATCCGTACGGTTGC
HOM.SA_B      TCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGC


ARA.TH_G      T-AAAGGTTGAGGGTATTGCGTTAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
HOM.SA_B      CTAAGG-AGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


ARA.TH_G      CAGCAGTGGACGGACAACG-GTTCGACG-CCAC--ACAAATCCACTATGGTC-CGCTGGC
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG---


ARA.TH_G      -TCGTAA--CCCGC-TTGAACCACCATTTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#1042

Mean pairwise ID: 36.67%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAGATGGG
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


HUM.JA_A      ACT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.JA_A      CCCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.JA_A      CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.JA_A      CGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.JA_A      TGCACT--CTTAA-TCAGACCATCTCTTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1043

Mean pairwise ID: 36.67%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
RAT.RAT.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGACAGAG


LYC.ES_J      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
RAT.RAT.      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


LYC.ES_J      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
RAT.RAT.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_J      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
RAT.RAT.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_J      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
RAT.RAT.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_J      GTTGCT---CCAA--TAAACAACCACCTTT
RAT.RAT.      CTGGGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1044

Mean pairwise ID: 36.70%


HUM.JA_B      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG-TGGGGGCATGTGGGAAATGGGACT-
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT---AG


HUM.JA_B      -TTA-GTTCGGC--CCATTG-GATC---GGATCCAGTGTTAGCTGCTTGCTGGGC-TGCC
TET.ROS.      TTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-CC


HUM.JA_B      CATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTCCT
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAGGACTTCACCAGGGCATT


HUM.JA_B      -AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCTCG
TET.ROS.      AAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTATT


HUM.JA_B      GCAGTGGAAGGATAACG-GGCCGGTGCTGC--TTGGACCCACCATGGTTCACTGAG--CT
TET.ROS.      GTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------GCTAATCG-GTTCTG-C


HUM.JA_B      GACT-CTTAA-TAGGACCATTTCTTTT
TET.ROS.      TATTC---TGATCA-GACACT------


[Download ClustalW]

#1045

Mean pairwise ID: 36.70%


HUM.LU_B      ----GGCCTTAGCAACGTGGGCCTGTAACCCAAG-TGGGGGCATGTGGGAAATGGAAC-A
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


HUM.LU_B      -TTG--GGTCAGC--CCAGTG-GATC---GGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


HUM.LU_B      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCCTGGGTTGCGCAGCTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


HUM.LU_B      T-AGAGTGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACTACCTCCCGCTCCC
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


HUM.LU_B      GGCAGTGGAAGGATAACG-GGCCGGTGCTAC--TTGGTCCACCATGT-TCACTGGT-CCT
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-----ACTAATCG-GTTCTA-C


HUM.LU_B      GACT-CTTAA-TCGGACCATTTCCTTT
TET.THE.      TATCA---AAGCCA-GACATT------


[Download ClustalW]

#1046

Mean pairwise ID: 36.73%


TRI.AE_A      NCC-GAGCTCAGTTGCGAGAGCTTGTAACCCGAG-TGGGGGCATTAAAGTGATGTGAACG
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT---AG


TRI.AE_A      C-TGTT--GTA-GCG---CTGCG-GGCCT--GGTCTGGG--TGTGCTACTGCTGGCC-CG
TET.THE.      GTT---GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT---AAGAGTGTG-


TRI.AE_A      CCCGTTCCAAGTTGCGTAGTGGACCGCCTGGGGCTTATGCGAAAGC-TGGGTCTCA-CGG
TET.THE.      CCCGCTCCAAACAA-TGAGT-TGCTAT-GGTGGTAACCTAGTAATAGGACTCCACCAGGG


TRI.AE_A      TCCATAATGTGGCAGGCACAGCGTGAGGCTGGCTTCACAGAGCAGCGACAACTGCCCGCT
TET.THE.      CATTAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCT


TRI.AE_A      TCCAACGGTGGAAGGATAATG-GGCCGCTGCACT--CCTAGGCCAATTGGGCCTCGCAG-
TET.THE.      TGTTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA------ACTAAT-CG-GTT


TRI.AE_A      ---CCTAC-TCCA-GCAGACCACC
TET.THE.      CTACTATCA--AAGCCA-GACATT


[Download ClustalW]

#1047

Mean pairwise ID: 36.78%


ZEA.MA_C      NCC-GAGCTCTGTAGCGAGAGCTTGTAACCCGAG-CGGGGGCATTAAGGTGGTGTGGATG
TET.ROS.      GCCAGGGTAG--CA----ATGCCTGTGACCT---CGTGTGGC--ATAAACAATGT----A


ZEA.MA_C      C-TTG--GTACCGT--GTCTT-TGCCT--GGGTTCATGGTGTGCCTTTGTTGGCC-TGCC
TET.ROS.      GTTA-GAATAGTCAGAGTATGAGA-GTTTGATGAGACAGTTTGCT---AAGAGTGTG-CC


ZEA.MA_C      CGTTCCAAGTTGGTAGTGGCCGTTGGAAGCTTGGGCGTAGGCCCTGGGCTTCC-TTGGAC
TET.ROS.      CGTTCCAAACAGTGAGT-TGCTATGGTGGAAACCTAGTAATAG-GACTTCACCAGGGCA-


ZEA.MA_C      CT-ATAGTGGCAGGAACGGCGTGAGGCTGTCTTCACAGAGCAGCGATCACTGCCGGCTAT
TET.ROS.      TTAAAGAGCTGAGGAACCGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTA


ZEA.MA_C      TAACGGTGGAAGGATAACA-GGCCACTGCAGC--ATGGGCTCGCTTAAGGCCTAGAC---
TET.ROS.      TTGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-------GCTAATCG-GTTCT


ZEA.MA_C      TTC-ATA-CTAAAGCAGACCACCATTTTT
TET.ROS.      G-CTATTC--TGATCA-GACACT------


[Download ClustalW]

#1048

Mean pairwise ID: 36.78%


TRI.AE_B      NCCGAGCT-AGTTGCGGGAGCTTGTCACCCATG-----TGGGGGCATTGAGGCGGTGTGG
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGT-G


TRI.AE_B      ATGC-TTG--GTGCGGT---TTGTT-GGCCTGGGCTTGTGATGTAACCTTGCTGGCC-TG
CAE.BRI.      GATGGAGTGAAGGGAGGAGTCCTGTGGGTG--TTGTCG-GCAACGGC---GACCGAGCG-


TRI.AE_B      CCCGTTCCAAGTTGGTAGTGGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-C
CAE.BRI.      TCCGTGCCAAGCGCTGCGTCGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


TRI.AE_B      T-TAAGTGGCAGGCACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCC
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


TRI.AE_B      AACGGTGGAAGGATAACA-GGCCGCTG-CAGC--ATGGGCCCGCTCTGGGCCTCCTA-CC
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCACAGCCT


TRI.AE_B      CCGC--CAT-A-GCAGACCACCATCTTT-
CAE.BRI.      CTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#1049

Mean pairwise ID: 36.81%


HOM.SA_B      GCC-GGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTC-GGGAGGCTGAGGTGGGAGG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---T-----CGGGGGCTGATCCCGCTT--


HOM.SA_B      ATCGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATGGGGTGTCCGCACTA
TRY.BR_A      AGCGGGGACGTCTTGGA--CAAGCGGGGGTTCTGT-TGCGTTGACTTGGTGTTC-TGCTT


HOM.SA_B      AGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
TRY.BR_A      GGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT


HOM.SA_B      GGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GATCAGTAGT
TRY.BR_A      GGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCG


HOM.SA_B      GGGATCGCGCCTGTGAATAGC--CACTG-CACTCCAG-CCTGAGCAACATAGCGAGACCC
TRY.BR_A      AGAAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGG


HOM.SA_B      CGTCTCT
TRY.BR_A      CGG----


[Download ClustalW]

#1050

Mean pairwise ID: 36.81%


GAL.GAL.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGCTGAGCCCGCCGG
TRY.BR_B      AGCCGGAGCG--CAT---TGCTCTGTAACCT---T-----CGGGGGCTGATCCCGCTT--


GAL.GAL.      ATCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGAGCGGGCGTCCGCGCTA
TRY.BR_B      AGCGGGGACGTCTTGGA--CAAGCGGGGGTTCTGT-TGCGTTGACTTGGTGTTC-TGCTT


GAL.GAL.      AGGCCGGCATCAATAT-GGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTGCCTAAGGAG
TRY.BR_B      GGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT


GAL.GAL.      GGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCC-GGTCAGTAAC
TRY.BR_B      GGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTGC


GAL.GAL.      GGGATCGCGCCTGTGAATAGC--CACTG-CAGCGTAG-CCTGGGCAACATAGCGAGACCC
TRY.BR_B      AGAAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGG


GAL.GAL.      TGTCTCC
TRY.BR_B      CGGTTT-


[Download ClustalW]

#1051

Mean pairwise ID: 36.81%


CAN.SPE.      GCC-GGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTC-GGGAGGCTGAGGCAGGAGG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---T-----CGGGGGCTGATCCCGCTT--


CAN.SPE.      ATCGCTTGAGCCCAGGAGTTCTGGGCTGCAGTGCGCTATGCCGATCGGGTGTCCGCACTA
TRY.BR_A      AGCGGGGACGTCTTGGA--CAAGCGGGGGTTCTGT-TGCGTTGACTTGGTGTTC-TGCTT


CAN.SPE.      AGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
TRY.BR_A      GGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT


CAN.SPE.      GGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GATCAGTAGT
TRY.BR_A      GGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCG


CAN.SPE.      GGGATCGCGCCTGTGAATAGC--CACTG-CACTCCAG-CCTGTGCAACATAGCGAGACCC
TRY.BR_A      AGAAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGG


CAN.SPE.      CGTCTCT
TRY.BR_A      CGG----


[Download ClustalW]

#1052

Mean pairwise ID: 36.86%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


HUM.LU_D      ACT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


HUM.LU_D      CCCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


HUM.LU_D      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


HUM.LU_D      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACTGGG
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG---


HUM.LU_D      -CTGACT--CTTAA-TAGGACCATTTCTTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#1053

Mean pairwise ID: 36.86%


HUM.LU_A      GCCGGTCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


HUM.LU_A      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


HUM.LU_A      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGGCTGGGTTGCGCACGTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


HUM.LU_A      CT-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


HUM.LU_A      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGGTCCACCATGCTT-CACTAGG
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG---


HUM.LU_A      -CTGACT--CTTAA-TAGGACCATTTCTTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#1054

Mean pairwise ID: 36.86%


HUM.LU_D      GACGGGCTTAGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


HUM.LU_D      CT--TTG--GGTCAAC--CTAGTG-GATCGGGTCCAGTGTTAGCTGCTTACTGGTC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


HUM.LU_D      CCATTCCAAGCCGGGAGTTGGGCTGAGTGACCTGGGCGAAGGCT-GGGTTGCGCAGCTCC
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


HUM.LU_D      T-AGAGTGGAGGGCAATGCGTGAGGCTGGCTTCACAGAGCAGCGACTACCTCCCGCTCTC
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


HUM.LU_D      GGCAGTGGAAGGATAACG-GGCCGGTG-CTAC--CTGGATCCACCATGCTT-CACTGGG-
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG---C


HUM.LU_D      CTGACT--CTTAA-TAGGACCATTTCTTTT-
CAE.BRI.      CTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#1055

Mean pairwise ID: 36.86%


HUM.JA_B      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAAATGGGA
XEN.LAE.      GCCGGGCGCTGTGGCGTGTGCCTGTAATCC-AGCTACTTGGAGGC---TTGGGCTGTCGG


HUM.JA_B      CT--TTA--GTTCGGC--CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TGC
XEN.LAE.      ATCGCTTGAGTCCAGGAGTTCTGGGCTG--CACTGA-GCTATGTC----GATCGGGTG-T


HUM.JA_B      CCATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTC-
XEN.LAE.      CCGCACTAAGTTCGGTAT-CAATATGGTGTTCCTGGGGGAGCCTCGGATCACCAGGTTGC


HUM.JA_B      CT-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCT
XEN.LAE.      TCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACCCCCGTGCC


HUM.JA_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTGAG
XEN.LAE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CGGTG-------CAGAACAG---


HUM.JA_B      -CTGACT--CTTAA-TAGGACCATTTCTTTT
XEN.LAE.      CCTGAACAACACAGCGAG-ACACAGTTCT--


[Download ClustalW]

#1056

Mean pairwise ID: 36.86%


LYC.ES_G      GCCGAGCTTAGTAATGTGGGCTTGTAACCCAAA------TGGGGGCATTAATGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_G      ATG--TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_G      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_G      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_G      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_G      -GCTGCT---CCAA-TTAAACCACCACTTTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1057

Mean pairwise ID: 36.86%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG-----TGAGGGCATCAGTGTGGTGGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


LYC.ES_C      TG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


LYC.ES_C      CCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCC
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


LYC.ES_C      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTG
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


LYC.ES_C      TGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG-
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT--------CGCCCACAG--C


LYC.ES_C      GCTGTT---CTAG-TTAAACTACCACATTT-
CAE.BRI.      CTCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#1058

Mean pairwise ID: 36.86%


LYC.ES_C      GCCGAGCTCAGTAGCGTGGGCTTGTAACTCAAG-----TGAGGGCATCAGTGTGGTGGAA
CAE.EL_C      ACCGAGCGTCGTGGCGGGCGCTTGTGAGTC-AGCTTCTTGACGGT---AGATGAGTGTGG


LYC.ES_C      TG--TTG--AACATGC--CCAGAA-GGTAGGGCTTGT--GTGACAATTCTCTGGCC-TGC
CAE.EL_C      ATGGAGTGAGAGGAGGAGTCCTGTGTATG-TCGTTG-TCAACGTC----GACCGAGCG-T


LYC.ES_C      CCTGTCCAAGCAAAGAGTTGGGTCTTGTGGGCCAAGCGAAGGCTTGGGCTGCTGGGCTCC
CAE.EL_C      CCGTGCCAAGCGCTGCGT-CACCAGGGGATGACTGTCGGAAGATGGTCAGTCCCGGGTGC


LYC.ES_C      T-AAAGTGGGGTGGACTGCGTGAGGCTGGTTTCACAGAGCAACGAATAGCTCCCGCTCTG
CAE.EL_C      ATAAGGAGTGGTGGAT-GGTTCAGGACCGAA--AGGTAGCAGACAAAAGCCACCGCGCGG


LYC.ES_C      TGCAGTGGAAGGATAACG-AGCCAGTG-TCAT--ATAAGTTCAACGAATGTC-TGATGG-
CAE.EL_C      TGCAGTGGCCGGACA-GCGCTTGT--GA-GTTGA--CACG--------TATACACAG--C


LYC.ES_C      GCTGTT---CTAG-TTAAACTACCACATTT-
CAE.EL_C      CTTCTCAATACCTTCAG-ACCACTTGTCACT


[Download ClustalW]

#1059

Mean pairwise ID: 36.86%


HUM.JA_B      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAAATGGG
GAL.GAL.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGCCCGCCG


HUM.JA_B      ACT--TTA--GTTCGGC--CCATTG-GATCGGATCCAGTGTTAGCTGCTTGCTGGGC-TG
GAL.GAL.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GAGCGGGCG-


HUM.JA_B      CCCATTCCAAGCCGAGAGTTGAGCTGTGTGAGCCGGACGAAGGTCTGGCTTGGTCAGCTC
GAL.GAL.      TCCGCGCTAAGGCCGGCAT-CAATATGGTGAGCCCCGGGGAGCCGAGGCACACCAGGTTG


HUM.JA_B      CT-AAAGCGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACAACCTCCCGCTCT
GAL.GAL.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCC


HUM.JA_B      CGGCAGTGGAAGGATAACG-GGCCGGTG-CTGC--TTGGACCCACCATGGTT-CACTGAG
GAL.GAL.      GGTCAGTAACGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CAGCGTAG---


HUM.JA_B      -CTGACT--CTTAA-TAGGACCATTTCTTTT
GAL.GAL.      CCTGGGCAACATAGCGAG-ACCCTGTCTCC-


[Download ClustalW]

#1060

Mean pairwise ID: 36.97%


LYC.ES_H      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_H      AT-A-TTG--GGCTGTA--CCAGAT-GGTTGGGCTTGGT--GGGCTAATTTCTGACT-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_H      CCCTATCCAAGCTTAGAGTTGGATCATGTGGCCCAATTGAAGAAATGGACTACTTGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_H      GT-AAAGTGGGGCGGAATGCGTGAGGCTGGTTTCACAGAGCAGTGAACAGCTCCCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_H      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_H      GTTGCT---CCAA-TAAACAACCACCTTTT
HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1061

Mean pairwise ID: 36.97%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAGATGGG
HOM.SA_A      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCTGGAG


HUM.JA_A      ACT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TG
HOM.SA_A      GATCGCTTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.JA_A      CCCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC
HOM.SA_A      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.JA_A      CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT
HOM.SA_A      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.JA_A      CGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-
HOM.SA_A      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.JA_A      TGCACT--CTTAA-TCAGACCATCTCTTTT
HOM.SA_A      CTGTGCAACATAGCGAG-ACCCCGTCTCTT


[Download ClustalW]

#1062

Mean pairwise ID: 36.97%


LYC.ES_A      GGCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_A      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_A      CCCTGTCCAAGCACAGAGTTGGATCTCGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_A      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAA-CGCTCCCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_A      GTGCAGTGGAAGGATAATG-GGTCGGTG-TCTT-ATCAAGTTCAGTAACGCC-TAATGG-
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_A      GTTGCT---CCAA--TAAACAACCACCTTT
HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1063

Mean pairwise ID: 36.97%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAGATGGG
CAN.SPE.      GCCGGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGCAGGAG


HUM.JA_A      ACT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TG
CAN.SPE.      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--CAGTGC-GCTATGCC----GATCGGGTG-


HUM.JA_A      CCCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC
CAN.SPE.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.JA_A      CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT
CAN.SPE.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.JA_A      CGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-
CAN.SPE.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.JA_A      TGCACT--CTTAA-TCAGACCATCTCTTTT
CAN.SPE.      CTGTGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1064

Mean pairwise ID: 36.97%


LYC.ES_K      GTTGAGCTTAGTAACGTGGGCTTGTAATCCAAG-----TGGAGACATCAAAGTGGTTGAA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


LYC.ES_K      TA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


LYC.ES_K      CCTGTCCAAGCACAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCC
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


LYC.ES_K      T-AAAGCGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTG
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


LYC.ES_K      TGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-G
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT-------CGCCCACAG--CC


LYC.ES_K      TTGCT---CCAA--TAAACAACCACCTTT-
CAE.BRI.      TCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#1065

Mean pairwise ID: 36.97%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG-----TGGGGGCATGTGGGAGATGGGA
CAE.BRI.      ACCGGGTGTCGTGGCGGGCGCCTGTGAGTC-AGCTTCTTGACGGT---AGACAAGTGTGG


HUM.JA_A      CT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TGC
CAE.BRI.      ATGGAGTGAAGGGAGGAGTCCTGTGGGTG-TTGTCG-GCAACGGC----GACCGAGCG-T


HUM.JA_A      CCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCC
CAE.BRI.      CCGTGCCAAGCGCTGCGT-CGCCAGGGGTCTCCGGTCGGAAGGCTGGCGGTCCCGGGCGC


HUM.JA_A      T-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTC
CAE.BRI.      ATAAGGAGTGGTGCAC-GGCTCAGGGCCGAA--AGGCAGCAGGCAAAAGCCACCGCGCGG


HUM.JA_A      GGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-T
CAE.BRI.      TGCAGTGGCCGGATA-GCGCTTGT--GA-GTTGT--CGCT------CGCCCACAG---CC


HUM.JA_A      GCACT--CTTAA-TCAGACCATCTCTTTT-
CAE.BRI.      TCTCTGATACCTTCAG-ACCACTTGTCATT


[Download ClustalW]

#1066

Mean pairwise ID: 36.97%


LYC.ES_O      GCCGAGCTTAGTAACGTGGGCTTGTAACCCAAG------TGGGGATGTTAAGGTGGTGGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_O      ATA--TTG--GGCTGTC--CCAGAT-GGCTGGGCTTGGT--GGGCTAATTTCTGGCC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_O      CCCTATCCAAGCACAGAGTTGGATCATGTGGTCCAATTGAAAGAATGGGCTACTAGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_O      CT-AAAGTGGGGTGGACCGCGTGAGGCTGGTTTCACAGAGCAACGAAAAACTTCCGCTTT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_O      GTGCAGTGGAAGGATAACG-GACCGGTGCCTT---CCAAGTTCCATTAATGCC-TGATGG
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG--------CACTCCAG--


LYC.ES_O      -GCTGCT---CCAA-TTAAACCACCACTTT
HOM.SA_B      CCTGAGCAACATAGCGAG-ACCCCGTCTCT


[Download ClustalW]

#1067

Mean pairwise ID: 36.97%


HUM.JA_A      ---GGCCT-AGCAACGTGGGCCTGTAACCCAAG------TGGGGGCATGTGGGAGATGGG
RAT.NOR.      GCCGGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGACAGGAG


HUM.JA_A      ACT--TTG--GGTCAGC--CCATTG-GATCGGGTCCAGTGTTAGCTGCTTGCTGGTC-TG
RAT.NOR.      GATCGATTGAGTCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATCGGGTG-


HUM.JA_A      CCCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTC
RAT.NOR.      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


HUM.JA_A      CT-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCT
RAT.NOR.      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


HUM.JA_A      CGGCAGTGGAAGGATAACG-GGTCGGTG-CTAC--TTGGGCCACCATGG-T-CACTGCA-
RAT.NOR.      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG------CACTCCAG---C


HUM.JA_A      TGCACT--CTTAA-TCAGACCATCTCTTTT
RAT.NOR.      CTGGGCAACATAGCGAG-ACCC-GTCTCT-


[Download ClustalW]

#1068

Mean pairwise ID: 36.97%


LYC.ES_J      GTCGAGCTTAGTAACGTGGGCTTGTAATCCAAG------TGGAGACATCAAAGTGGTTGA
HOM.SA_B      GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGC---TGAGGTGGGAG


LYC.ES_J      ATA--TTG--GGCTTTA--CCAGAA-GGTTGGGCTTGGT--GGGCTTAGTTCTGGCC-TG
HOM.SA_B      GATCGCTTGAGCCCAGGAGTTCTGGGCTG--TAGTGC-GCTATGCC----GATGGGGTG-


LYC.ES_J      CCCTGTCCAAGCACAGAGTTGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTC
HOM.SA_B      TCCGCACTAAGTTCGGCAT-CAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTG


LYC.ES_J      CT-AAAGTGGGGCGGACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCT
HOM.SA_B      CCTAAGGAGGGGTGAACCGGCCCAGGTCGGAA--ACGGAGCAGGTCAAAACTCCCGTGCT


LYC.ES_J      GTGCAGTGGAAGGATAATG-GGTCGGTGTCTT--ATCAAGTTCAGTAACGCC-TAATGG-
HOM.SA_B      GATCAGTAGTGGGATC-GCGCCTGT--GA-ATAGC--CACTG-------CACTCCAG--C


LYC.ES_J      GTTGCT---CCAA--TAAACAACCACCTTT
HOM.SA_B      CTGAGCAACATAGCGAG-ACCCCGTCTCT-


[Download ClustalW]

#1069

Mean pairwise ID: 37.00%


HUM.JA_A      ----GGCCT-AGCAACGTGGGCCTGTAACCCAAG-TGGGGGCATGTGGGAGATGGGACT-
TET.THE.      GCCAGGGTAG--CA----ATACCTGTGTCTA---TATGTGGC--ATAAACAATGT--AGG


HUM.JA_A      -TTG--GGTCAGC--CCATTG-GATC---GGGTCCAGTGTTAGCTGCTTGCTGGTC-TGC
TET.THE.      TT--GTGATAGATAGGATATGAGA-GTTTGATGAGACAGTTTGCT----AAGAGTGTG-C


HUM.JA_A      CCATTCCAAGCCGAGAGTTGGGCTGTGTGATCTGGGCGAAGGCTGGGGTCGCACAGCTCC
TET.THE.      CCGCTCCAAACAATGAGT-TGCTATGGTGGTAACCTAGTAATAGGACTCCACCAGGGCAT


HUM.JA_A      T-AAAGAGGAGGGCAATGCGTGAGGCTGGTTTCACAGAGCAGCGACCACCTCCCGCTCTC
TET.THE.      TAAAGAGCTAAGGAAACGCCTCAGGCTGGCA--ACAGAACAGGGAAAACTTGCCGCTTGT


HUM.JA_A      GGCAGTGGAAGGATAACG-GGTCGGTGCTAC--TTGGGCCACCATGG-TCACTGCA--TG
TET.THE.      TGTGGTGGAAGGATA-ACATACTC--ATTAACTGTCAA-----ACTAATCG-GTTCTA-C


HUM.JA_A      CACT-CTTAA-TCAGACCATCTCTTTT
TET.THE.      TATCA---AAGCCA-GACATT------


[Download ClustalW]

#1070

Mean pairwise ID: 37.01%


RAT.RAT.      GCC-GGGCGCGGTGGCGCACGCCTGTAGTCCCAGCTACTC-GGGAGGCTGAGGACAGAGG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---T-----CGGGGGCTGATCCCGCTT--


RAT.RAT.      ATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
TRY.BR_A      AGCGGGGACGTCTTGGA--CAAGCGGGGGTTCTGT-TGCGTTGACTTGGTGTTC-TGCTT


RAT.RAT.      AGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
TRY.BR_A      GGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT


RAT.RAT.      GGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GATCAGTAGT
TRY.BR_A      GGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCG


RAT.RAT.      GGGATCGCGCCTGTGAATAGC--CACTG-CACTCCAG-CCTGGGCAACATAGCGAGACCC
TRY.BR_A      AGAAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGG


RAT.RAT.      CGTCTCTT
TRY.BR_A      CGG-----


[Download ClustalW]

#1071

Mean pairwise ID: 37.01%


HOM.SA_A      GCC-GGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTC-GGGAGGCTGAGGCTGGAGG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---T-----CGGGGGCTGATCCCGCTT--


HOM.SA_A      ATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTA
TRY.BR_A      AGCGGGGACGTCTTGGA--CAAGCGGGGGTTCTGT-TGCGTTGACTTGGTGTTC-TGCTT


HOM.SA_A      AGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
TRY.BR_A      GGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT


HOM.SA_A      GGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GATCAGTAGT
TRY.BR_A      GGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCG


HOM.SA_A      GGGATCGCGCCTGTGAATAGC--CACTG-CACTCCAG-CCTGTGCAACATAGCGAGACCC
TRY.BR_A      AGAAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGG


HOM.SA_A      CGTCTCTT
TRY.BR_A      CGG-----


[Download ClustalW]

#1072

Mean pairwise ID: 37.10%


TRI.AE_B      NCCGAGCTAGTTGCGGGAGCTTGTCACCCATGTGGGGGCATTGAGGCGGTGTGGATGCTT
LYC.ES_D      ------------------------------------------------------------


TRI.AE_B      GGTGCGGTTTGTTGGCCTGGGCTTGTGATGTAACC-TTGCTGGCCTGCCCGTTCCAAGTT
LYC.ES_D      ---------------------------------TAG-TTCTGGCCTGCCCTGTCCAAGCA


TRI.AE_B      GGTAGT-GGGCTGGGTGGCTGGGGCGAAAGCTTCGCCTTCTCAGGC-CTTAAGTGGCAGG
LYC.ES_D      CAGAGTAGGATCACGAGGCCCAAATGAAAATATGGGCTTCTTGATTCCTAAAGCGGGGCG


TRI.AE_B      CACCACGTTAGGCTGGTTTCACAGAGCAGCGACAACTGCC-GCTTCCAACGGTGGAAGGA
LYC.ES_D      GACCGCATGAGGCTGGCTTCACAGAGCAGTGAACAGCTCCCGCTCTGTGCAGTGGAAGGA


TRI.AE_B      TAACAGGCCGCTGCAGC-ATGGGCCCGCTCTGGGCCTCCTA--CCCCGCCAT-AGCAGAC
LYC.ES_D      TAATGGGTCGGTGTCTTATCAAGTTCAGT-AACGCC-TAATGGGTTGCT-CCAACTAAAC


TRI.AE_B      CACCATCTTT
LYC.ES_D      CACCACTTTT


[Download ClustalW]

#1073

Mean pairwise ID: 37.13%


ORI.CUN.      GCC-GGGCGCGGTGGCGCGCGCCTGTAGTCCCAGCTACTC-GGGAGGCTGAGGCCGGAGG
TRY.BR_A      AGCCGGAGCG--CAT---TGCTCTGTAACCT---T-----CGGGGGCTGATCCCGCTT--


ORI.CUN.      ATCGCTTGAGTCCAGGAGTTCTGGGCTGTCGTGCGCTATGCCGATCGGGTGTCCGCACTA
TRY.BR_A      AGCGGGGACGTCTTGGA--CAAGCGGGGGTTCTGT-TGCGTTGACTTGGTGTTC-TGCTT


ORI.CUN.      AGTTCGGCATCAATAT-GGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAG
TRY.BR_A      GGTTGCGTGTCGGTGTTGAGGTCGCCACTGTAGAGAGGCGTTCTCGCGCCGT-TAA-AGT


ORI.CUN.      GGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCT-GATCAGTAGT
TRY.BR_A      GGGGGGAACGGGTCAGGCCGGTGACGGAGCAGCCCA-CCTT-GCGCACGTTCCC-GTTCG


ORI.CUN.      GGGATCGCGCCTGTGAATAGC--CACTG-CACTCCAG-CCTGGGCAACATAGCGAGACCC
TRY.BR_A      AGAAGCACACCGAGGAGCATCTCAGGACTTTGCGC--CCCAAG-TGT--CGTCGCG-AGG


ORI.CUN.      TGTCTCC
TRY.BR_A      CGG----


[Download ClustalW]