Structure #1390
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr22 |
| Strand | + |
| Position | 18,488,478 - 18,488,534 |
| Number of sequences | 6 |
| Organisms | human, mouse, rat, dog, chicken, fugu, zebrafish |
| Mean pairwise identity | 72.53 |
| Columns | 59 |
| Mean single MFE | -22.71 |
| Consensus MFE | -16.44 |
| Combinations/base pair | 28 / 16 = 1.75 |
| SCI | 0.72 |
| z-score | -4.53 |
| RNA class probability | 0.976224 |
This structure is part of cluster 64435
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 6 Slice: 1 to 59 Columns: 59 Strand: + Mean pairwise identity: 72.53 Mean single sequence MFE: -22.71 Consensus MFE: -16.44 Energy contribution: -15.26 Covariance contribution: -1.19 Mean z-score: -4.53 Structure conservation index: 0.72 SVM decision value: 1.77 SVM RNA-class probability: 0.976224 Prediction: RNA ###################################################################### >hg17.chr22/18488478-18488534 GCAGACUCACUCUGCAUCUGACUAUACUUCCAGGCGGGUGCUUUUUCUGUCUGCCA ((((((.......(((((((.((........)).))))))).......)))))).. ( -19.84) >mm5.chr16/80784111-80784055 GCAGAUUCACUCUGCACCUGGCUGCAGCUCCAGUCUGGUGCUUUUUCCAUCUGCCA ((((((.......(((((.(((((......))))).))))).......)))))).. ( -23.14) >canFam1.chr26/9779046-9778990 GCAGACUCACUCUGCAUCCGGCUGCAGCCCCAGGCGGGUGCUUUUUCCGUCUGCCA ((((((.......(((((((.(((......))).))))))).......)))))).. ( -26.54) >galGal2.chr15/1292179-1292237 GCAGACUCACUCUGUACUGAACUGCAGUCUUCAGUUCAGGUGCUUUUUCUGUCUGCAA ((((((.......(((((((((((.......))))))).)))).......)))))).. ( -22.84) >fr1.chrUn/277631214-277631157 GCGGGCCCACUCUGUUCCUUGCUGCUCACUCCAGCCUGGAACUUUUUUCGCCUGCUA ((((((.......(((((..((((.......))))..))))).......)))))).. ( -23.34) >danRer1.chr5/3207032-3207089 GCAGACUCACUCUGUGUAAGGCAGAUACCUCCAGCCUUAGACUUUUUCUGUCUGCUA ((((((.......((.((((((.((....))..)))))).)).......)))))).. ( -20.54) >consensus GCAGACUCACUCUGCACCUGGCUG_CAC_CUCCAG_CCUGGUGCUUUUUCCGUCUGCCA ((((((.......(((((.(((((........))).)).))))).......)))))).. (-16.44 = -15.26 + -1.19)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
