Structure #13968
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr1 |
| Strand | + |
| Position | 103,200,720 - 103,200,782 |
| Number of sequences | 5 |
| Organisms | human, mouse, rat, dog, chicken |
| Mean pairwise identity | 77.47 |
| Columns | 66 |
| Mean single MFE | -16.74 |
| Consensus MFE | -11.6 |
| Combinations/base pair | 21 / 19 = 1.11 |
| SCI | 0.69 |
| z-score | -4.52 |
| RNA class probability | 0.999734 |
This structure is part of cluster 5504
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 5 Slice: 1 to 66 Columns: 66 Strand: + Mean pairwise identity: 77.47 Mean single sequence MFE: -16.74 Consensus MFE: -11.60 Energy contribution: -12.92 Covariance contribution: 1.32 Mean z-score: -4.52 Structure conservation index: 0.69 SVM decision value: 3.97 SVM RNA-class probability: 0.999734 Prediction: RNA ###################################################################### >hg17.chr1/103200720-103200782 UCAGUAUCAUUGAAAGAAAUAUAUUUGUACAUUGCUAUGUACAAAGAGAUAUUGCUUUCAAA .........(((((((.(((((.(((((((((....)))))))))...))))).))))))). ( -19.30) >mm5.chr3/46147468-46147402 UCGGUAUCACUGAAAGGAAUAUACUUGUACAUACACUGAUAUGUACAAAGACAUAUUGCUUUCAAA ..........((((((.(((((..(((((((((......)))))))))....))))).)))))).. ( -17.70) >rn3.chr2/48190446-48190380 UCAGUAUCACUGAAAGGAAUAUAUUUGUACAUACACCCAUAUGUACAAAGACAUAUUACUUUCAAA ..........((((((.(((((.((((((((((......))))))))))...))))).)))))).. ( -17.90) >canFam1.chr6/30106282-30106220 UCAGUAUCAUCGAAAGAAAUAUUUUUGUACAUUGGUAUGUACAAGGAAAUAUUGCUUUCAAA ...........(((((.(((((((((((((((....)))))))..)))))))).)))))... ( -17.10) >galGal2.chr8/18405301-18405246 UCAGAGUAAUUAAAAGAUCUUUGUACACAUAGUACAAAGAAGUAAUGCCUUCAUA ...(((..((((.....(((((((((.....)))))))))..))))..))).... ( -11.70) >consensus UCAGUAUCAUUGAAAGAAAUAUAUUUGUACAU____UGAUAUGUACAAAGAAAUAUUGCUUUCAAA ...........(((((.(((((.(((((((((........)))))))))...))))).)))))... (-11.60 = -12.92 + 1.32)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
