Structure #13969
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr1 |
| Strand | - |
| Position | 103,200,720 - 103,200,782 |
| Number of sequences | 5 |
| Organisms | human, mouse, rat, dog, chicken |
| Mean pairwise identity | 77.47 |
| Columns | 66 |
| Mean single MFE | -17.22 |
| Consensus MFE | -13.98 |
| Combinations/base pair | 30 / 22 = 1.36 |
| SCI | 0.81 |
| z-score | -4.34 |
| RNA class probability | 0.999404 |
This structure is part of cluster 5504
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 5 Slice: 1 to 66 Columns: 66 Strand: + Mean pairwise identity: 77.47 Mean single sequence MFE: -17.22 Consensus MFE: -13.98 Energy contribution: -14.30 Covariance contribution: 0.32 Mean z-score: -4.34 Structure conservation index: 0.81 SVM decision value: 3.57 SVM RNA-class probability: 0.999404 Prediction: RNA ###################################################################### >hg17.chr1/103200782-103200720 UUUGAAAGCAAUAUCUCUUUGUACAUAGCAAUGUACAAAUAUAUUUCUUUCAAUGAUACUGA .(((((((.(((((...(((((((((....))))))))).))))).)))))))......... ( -16.50) >mm5.chr3/46147402-46147468 UUUGAAAGCAAUAUGUCUUUGUACAUAUCAGUGUAUGUACAAGUAUAUUCCUUUCAGUGAUACCGA .(((((((.((((((.(((.((((((((....))))))))))))))))).)))))))......... ( -19.60) >rn3.chr2/48190380-48190446 UUUGAAAGUAAUAUGUCUUUGUACAUAUGGGUGUAUGUACAAAUAUAUUCCUUUCAGUGAUACUGA .(((((((.(((((((..((((((((((....))))))))))))))))).)))))))......... ( -20.90) >canFam1.chr6/30106220-30106282 UUUGAAAGCAAUAUUUCCUUGUACAUACCAAUGUACAAAAAUAUUUCUUUCGAUGAUACUGA .(((((((.(((((((..((((((((....))))))))))))))).)))))))......... ( -17.40) >galGal2.chr8/18405246-18405301 UAUGAAGGCAUUACUUCUUUGUACUAUGUGUACAAAGAUCUUUUAAUUACUCUGA ..((((((.......(((((((((.....))))))))).)))))).......... ( -11.70) >consensus UUUGAAAGCAAUAUGUCUUUGUACAUAUCA____AUGUACAAAUAUAUUCCUUUCAAUGAUACUGA .(((((((.((((((..(((((((((........))))))))))))))).)))))))......... (-13.98 = -14.30 + 0.32)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
