Structure #30266
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr10 |
| Strand | + |
| Position | 104,410,411 - 104,410,465 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 82.21 |
| Columns | 55 |
| Mean single MFE | -20.82 |
| Consensus MFE | -14.75 |
| Combinations/base pair | 24 / 16 = 1.50 |
| SCI | 0.71 |
| z-score | -3.48 |
| RNA class probability | 0.9983 |
This structure is part of cluster 14410
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 55 Columns: 55 Strand: + Mean pairwise identity: 82.21 Mean single sequence MFE: -20.83 Consensus MFE: -14.75 Energy contribution: -14.13 Covariance contribution: -0.62 Mean z-score: -3.48 Structure conservation index: 0.71 SVM decision value: 3.06 SVM RNA-class probability: 0.998300 Prediction: RNA ###################################################################### >hg17.chr10/104410411-104410465 CCUAAUUUCUUUCCCACUUGGCCUAGUUUUGUUUUGGCUGAGGGGAGAGGCCCU .......((((((((.((..(((............)))..)))))))))).... ( -21.80) >mm5.chr19/45858970-45859024 CCUAAUUUCUCUCCCACUUGGUCCAAUUUGUUUUGGCUAGCGGGAGGGGCCCCU .......((((((((.((.((.((((......)))))))).))))))))..... ( -19.80) >rn3.chr1/252004421-252004474 CCUAAUUUCUCUCCCACUUGGCCCAGUUUGUUUUGGCUAGUGGGAGGGGCCCU .......(((((((((((.((((.((.....)).))))))))))))))).... ( -23.80) >canFam1.chr28/18154532-18154584 CCCAAUUUCUCUCAGUUGGCCUAGAUUUGUGUUAGCUGAUGGGAGGGGUCCU (((....((((((((((((((.......).))))))))).)))).))).... ( -17.90) >consensus CCUAAUUUCUCUCCCACUUGGCCCAG_UUUGUUUUGGCUAAUGGGAGGGG_CCCU ........(((((((.(((((.((((.......))))))))))))))))...... (-14.75 = -14.13 + -0.62)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
