Structure #33426
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr11 |
| Strand | + |
| Position | 10,433,808 - 10,433,878 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 81.84 |
| Columns | 73 |
| Mean single MFE | -29.5 |
| Consensus MFE | -24.05 |
| Combinations/base pair | 38 / 27 = 1.41 |
| SCI | 0.82 |
| z-score | -3.88 |
| RNA class probability | 0.999507 |
This structure is part of cluster 16237
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 73 Columns: 73 Strand: + Mean pairwise identity: 81.84 Mean single sequence MFE: -29.50 Consensus MFE: -24.05 Energy contribution: -24.30 Covariance contribution: 0.25 Mean z-score: -3.88 Structure conservation index: 0.82 SVM decision value: 3.67 SVM RNA-class probability: 0.999507 Prediction: RNA ###################################################################### >hg17.chr11/10433808-10433878 CUCUGUCCUUUCCUGGGAAAGGUGGAAGCAGUUCAUGGUCUUUCCCUUUCAGAGGAGGAGGGGAUGGAGG ((((((((((((((..((((((.((((((........).))))))))))).....)))))))))))))). ( -32.70) >mm5.chr7/98044043-98044115 CUCUGUUCCUUCCUAGACAAGGAGGAAGCACUUCAUAGUCCUUUCCUCUUUUUGGGGGGGAGGGGAAGGAGG ((((.(((((((((...(((((((((((.(((....))).).)))))))..)))...))))))))).)))). ( -31.40) >rn3.chr1/168635662-168635734 CUCUGUUCCUUCCUAGACAAGGAGGAAGCACUUUAUAGUCCUUUCCUCUUUUUGAGGGGGAGGGGAAGGAGG ((((.(((((((((....((((((((((.(((....))).).)))))))))......))))))))).)))). ( -30.40) >canFam1.chr21/35874690-35874763 CUCUGUCUUUUCCUGGGAAAGGAGGGAGCAGUUCAAUAGUCCUUGGCUUUUUUAGAGGAGGAGGGGAAGGAGG ((((.(((((((....))))))).))))...........(((((..(((((((....)))))))..))))).. ( -23.50) >consensus CUCUGUCCCUUCCUAGAAAAGGAGGAAGCACUUC_AUAGUCCUUUCCUCUUUUAGAGGAGGAGGGGAAGGAGG (((..(((((((((.(((((((.(((((.(((.....))).))))).)))))))....)))))))))..))). (-24.05 = -24.30 + 0.25)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
