Structure #52002
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr12 |
| Strand | + |
| Position | 117,393,044 - 117,393,102 |
| Number of sequences | 4 |
| Organisms | human, dog, mouse, rat |
| Mean pairwise identity | 84.77 |
| Columns | 58 |
| Mean single MFE | -16.25 |
| Consensus MFE | -15.98 |
| Combinations/base pair | 31 / 22 = 1.41 |
| SCI | 0.98 |
| z-score | -3.46 |
| RNA class probability | 0.999286 |
This structure is part of cluster 26234
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 58 Columns: 58 Strand: + Mean pairwise identity: 84.77 Mean single sequence MFE: -16.25 Consensus MFE: -15.98 Energy contribution: -15.47 Covariance contribution: -0.50 Mean z-score: -3.46 Structure conservation index: 0.98 SVM decision value: 3.49 SVM RNA-class probability: 0.999286 Prediction: RNA ###################################################################### >hg17.chr12/117393044-117393102 AUCCUGUUCUUUAGCCAUUCAAUAAAUAUUUGUUUGGUGGCUAACUUGUACAGGAUUA (((((((.(.((((((((..(((((....)))))..))))))))...).))))))).. ( -21.40) >canFam1.chr26/0-58 AUCCUGUUCUAUAGCUGUUCAAUAAAUAUUUGUUUGGUGGCUUACUUGUGCAGGAUUA (((((((.(...(((..(..(((((....)))))..)..))).....).))))))).. ( -15.90) >mm5.chr5/34739833-34739775 AUCCUGCUCUUUAAUCAUCCAGUAAACAUUUGCUUGGUGGCUAACUUGUGUAGGAUUA (((((((.(.(((..((((.(((((....))))).))))..)))...).))))))).. ( -17.70) >rn3.chr12/40602823-40602881 AUCCUGCUCUUUAAUCAUUCAGGAAACAUUUGCUUAGUGGCUAACUUGUAUAGGAUUA ((((((..(.(((..((((.((.((....)).)).))))..)))...)..)))))).. ( -10.00) >consensus AUCCUGCUCUUUAACCAUUCAAUAAACAUUUGCUUGGUGGCUAACUUGUACAGGAUUA (((((((.(.(((((((((.(((((....))))).)))))))))...).))))))).. (-15.98 = -15.47 + -0.50)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
