Structure #61162
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr14 |
| Strand | + |
| Position | 56,593,996 - 56,594,068 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 81.48 |
| Columns | 72 |
| Mean single MFE | -24.05 |
| Consensus MFE | -18.46 |
| Combinations/base pair | 31 / 23 = 1.35 |
| SCI | 0.77 |
| z-score | -2.31 |
| RNA class probability | 0.973024 |
This structure is part of cluster 31534
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 72 Columns: 72 Strand: + Mean pairwise identity: 81.48 Mean single sequence MFE: -24.05 Consensus MFE: -18.46 Energy contribution: -17.90 Covariance contribution: -0.56 Mean z-score: -2.31 Structure conservation index: 0.77 SVM decision value: 1.70 SVM RNA-class probability: 0.973024 Prediction: RNA ###################################################################### >hg17.chr14/56593996-56594068 CAUUGCCAAUUAGCUAGGGCCUCCCCUGACCAGUUCCAACCCACGAGCUGGGUUAGGACUGCAACUUUGACC ..((((...((((((((((....))))).(((((((........))))))))))))....))))........ ( -21.30) >mm5.chr14/41551188-41551260 CAUUGCCAAUCAGCUGGGGCUGCCCCUAGCUGGUUCCAACCCACCAGCUGGGUCAGGAAUGCAACUUUGACC ..((((....(((((((((....)))))))))(((((.(((((.....)))))..)))))))))........ ( -30.00) >rn3.chr15/24871215-24871287 CAUUGCCAAUCAGCUGGGGCCUCCCCUAACCGGUUCCAACCCACCAGCUGGGUCAGGAAUGCAACUUUGACC ..........(((((((((.....((.....)).......)).)))))))(((((((........))))))) ( -20.70) >canFam1.chr8/35571395-35571466 CUUGCCAAUUAGCCAGGGCCACCUCUGAUUAGUUCUGACCCAUCAGUCGGGUUGGGAAGGCAAUUCUGACC .(((((((((((..(((....)))))))))..(((..((((.......))))..))).)))))........ ( -24.20) >consensus CAUUGCCAAUCAGCUAGGGCCUCCCCUAACCAGUUCCAACCCACCAGCUGGGUCAGGAAUGCAACUUUGACC ..((((..(((((.(((((....))))).)))))(((((((((.....)))))).)))..))))........ (-18.46 = -17.90 + -0.56)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
