Structure #61163
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr14 |
| Strand | - |
| Position | 56,593,996 - 56,594,068 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 81.48 |
| Columns | 72 |
| Mean single MFE | -26.23 |
| Consensus MFE | -23.14 |
| Combinations/base pair | 29 / 22 = 1.32 |
| SCI | 0.88 |
| z-score | -1.73 |
| RNA class probability | 0.877635 |
This structure is part of cluster 31534
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 72 Columns: 72 Strand: + Mean pairwise identity: 81.48 Mean single sequence MFE: -26.23 Consensus MFE: -23.14 Energy contribution: -23.20 Covariance contribution: 0.06 Mean z-score: -1.73 Structure conservation index: 0.88 SVM decision value: 0.90 SVM RNA-class probability: 0.877635 Prediction: RNA ###################################################################### >hg17.chr14/56594068-56593996 GGUCAAAGUUGCAGUCCUAACCCAGCUCGUGGGUUGGAACUGGUCAGGGGAGGCCCUAGCUAAUUGGCAAUG .(((((.....((((.((((((((.....)))))))).))))(..((((....))))..)...))))).... ( -27.70) >mm5.chr14/41551260-41551188 GGUCAAAGUUGCAUUCCUGACCCAGCUGGUGGGUUGGAACCAGCUAGGGGCAGCCCCAGCUGAUUGGCAAUG .......(((((.((((.((((((.....)))))))))).(((((.((((...)))))))))....))))). ( -30.30) >rn3.chr15/24871287-24871215 GGUCAAAGUUGCAUUCCUGACCCAGCUGGUGGGUUGGAACCGGUUAGGGGAGGCCCCAGCUGAUUGGCAAUG .......(((((.((((.((((((.....)))))))))).(((((.((((...)))))))))....))))). ( -27.20) >canFam1.chr8/35571466-35571395 GGUCAGAAUUGCCUUCCCAACCCGACUGAUGGGUCAGAACUAAUCAGAGGUGGCCCUGGCUAAUUGGCAAG .(((((....(((...(((.((...(((((.(((....))).))))).)))))....)))...)))))... ( -19.70) >consensus GGUCAAAGUUGCAUUCCUAACCCAGCUGGUGGGUUGGAACCAGUCAGGGGAGGCCCCAGCUAAUUGGCAAUG .(((((..........((((((((.....))))))))...(((((((((....))))))))).))))).... (-23.14 = -23.20 + 0.06)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
