Structure #69534
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr15 |
| Strand | - |
| Position | 70,393,046 - 70,393,122 |
| Number of sequences | 4 |
| Organisms | human, dog, mouse, rat |
| Mean pairwise identity | 79.61 |
| Columns | 77 |
| Mean single MFE | -20.68 |
| Consensus MFE | -15.05 |
| Combinations/base pair | 19 / 13 = 1.46 |
| SCI | 0.73 |
| z-score | -3.19 |
| RNA class probability | 0.999405 |
This structure is part of cluster 36252
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 77 Columns: 77 Strand: + Mean pairwise identity: 79.61 Mean single sequence MFE: -20.68 Consensus MFE: -15.05 Energy contribution: -14.92 Covariance contribution: -0.13 Mean z-score: -3.19 Structure conservation index: 0.73 SVM decision value: 3.58 SVM RNA-class probability: 0.999405 Prediction: RNA ###################################################################### >hg17.chr15/70393122-70393046 GAGACAAGCUGUAACAUUCCAUGUGGGAAACAGCAUGGUAAAGGUGCAGACACAGAAGGAACAGGUGGGUGUGAAA .(.((.(.((((..(...((((((.(....).)))))).....(((....)))....)..)))).)..)).).... ( -18.60) >canFam1.chr30/38758194-38758117 GAGACAAACUGUAACAUUCCAUGUGGGAAACCGCAUGGUAAAGGUGCAGAGACAGAAGGAACAAGAUGGGUGUGAAA ........(((((.....((((((((....))))))))......)))))............................ ( -22.90) >mm5.chr9/0-73 GAGACAAGCUGGAACACCCAUGCAGGAAACUGUGCGAUAAAAUUCAGAGCUGGAAGGAACAGGUGGGUGUGAA .............((((((((((((....))))................(((.......)))))))))))... ( -22.20) >rn3.chr8/0-72 GAGACAAGCUGGAACACCCGUGCAGGAAACGGGGUGGUAAAAUUCAGAGCUGGAAGGAACAGCGGGUAUGAA ...((..((((...(((((.....(....).)))))......((((....)))).....))))..))..... ( -19.00) >consensus GAGACAAGCUGGAACAC_CCAUGCAGGAAACAGCAUGGUAAAA_UGCAGAGACAGAAGGAACAGG_UGGGUGUGAA_ ........(((((.....((((((((....))))))))......)))))............................ (-15.05 = -14.92 + -0.13)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
