Structure #74289
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr16 |
| Strand | + |
| Position | 26,105,208 - 26,105,280 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 74.69 |
| Columns | 91 |
| Mean single MFE | -23.88 |
| Consensus MFE | -19.62 |
| Combinations/base pair | 33 / 23 = 1.43 |
| SCI | 0.82 |
| z-score | -3.76 |
| RNA class probability | 0.999976 |
This structure is part of cluster 38888
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 91 Columns: 91 Strand: + Mean pairwise identity: 74.69 Mean single sequence MFE: -23.88 Consensus MFE: -19.62 Energy contribution: -18.12 Covariance contribution: -1.50 Mean z-score: -3.76 Structure conservation index: 0.82 SVM decision value: 5.14 SVM RNA-class probability: 0.999976 Prediction: RNA ###################################################################### >hg17.chr16/26105208-26105280 CAUGUCACCCCAGGAGUGAGUGGGAAAUUACUCAGUUCUGGAGAGAGGGAAAUGUCAAGACAGAUGGGUCA ..((((...((((((.(((((((....))))))).)))))).((.(......).))..))))......... ( -22.70) >mm5.chr7/111951950-111952022 UGUGUCACCUCAGAAGUGAGUAGGAAAUUAUUCACUUUUGGAGAGAGAGAAAUGUCAAGACAGAUUGAUCA ..((((.(..(((((((((((((....)))))))))))))..).((.(....).))..))))......... ( -22.70) >rn3.chr1/183530685-183530757 UGUGUCACCCCAGAAGUGAGUAGGAAAUUAUUCACUUUUGGAGAGAGGGAAAUGUCAAGACAGAUUGAUCA ..((((...((((((((((((((....)))))))))))))).((.(......).))..))))......... ( -22.50) >canFam1.chr6/57361701-57361610 CCAAACAAACAAACAAACCACAUCACCCCAGAAGCGAAUGGGAAAUUGUUCACUUCUGGAGAGAUGGGCAUGUCAAGACAGAGAUGGGUCA ((...............((.((((.(.(((((((.(((..(....)..))).))))))).).))))))(((.((......)).)))))... ( -27.60) >consensus __________________CAUGUCACCCCAGAAGUGAGUAGGAAAUUAUUCACUUCUGGAGAGAGGGAAAUGUCAAGAC__AGAUGGAUCA ....................(.((.(.((((((((((((((....)))))))))))))).).)).)((...(((........)))...)). (-19.62 = -18.12 + -1.50)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
