Structure #74291
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr16 |
| Strand | - |
| Position | 26,105,208 - 26,105,280 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 74.69 |
| Columns | 91 |
| Mean single MFE | -18.87 |
| Consensus MFE | -15.71 |
| Combinations/base pair | 23 / 20 = 1.15 |
| SCI | 0.83 |
| z-score | -2.83 |
| RNA class probability | 0.999814 |
This structure is part of cluster 38888
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 91 Columns: 91 Strand: + Mean pairwise identity: 74.69 Mean single sequence MFE: -18.88 Consensus MFE: -15.71 Energy contribution: -17.65 Covariance contribution: 1.94 Mean z-score: -2.83 Structure conservation index: 0.83 SVM decision value: 4.15 SVM RNA-class probability: 0.999814 Prediction: RNA ###################################################################### >hg17.chr16/26105280-26105208 UGACCCAUCUGUCUUGACAUUUCCCUCUCUCCAGAACUGAGUAAUUUCCCACUCACUCCUGGGGUGACAUG .(((......)))............((.((((((...(((((........)))))...)))))).)).... ( -15.90) >mm5.chr7/111952022-111951950 UGAUCAAUCUGUCUUGACAUUUCUCUCUCUCCAAAAGUGAAUAAUUUCCUACUCACUUCUGAGGUGACACA ((.((((......))))))......((.(..((.((((((.((......)).)))))).))..).)).... ( -10.10) >rn3.chr1/183530757-183530685 UGAUCAAUCUGUCUUGACAUUUCCCUCUCUCCAAAAGUGAAUAAUUUCCUACUCACUUCUGGGGUGACACA ((.((((......))))))......((.(((((.((((((.((......)).)))))).))))).)).... ( -15.40) >canFam1.chr6/57361610-57361701 UGACCCAUCUCUGUCUUGACAUGCCCAUCUCUCCAGAAGUGAACAAUUUCCCAUUCGCUUCUGGGGUGAUGUGGUUUGUUUGUUUGUUUGG ....(((...(......((((.(((((((.(((((((((((((..........))))))))))))).)))).))).)))).....)..))) ( -34.10) >consensus UGACCAAUCU__GUCUUGACAUUUCCCUCUCUCCAAAAGUGAAUAAUUUCCCACUCACUUCUGGGGUGACACA__________________ .(((........)))............((.(((((((((((((((......))))))))))))))).))...................... (-15.71 = -17.65 + 1.94)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
