Structure #102192
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr2 |
| Strand | + |
| Position | 65,297,565 - 65,297,643 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 82.7 |
| Columns | 81 |
| Mean single MFE | -26.58 |
| Consensus MFE | -24.27 |
| Combinations/base pair | 28 / 21 = 1.33 |
| SCI | 0.91 |
| z-score | -2.1 |
| RNA class probability | 0.972294 |
This structure is part of cluster 53790
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 81 Columns: 81 Strand: + Mean pairwise identity: 82.70 Mean single sequence MFE: -26.57 Consensus MFE: -24.27 Energy contribution: -23.28 Covariance contribution: -1.00 Mean z-score: -2.10 Structure conservation index: 0.91 SVM decision value: 1.69 SVM RNA-class probability: 0.972294 Prediction: RNA ###################################################################### >hg17.chr2/65297565-65297643 GUAUACCUUUGGGCAGUGUUUUGCACUUCUGAGAGUGAAAUGACUCCUGUGGAGUCGGUCCUAAUCUGAGUGCAAACA .....((....))......(((((((((.....((.((..(((((((...))))))).)))).....))))))))).. ( -21.70) >mm5.chr18/35997252-35997327 GUACUUUCAGGCAGUAUUGCAUCCCUGAGAGUGGAAUGACUCCUUGUGGAGUUGGUCCUGGUCUGGGUGCAAACA .............((.((((((((...(((.((((..((((((....))))))..))).).))))))))))))). ( -26.30) >rn3.chr18/28207148-28207225 GUACCUUCAGGCAGUGUAUUGCAUCCCUGAGAGUGGAAUGACUCCUUGUGGAGUUGGUCCUAGUCUAGGUGCGAACA (((((((((((..(((.....))).)))))((.((((..((((((....))))))..))).).)).))))))..... ( -29.60) >canFam1.chr11/28125510-28125589 GUACUCUUGGGCAGCGUUUUGCACCUCUGAGAGUGGAAGAACUCCUCCUGUGGAGUUGGUCCUAGUCUGGGUGCAAACA ...............((((.((((((...(((.((((..((((((......))))))..))).).))))))))))))). ( -28.70) >consensus GUA__CCUUCAGGCAGUGUUUUGCACCCCUGAGAGUGGAAUGACUCCU__UGUGGAGUUGGUCCUAGUCUGGGUGCAAACA ....................((((((((...(((.((((..((((((......))))))..))).).)))))))))))... (-24.27 = -23.28 + -1.00)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
