Structure #102193
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr2 |
| Strand | - |
| Position | 65,297,565 - 65,297,643 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 82.7 |
| Columns | 81 |
| Mean single MFE | -21.7 |
| Consensus MFE | -17.17 |
| Combinations/base pair | 29 / 23 = 1.26 |
| SCI | 0.79 |
| z-score | -2.31 |
| RNA class probability | 0.968189 |
This structure is part of cluster 53790
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 81 Columns: 81 Strand: + Mean pairwise identity: 82.70 Mean single sequence MFE: -21.70 Consensus MFE: -17.17 Energy contribution: -18.05 Covariance contribution: 0.88 Mean z-score: -2.31 Structure conservation index: 0.79 SVM decision value: 1.62 SVM RNA-class probability: 0.968189 Prediction: RNA ###################################################################### >hg17.chr2/65297643-65297565 UGUUUGCACUCAGAUUAGGACCGACUCCACAGGAGUCAUUUCACUCUCAGAAGUGCAAAACACUGCCCAAAGGUAUAC ..((((((((((((...(((..((((((...))))))..)))..)))..).))))))))....((((....))))... ( -20.80) >mm5.chr18/35997327-35997252 UGUUUGCACCCAGACCAGGACCAACUCCACAAGGAGUCAUUCCACUCUCAGGGAUGCAAUACUGCCUGAAAGUAC ...(((((((((((...(((...(((((....)))))...)))..)))..))).)))))((((.......)))). ( -21.60) >rn3.chr18/28207225-28207148 UGUUCGCACCUAGACUAGGACCAACUCCACAAGGAGUCAUUCCACUCUCAGGGAUGCAAUACACUGCCUGAAGGUAC .....((((((.((...(((...(((((....)))))...)))....)).))).))).......((((....)))). ( -20.40) >canFam1.chr11/28125589-28125510 UGUUUGCACCCAGACUAGGACCAACUCCACAGGAGGAGUUCUUCCACUCUCAGAGGUGCAAAACGCUGCCCAAGAGUAC ..((((((((((((...(((..((((((......))))))..)))..)))..).))))))))((.((.....)).)).. ( -24.00) >consensus UGUUUGCACCCAGACUAGGACCAACUCCACA__AGGAGUCAUUCCACUCUCAGAGAUGCAAAACACUGCCCAAAAG__UAC ((((((((((((((...(((..((((((......))))))..)))..)))...)))))))).)))................ (-17.17 = -18.05 + 0.88)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
