Structure #102610
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr2 |
| Strand | + |
| Position | 67,874,197 - 67,874,260 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 84.13 |
| Columns | 63 |
| Mean single MFE | -12.25 |
| Consensus MFE | -9.5 |
| Combinations/base pair | 21 / 17 = 1.24 |
| SCI | 0.78 |
| z-score | -3.61 |
| RNA class probability | 0.997695 |
This structure is part of cluster 54036
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 63 Columns: 63 Strand: + Mean pairwise identity: 84.13 Mean single sequence MFE: -12.25 Consensus MFE: -9.50 Energy contribution: -10.88 Covariance contribution: 1.38 Mean z-score: -3.61 Structure conservation index: 0.78 SVM decision value: 2.91 SVM RNA-class probability: 0.997695 Prediction: RNA ###################################################################### >hg17.chr2/67874197-67874260 AACCUAGCAGCACAUUUUAACACACUGAUGUUCUCAGAUAUGUUAAAAUGUGAAAUAAAAUAC ..........((((((((((((..((((.....))))...))))))))))))........... ( -16.30) >mm5.chr11/104161426-104161363 AACCUAGCAACACAUUUUAACAUAUUGGCACUCACAGACACAUUAAAAUGUAAAAUAAAACAC ...........(((((((((....(((.......))).....)))))))))............ ( -5.70) >rn3.chr14/13731879-13731816 AAUCUAGCAACACAUUUUAACAUAUUGGUGUUCACAGACACGUUAAAAUGUAAAAUAAAACAC ...........((((((((((......(((((....)))))))))))))))............ ( -11.00) >canFam1.chr10/70304625-70304688 AACCUAGCAGCACAUUUUAAUAUGCUGGUGUUUUUAGAUAUGUUAAAAUGUGAAAUAAAACAC ..........((((((((((((((((((.....)))).))))))))))))))........... ( -16.00) >consensus AACCUAGCAACACAUUUUAACAUACUGGUGUUCACAGACACGUUAAAAUGUAAAAUAAAACAC ..........(((((((((((((((((.......))).))))))))))))))........... ( -9.50 = -10.88 + 1.38)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
