Structure #102611
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr2 |
| Strand | - |
| Position | 67,874,197 - 67,874,260 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 84.13 |
| Columns | 63 |
| Mean single MFE | -14.96 |
| Consensus MFE | -11.81 |
| Combinations/base pair | 21 / 15 = 1.40 |
| SCI | 0.79 |
| z-score | -3.12 |
| RNA class probability | 0.995789 |
This structure is part of cluster 54036
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 63 Columns: 63 Strand: + Mean pairwise identity: 84.13 Mean single sequence MFE: -14.96 Consensus MFE: -11.81 Energy contribution: -11.12 Covariance contribution: -0.69 Mean z-score: -3.12 Structure conservation index: 0.79 SVM decision value: 2.62 SVM RNA-class probability: 0.995789 Prediction: RNA ###################################################################### >hg17.chr2/67874260-67874197 GUAUUUUAUUUCACAUUUUAACAUAUCUGAGAACAUCAGUGUGUUAAAAUGUGCUGCUAGGUU ...........((((((((((((((.((((.....)))))))))))))))))).......... ( -20.10) >mm5.chr11/104161363-104161426 GUGUUUUAUUUUACAUUUUAAUGUGUCUGUGAGUGCCAAUAUGUUAAAAUGUGUUGCUAGGUU ...........(((((((((((((((..((....))..))))))))))))))).......... ( -12.50) >rn3.chr14/13731816-13731879 GUGUUUUAUUUUACAUUUUAACGUGUCUGUGAACACCAAUAUGUUAAAAUGUGUUGCUAGAUU ..((((..(..(((((((((((((((..((....))..)))))))))))))))..)..)))). ( -15.50) >canFam1.chr10/70304688-70304625 GUGUUUUAUUUCACAUUUUAACAUAUCUAAAAACACCAGCAUAUUAAAAUGUGCUGCUAGGUU (((((((......................)))))))((((((((....))))))))....... ( -11.75) >consensus GUGUUUUAUUUCACAUUUUAACAUAUCUGAGAACACCAAUAUGUUAAAAUGUGCUGCUAGGUU ...........(((((((((((((((............))))))))))))))).......... (-11.81 = -11.12 + -0.69)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
