Structure #87669
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr17 |
| Strand | + |
| Position | 70,220,699 - 70,220,752 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 79.01 |
| Columns | 55 |
| Mean single MFE | -16.07 |
| Consensus MFE | -9.76 |
| Combinations/base pair | 16 / 12 = 1.33 |
| SCI | 0.61 |
| z-score | -2.96 |
| RNA class probability | 0.99623 |
This structure is part of cluster 45900
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 55 Columns: 55 Strand: + Mean pairwise identity: 79.01 Mean single sequence MFE: -16.07 Consensus MFE: -9.76 Energy contribution: -9.38 Covariance contribution: -0.38 Mean z-score: -2.96 Structure conservation index: 0.61 SVM decision value: 2.67 SVM RNA-class probability: 0.996230 Prediction: RNA ###################################################################### >hg17.chr17/70220699-70220752 ACUUCCUCCUUCAGUCACUUCCCAUGGGUGAAAGAGACUAAAAGAGGAAGGAG .(((((((.((.((((.(((((....))...))).)))).)).)))))))... ( -19.30) >mm5.chr11/114805113-114805168 ACUUCCUCCUUUAGCCACUUCCCGCUGGCAUAUAAAGCACCAAAAGAGGAAGGAG .((((((((((((((((........))))...)))))........)))))))... ( -15.20) >rn3.chr10/105223571-105223624 ACUUCCUCCUUUAGCCACUUCCCGCUGGCAAAUAAAAGCAAAAGAGGAAGGAG .(((((((...((((........))))((........))....)))))))... ( -14.70) >canFam1.chr18/25056921-25056973 ACUUCCUCCUUCAGCCACUUCUCACUGAUGAGUAAGCAAAAAGAGGAAGGAG .(((((((.((..((.....((((....))))...))..)).)))))))... ( -15.10) >consensus ACUUCCUCCUUCAGCCACUUCCCACUGG__UAAAAAAGACCAAAAGAGGAAGGAG .(((((((..(((((........))))).................)))))))... ( -9.76 = -9.38 + -0.38)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
