Structure #87670
Summary
Genome/Assembly | hg17 |
Chromosome/Contig | chr17 |
Strand | - |
Position | 70,220,699 - 70,220,752 |
Number of sequences | 4 |
Organisms | human, mouse, rat, dog |
Mean pairwise identity | 79.01 |
Columns | 55 |
Mean single MFE | -23.3 |
Consensus MFE | -18.83 |
Combinations/base pair | 31 / 22 = 1.41 |
SCI | 0.81 |
z-score | -4.7 |
RNA class probability | 0.999809 |
This structure is part of cluster 45900
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 55 Columns: 55 Strand: + Mean pairwise identity: 79.01 Mean single sequence MFE: -23.30 Consensus MFE: -18.83 Energy contribution: -19.45 Covariance contribution: 0.62 Mean z-score: -4.70 Structure conservation index: 0.81 SVM decision value: 4.13 SVM RNA-class probability: 0.999809 Prediction: RNA ###################################################################### >hg17.chr17/70220752-70220699 CUCCUUCCUCUUUUAGUCUCUUUCACCCAUGGGAAGUGACUGAAGGAGGAAGU ...(((((((((((((((.(((((.......))))).))))))))))))))). ( -28.30) >mm5.chr11/114805168-114805113 CUCCUUCCUCUUUUGGUGCUUUAUAUGCCAGCGGGAAGUGGCUAAAGGAGGAAGU ...(((((((((((((((((((...((....)).))))).)))))))))))))). ( -23.20) >rn3.chr10/105223624-105223571 CUCCUUCCUCUUUUGCUUUUAUUUGCCAGCGGGAAGUGGCUAAAGGAGGAAGU ...((((((((((((((...((((.((...)).))))))).))))))))))). ( -19.70) >canFam1.chr18/25056973-25056921 CUCCUUCCUCUUUUUGCUUACUCAUCAGUGAGAAGUGGCUGAAGGAGGAAGU ...(((((((((((.(((..((((....))))....))).))))))))))). ( -22.00) >consensus CUCCUUCCUCUUUUGGUCUUAUUCA__CCAGCGGGAAGUGGCUAAAGGAGGAAGU ...((((((((((((((((((((((......))))))).))))))))))))))). (-18.83 = -19.45 + 0.62)