Structure #88278
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr18 |
| Strand | + |
| Position | 351,384 - 351,444 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 83.29 |
| Columns | 60 |
| Mean single MFE | -13.3 |
| Consensus MFE | -13.44 |
| Combinations/base pair | 22 / 15 = 1.47 |
| SCI | 1.01 |
| z-score | -3.34 |
| RNA class probability | 0.999341 |
This structure is part of cluster 46245
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 60 Columns: 60 Strand: + Mean pairwise identity: 83.29 Mean single sequence MFE: -13.30 Consensus MFE: -13.44 Energy contribution: -11.75 Covariance contribution: -1.69 Mean z-score: -3.34 Structure conservation index: 1.01 SVM decision value: 3.53 SVM RNA-class probability: 0.999341 Prediction: RNA ###################################################################### >hg17.chr18/351384-351444 UGAGAUCUUUUCAUCUCAGUGGAAGCUUCCUCUUCCAUUCCCACUGGAAUCUAGCCUCAC ((((((......))))))(((((((......)))))))(((....)))............ ( -13.70) >mm5.chr18/81026579-81026520 UGAGAUCUUUACCCGCAAUGGAGACUUUCUUUUCCAUUCCCACUAUAACCUAGCCUCAC ((((..........(.((((((((......)))))))).)..(((.....))).)))). ( -8.90) >rn3.chr18/86194876-86194817 UGAGAUCUUUACCCCCAGUGGAAACUCUCUUUUCCAUUCCCACUGGAACCCAGCCUCAC ((((............((((((((......))))))))....((((...)))).)))). ( -12.40) >canFam1.chr7/69707915-69707975 UGAGAUCCUUUCAUCUCAGUGGGAGCUUCCUCUUCCACUCCCACUGGAACCCAGCCUCAC ((((...((....((.(((((((((............)))))))))))....)).)))). ( -18.20) >consensus UGAGAUCUUUAC_CCUCAGUGGAAACUUCCUCUUCCAUUCCCACUGGAACCCAGCCUCAC ((((.............((((((((......))))))))....(((.....))).)))). (-13.44 = -11.75 + -1.69)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
