Structure #88279
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr18 |
| Strand | - |
| Position | 351,384 - 351,444 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 83.29 |
| Columns | 60 |
| Mean single MFE | -18.97 |
| Consensus MFE | -16.83 |
| Combinations/base pair | 25 / 19 = 1.32 |
| SCI | 0.89 |
| z-score | -3.35 |
| RNA class probability | 0.998855 |
This structure is part of cluster 46245
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 60 Columns: 60 Strand: + Mean pairwise identity: 83.29 Mean single sequence MFE: -18.98 Consensus MFE: -16.83 Energy contribution: -16.32 Covariance contribution: -0.50 Mean z-score: -3.35 Structure conservation index: 0.89 SVM decision value: 3.25 SVM RNA-class probability: 0.998855 Prediction: RNA ###################################################################### >hg17.chr18/351444-351384 GUGAGGCUAGAUUCCAGUGGGAAUGGAAGAGGAAGCUUCCACUGAGAUGAAAAGAUCUCA ((((((((...(((((.......))))).....))))).))).(((((......))))). ( -17.60) >mm5.chr18/81026520-81026579 GUGAGGCUAGGUUAUAGUGGGAAUGGAAAAGAAAGUCUCCAUUGCGGGUAAAGAUCUCA .((((((((.....)))).(.((((((..........)))))).)..........)))) ( -11.60) >rn3.chr18/86194817-86194876 GUGAGGCUGGGUUCCAGUGGGAAUGGAAAAGAGAGUUUCCACUGGGGGUAAAGAUCUCA .(((((((.(.(((((((((((((..........))))))))))))).)..)).))))) ( -22.30) >canFam1.chr7/69707975-69707915 GUGAGGCUGGGUUCCAGUGGGAGUGGAAGAGGAAGCUCCCACUGAGAUGAAAGGAUCUCA .(((((((....((((((((((((..........)))))))))).)).....)).))))) ( -24.40) >consensus GUGAGGCUAGGUUCCAGUGGGAAUGGAAAAGAAAGCUUCCACUGAGA_GAAAAGAUCUCA .(((((((....((((((((((((..........)))))))))).)).....)).))))) (-16.83 = -16.32 + -0.50)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
