Structure #93501
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr19 |
| Strand | + |
| Position | 7,884,994 - 7,885,070 |
| Number of sequences | 4 |
| Organisms | human, dog, mouse, rat |
| Mean pairwise identity | 79.32 |
| Columns | 82 |
| Mean single MFE | -28.53 |
| Consensus MFE | -20.5 |
| Combinations/base pair | 18 / 13 = 1.38 |
| SCI | 0.72 |
| z-score | -3.76 |
| RNA class probability | 0.999836 |
This structure is part of cluster 49166
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 82 Columns: 82 Strand: + Mean pairwise identity: 79.32 Mean single sequence MFE: -28.53 Consensus MFE: -20.50 Energy contribution: -20.50 Covariance contribution: 0.00 Mean z-score: -3.76 Structure conservation index: 0.72 SVM decision value: 4.21 SVM RNA-class probability: 0.999836 Prediction: RNA ###################################################################### >hg17.chr19/7884994-7885070 UGGCUGGUCCCAGGGCCAGCACAGGCCCGAGGCCGGGCUGCCUGGUUUUAUUUUUAUUUAACUUUAUUUUCUGUUU ..(((((((....)))))))(((((((((....))))).....((((..((....))..)))).......)))).. ( -26.70) >canFam1.chr20/55469728-55469801 UGGCUGGGUGCAGGGCUAGUGGAGGCCCUGGGGCCAGCCACCUGGAUUUAUUUUUAUUUAACUAUUUCUGUUU (((((((.(.(((((((......))))))).).)))))))...(((..((.((......)).))..))).... ( -29.90) >mm5.chr8/4216989-4217065 UGGCUGGUCCCAGGGCCAGCACAGGCCCAAGACUGGGCCUGAUGGUUUUAUUUUUAUUUAACUUUAUUUUCUGUGU ..(((((((....))))))).((((((((....))))))))..((((..((....))..))))............. ( -30.20) >rn3.chr12/45105599-45105517 UGGCUGGUCCCAGGGCCAGCACAGGCCCAAGACUGGGCCUCAUGGUUUUAUUUUUAUUUAACUUUAUUUUCUAUGUGUGUGU ..(((((((....)))))))(((((((((....)))))).(((((.........................)))))))).... ( -27.31) >consensus UGGCUGGUCCCAGGGCCAGCACAGGCCCAAGACCGGGCCUCAUGGUUUUAUUUUUAUUUAACUUUAUUUUC______UGUGU ..(((((((....)))))))...((((((....))))))........................................... (-20.50 = -20.50 + 0.00)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
