Structure #93502
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr19 |
| Strand | - |
| Position | 7,884,994 - 7,885,070 |
| Number of sequences | 4 |
| Organisms | human, dog, mouse, rat |
| Mean pairwise identity | 79.32 |
| Columns | 82 |
| Mean single MFE | -22.63 |
| Consensus MFE | -15.19 |
| Combinations/base pair | 13 / 11 = 1.18 |
| SCI | 0.67 |
| z-score | -3.57 |
| RNA class probability | 0.999682 |
This structure is part of cluster 49166
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 82 Columns: 82 Strand: + Mean pairwise identity: 79.32 Mean single sequence MFE: -22.62 Consensus MFE: -15.19 Energy contribution: -15.88 Covariance contribution: 0.69 Mean z-score: -3.57 Structure conservation index: 0.67 SVM decision value: 3.88 SVM RNA-class probability: 0.999682 Prediction: RNA ###################################################################### >hg17.chr19/7885070-7884994 AAACAGAAAAUAAAGUUAAAUAAAAAUAAAACCAGGCAGCCCGGCCUCGGGCCUGUGCUGGCCCUGGGACCAGCCA ..................................(((.....(((((.(((((......))))).))).)).))). ( -21.70) >canFam1.chr20/55469801-55469728 AAACAGAAAUAGUUAAAUAAAAAUAAAUCCAGGUGGCUGGCCCCAGGGCCUCCACUAGCCCUGCACCCAGCCA .................................(((((((...((((((........))))))...))))))) ( -23.60) >mm5.chr8/4217065-4216989 ACACAGAAAAUAAAGUUAAAUAAAAAUAAAACCAUCAGGCCCAGUCUUGGGCCUGUGCUGGCCCUGGGACCAGCCA ...................................(((((((......))))))).(((((((...)).))))).. ( -23.50) >rn3.chr12/45105517-45105599 ACACACACAUAGAAAAUAAAGUUAAAUAAAAAUAAAACCAUGAGGCCCAGUCUUGGGCCUGUGCUGGCCCUGGGACCAGCCA ..........................................((((((......))))))(.(((((((...)).)))))). ( -21.70) >consensus AAACA______GAAAAUAAAGUUAAAUAAAAAUAAAACCAGGAGGCCCAGCCUUGGGCCUGUGCUGGCCCUGGGACCAGCCA ...........................................(((....(((.(((((......))))).)))....))). (-15.19 = -15.88 + 0.69)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
