Structure #96477
Summary
Genome/Assembly | hg17 |
Chromosome/Contig | chr19 |
Strand | + |
Position | 55,092,106 - 55,092,158 |
Number of sequences | 4 |
Organisms | human, mouse, rat, dog |
Mean pairwise identity | 82.35 |
Columns | 57 |
Mean single MFE | -17.97 |
Consensus MFE | -14.94 |
Combinations/base pair | 19 / 14 = 1.36 |
SCI | 0.83 |
z-score | -3.23 |
RNA class probability | 0.998652 |
This structure is part of cluster 50608
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 57 Columns: 57 Strand: + Mean pairwise identity: 82.35 Mean single sequence MFE: -17.97 Consensus MFE: -14.94 Energy contribution: -14.12 Covariance contribution: -0.81 Mean z-score: -3.23 Structure conservation index: 0.83 SVM decision value: 3.17 SVM RNA-class probability: 0.998652 Prediction: RNA ###################################################################### >hg17.chr19/55092106-55092158 GGAGGAAGUUAAUCAGUCUAUUCACUUCCUUUUGCCCCAGAUAGUUCUGGGG (((((((((.(((......))).)))))))))..(((((((....))))))) ( -21.50) >mm5.chr7/100821925-100821872 GGAGGAAGUAACUCAGUCUAUUUUUCUUCUUCCUGCUUCAAAUAGCUUUGGGG ((((((((.................))))))))..(((((((....))))))) ( -12.33) >rn3.chr1/172735555-172735501 GGAGGAAGUAACUUAGUCUAUUUUUUCUUCCUCCUGCUCCAAAUAGCUUUGGGG ((((((((..................))))))))..(((((((....))))))) ( -17.77) >canFam1.chr1/15964711-15964658 GAGAGGAAGCAAAUCAGUCUAUUUUCUUCCUCUUGCCCCAAAUAGUUCUGGGG (((((((((.((((......)))).))))))))).(((((........))))) ( -20.30) >consensus G_GAGGAAGUAA__AUCAGUCUA__UUUUCUUCCUCCUGCCCCAAAUAGCUCUGGGG ..(((((((....................)))))))...(((((((....))))))) (-14.94 = -14.12 + -0.81)