Structure #96478
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr19 |
| Strand | - |
| Position | 55,092,106 - 55,092,158 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 82.35 |
| Columns | 57 |
| Mean single MFE | -15.76 |
| Consensus MFE | -10.64 |
| Combinations/base pair | 16 / 14 = 1.14 |
| SCI | 0.68 |
| z-score | -3.17 |
| RNA class probability | 0.994931 |
This structure is part of cluster 50608
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 57 Columns: 57 Strand: + Mean pairwise identity: 82.35 Mean single sequence MFE: -15.75 Consensus MFE: -10.64 Energy contribution: -11.45 Covariance contribution: 0.81 Mean z-score: -3.17 Structure conservation index: 0.68 SVM decision value: 2.52 SVM RNA-class probability: 0.994931 Prediction: RNA ###################################################################### >hg17.chr19/55092158-55092106 CCCCAGAACUAUCUGGGGCAAAAGGAAGUGAAUAGACUGAUUAACUUCCUCC (((((((....)))))))....(((((((.(((......))).))))))).. ( -20.00) >mm5.chr7/100821872-100821925 CCCCAAAGCUAUUUGAAGCAGGAAGAAGAAAAAUAGACUGAGUUACUUCCUCC .......(((......)))((((((....................)))))).. ( -7.05) >rn3.chr1/172735501-172735555 CCCCAAAGCUAUUUGGAGCAGGAGGAAGAAAAAAUAGACUAAGUUACUUCCUCC ..(((((....)))))....((((((((..................)))))))) ( -14.77) >canFam1.chr1/15964658-15964711 CCCCAGAACUAUUUGGGGCAAGAGGAAGAAAAUAGACUGAUUUGCUUCCUCUC (((((((....)))))))..((((((((.((((......)))).)))))))). ( -21.20) >consensus CCCCAAAACUAUUUGGAGCAAGAGGAAGAAAA__UAGACUGAG__UUACUUCCUC_C (((((((....)))))))...(((((((....................))))))).. (-10.64 = -11.45 + 0.81)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
