Structure #140177
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr4 |
| Strand | + |
| Position | 129,762,742 - 129,762,816 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 81.53 |
| Columns | 74 |
| Mean single MFE | -28.18 |
| Consensus MFE | -27.58 |
| Combinations/base pair | 33 / 24 = 1.38 |
| SCI | 0.98 |
| z-score | -3.5 |
| RNA class probability | 0.999419 |
This structure is part of cluster 77311
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 74 Columns: 74 Strand: + Mean pairwise identity: 81.53 Mean single sequence MFE: -28.18 Consensus MFE: -27.58 Energy contribution: -26.20 Covariance contribution: -1.38 Mean z-score: -3.50 Structure conservation index: 0.98 SVM decision value: 3.59 SVM RNA-class probability: 0.999419 Prediction: RNA ###################################################################### >hg17.chr4/129762742-129762816 AAGUCAUUGUGGGUUUGGCAUCCUGUUCAGCCUGGCUGGGGCCAGGGGAGCUGAACUGUAAUGACAAGCAGAUG ..(((((((..(.((..((.(((.......((((((....)))))))))))..)))..)))))))......... ( -30.71) >mm5.chr3/41009081-41009155 AAGUCACUGUGGGUUUGGCAUCUUGUUCAGACCAAUGGGGUCCCAGGGAGCUGAACCCUAAUGACAUGCAGAUG ..((((.((.(((((..((..((((....((((.....)))).))))..))..))))))).))))......... ( -28.50) >rn3.chr2/128162061-128162135 AAGUCACUGUGGUUUUGGCAUCUUGUUCAGACCAAUGGGGUCCCAGGGAGCUGAACCCUAAUGACAUGCAGAUG ..((((...((((((..((.....))..)))))).((((((..(((....))).)))))).))))......... ( -23.50) >canFam1.chr19/41374245-41374171 AAGUCAUUGUGGGUUUAGCAUCCUAUUCAACCUAAUAAAGGUUAGAGGAGCUGAACUCUAAUGGCAUGCAGAUG ..(((((((.(((((((((.((((....(((((.....)))))..))))))))))))))))))))......... ( -30.00) >consensus AAGUCACUGUGGGUUUGGCAUCCUGUUCAGACCAAUGGGGGCCAAGGGAGCUGAACCCUAAUGACAUGCAGAUG ..(((((((.(((((((((.((((.....((((.....))))...))))))))))))))))))))......... (-27.58 = -26.20 + -1.38)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
