Structure #140178
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr4 |
| Strand | - |
| Position | 129,762,742 - 129,762,816 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 81.53 |
| Columns | 74 |
| Mean single MFE | -19.75 |
| Consensus MFE | -14.39 |
| Combinations/base pair | 24 / 18 = 1.33 |
| SCI | 0.73 |
| z-score | -2.22 |
| RNA class probability | 0.952483 |
This structure is part of cluster 77311
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 74 Columns: 74 Strand: + Mean pairwise identity: 81.53 Mean single sequence MFE: -19.75 Consensus MFE: -14.39 Energy contribution: -14.45 Covariance contribution: 0.06 Mean z-score: -2.22 Structure conservation index: 0.73 SVM decision value: 1.40 SVM RNA-class probability: 0.952483 Prediction: RNA ###################################################################### >hg17.chr4/129762816-129762742 CAUCUGCUUGUCAUUACAGUUCAGCUCCCCUGGCCCCAGCCAGGCUGAACAGGAUGCCAAACCCACAAUGACUU .........((((((...(((((((....(((((....)))))))))))).((.........))..)))))).. ( -23.80) >mm5.chr3/41009155-41009081 CAUCUGCAUGUCAUUAGGGUUCAGCUCCCUGGGACCCCAUUGGUCUGAACAAGAUGCCAAACCCACAGUGACUU .........((((((.(((((..((((..(.(((((.....))))).)....)).))..)))))..)))))).. ( -21.10) >rn3.chr2/128162135-128162061 CAUCUGCAUGUCAUUAGGGUUCAGCUCCCUGGGACCCCAUUGGUCUGAACAAGAUGCCAAAACCACAGUGACUU .........((((((.((((((((..((.(((....)))..)).))))))..(....)....))..)))))).. ( -18.30) >canFam1.chr19/41374171-41374245 CAUCUGCAUGCCAUUAGAGUUCAGCUCCUCUAACCUUUAUUAGGUUGAAUAGGAUGCUAAACCCACAAUGACUU ...........((((.(.(((.(((((((.((((((.....))))))...)))).))).))).)..)))).... ( -15.80) >consensus CAUCUGCAUGUCAUUAGAGUUCAGCUCCCCGGGACCCCAUUAGGCUGAACAAGAUGCCAAACCCACAAUGACUU ........((.((((...(((((((((..(((....)))..)))))))))..)))).))............... (-14.39 = -14.45 + 0.06)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
