Structure #144847
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr5 |
| Strand | - |
| Position | 35,585,000 - 35,585,063 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 73.71 |
| Columns | 66 |
| Mean single MFE | -17.93 |
| Consensus MFE | -16.44 |
| Combinations/base pair | 20 / 14 = 1.43 |
| SCI | 0.92 |
| z-score | -3.32 |
| RNA class probability | 0.999909 |
This structure is part of cluster 80088
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 66 Columns: 66 Strand: + Mean pairwise identity: 73.71 Mean single sequence MFE: -17.93 Consensus MFE: -16.44 Energy contribution: -15.25 Covariance contribution: -1.19 Mean z-score: -3.32 Structure conservation index: 0.92 SVM decision value: 4.49 SVM RNA-class probability: 0.999909 Prediction: RNA ###################################################################### >hg17.chr5/35585063-35585000 GUUUUGUCCUGACCUUCUGGUUUCAGGACAAGGCUGAUUUUUAAGUCUCGCAGUAUUUCCUAG ((((((((((((((....))..)))))))))))).((((....))))................ ( -19.00) >mm5.chr15/94435331-94435387 GUAUUGUUGUGACCUCUUGGCUUCAUGGCAAGAUUUCUCACAGCACAAUUUCCUAG ....((((((((..(((((.(.....).)))))....))))))))........... ( -15.80) >rn3.chr2/201464173-201464232 GUUUUGUCGUGACCUUUUGGCUUCAUGACAAGAUUUUAAGUCUCAGUACAAUUUCCUAG ((((((((((((((....))..))))))))))))......................... ( -14.20) >canFam1.chr4/15263404-15263467 GUUUUGUCCUGACCUUAUGGUUUCAGGACAAAACUGGUUGUUAAAUCUCACAGCAUUUCCUAG ((((((((((((((....))..))))))))))))..(((((........)))))......... ( -22.70) >consensus GUUUUGUCCUGACCUUUUGGCUUCAGGACAAGACU_____UUAAGUCUCACAGCA___UUUCCUAG ((((((((((((((....))..))))))))))))................................ (-16.44 = -15.25 + -1.19)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
