Structure #146126
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr5 |
| Strand | + |
| Position | 60,955,149 - 60,955,213 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 82.77 |
| Columns | 64 |
| Mean single MFE | -24.25 |
| Consensus MFE | -18.59 |
| Combinations/base pair | 28 / 19 = 1.47 |
| SCI | 0.77 |
| z-score | -3.08 |
| RNA class probability | 0.996831 |
This structure is part of cluster 80849
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 64 Columns: 64 Strand: + Mean pairwise identity: 82.77 Mean single sequence MFE: -24.25 Consensus MFE: -18.59 Energy contribution: -17.90 Covariance contribution: -0.69 Mean z-score: -3.08 Structure conservation index: 0.77 SVM decision value: 2.75 SVM RNA-class probability: 0.996831 Prediction: RNA ###################################################################### >hg17.chr5/60955149-60955213 AUGGUUCAGCCAGACCCACAAGGUCUGGCAGAGUUCUUGCCUUUCCCAGGCUUUGGGGUUCUCU ........((((((((.....))))))))((((..((.((((.....))))...))..)))).. ( -27.60) >mm5.chr13/12041896-12041833 AUGGUUCAGCCUGGCUCCAAAGGCGUGGUGAGUUUUUGCCUUUCCCAGUCUUUGGAGCUCUCU ..((.....)).((((((((((((.(((.(((.........)))))))))))))))))).... ( -25.10) >rn3.chr2/219436177-219436114 AUGGUUCAGCCAGGCUCAAAGGGUCUGGUGAGCUUAGGACUUUCCCAGUCUUUGGAGUUCUCU ........((((((((.....))))))))((((((.(((((.....)))))...))))))... ( -23.10) >canFam1.chr2/48749741-48749804 AUGGUUCAGCCAGACUCCAGGGUCUAGUAGAGUUCUUGCCUUUCCCAGGCUUUGGGGUUCUCU .(((.....)))(((((((((((((.(.((((.......)))).).))))))))))))).... ( -21.20) >consensus AUGGUUCAGCCAGACUCAAAAGGUCUGGU_GAGUUCUUGCCUUUCCCAGGCUUUGGAGUUCUCU ........((((((((.....)))))))).(((((((.((((.....))))...)))))))... (-18.59 = -17.90 + -0.69)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
