Structure #152328
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr5 |
| Strand | + |
| Position | 141,576,239 - 141,576,292 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 79.56 |
| Columns | 53 |
| Mean single MFE | -18.35 |
| Consensus MFE | -13.3 |
| Combinations/base pair | 30 / 21 = 1.43 |
| SCI | 0.72 |
| z-score | -3.23 |
| RNA class probability | 0.999473 |
This structure is part of cluster 84325
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 53 Columns: 53 Strand: + Mean pairwise identity: 79.56 Mean single sequence MFE: -18.35 Consensus MFE: -13.30 Energy contribution: -12.68 Covariance contribution: -0.63 Mean z-score: -3.23 Structure conservation index: 0.72 SVM decision value: 3.63 SVM RNA-class probability: 0.999473 Prediction: RNA ###################################################################### >hg17.chr5/141576239-141576292 UCUGUUUCAAUCUGAGCUUUUGUAAGGAUGCAGAUUUGGGACUUGGAACAGGA (((((((((((((.((..((((((....)))))).)).))).)))))))))). ( -17.10) >mm5.chr18/38961703-38961756 UCUGUUCUAAUCUGCACUUUUGCAAGAACGCAGAUGUGAGACUUGGAGCGGGA (((((((((((((.(((.(((((......))))).)))))).)))))))))). ( -21.90) >rn3.chr18/31493238-31493290 UCUGUUCUAAUCUGCACUUUUGCAAGAACGCAGAUGUGAGACUUGGAACGGA (((((((((((((.(((.(((((......))))).)))))).)))))))))) ( -22.00) >canFam1.chr2/37723411-37723461 UCUUUCCAAUCUGAGCUUUUAUAGAGGCAGACUGGGAACUUGGAACAGGA ..((((((.((((..(((.....))).)))).))))))((((...)))). ( -12.40) >consensus UCUGUUCCAAUCUGAACUUUUGCAAGAACGCAGAUGUGAGACUUGGAACAGGA ((((((((((((((((..(((((......)))))))))))..)))))))))). (-13.30 = -12.68 + -0.63)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
