Structure #154570
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr5 |
| Strand | - |
| Position | 166,225,112 - 166,225,173 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 83.2 |
| Columns | 64 |
| Mean single MFE | -12.67 |
| Consensus MFE | -12.07 |
| Combinations/base pair | 17 / 12 = 1.42 |
| SCI | 0.95 |
| z-score | -3.13 |
| RNA class probability | 0.998899 |
This structure is part of cluster 85594
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 64 Columns: 64 Strand: + Mean pairwise identity: 83.20 Mean single sequence MFE: -12.67 Consensus MFE: -12.07 Energy contribution: -11.45 Covariance contribution: -0.62 Mean z-score: -3.13 Structure conservation index: 0.95 SVM decision value: 3.27 SVM RNA-class probability: 0.998899 Prediction: RNA ###################################################################### >hg17.chr5/166225173-166225112 AUGAAUGGCUUCAUGUCAUUCCCAAUUAAGCCUUCCCAUGAUCUGUCCUGAUUAGCAUAAA ..(((((((.....))))))).................(((((......)))))....... ( -10.70) >mm5.chr11/84612670-84612731 AUGAAUGACUUCAUGUCAUUCCCAAUUAGGCACCCCCAUCAUCUGUCCUGAUUAGCACAAA ..(((((((.....)))))))..(((((((((...........)).)))))))........ ( -13.80) >rn3.chr10/88432472-88432536 AUGGAUGGCUUCAUGCCAUCCCCAAUUAGCCCCACCCCCCAUCAUCUGUCCUGAUUAGCACAAA ..(((((((.....)))))))..((((((..(...............)..))))))........ ( -13.56) >canFam1.chr4/43401036-43401097 AUGAAUGACUUCUAGUCAUUCCCAAUUAAUCCUUCCCAUCAUCUGUCCUGGUGAACACAAA ..(((((((.....))))))).................(((((......)))))....... ( -12.60) >consensus AUGAAUGACUUCAUGUCAUUCCCAAUUAAGCCC___CCCCAUCAUCUGUCCUGAUUAGCACAAA ..(((((((.....)))))))....................(((((......)))))....... (-12.07 = -11.45 + -0.62)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
