Structure #158726
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr6 |
| Strand | + |
| Position | 35,568,251 - 35,568,364 |
| Number of sequences | 2 |
| Organisms | human, dog |
| Mean pairwise identity | 78.15 |
| Columns | 119 |
| Mean single MFE | -52.7 |
| Consensus MFE | -44.65 |
| Combinations/base pair | 42 / 38 = 1.11 |
| SCI | 0.85 |
| z-score | -3.28 |
| RNA class probability | 0.999043 |
This structure is part of cluster 87908
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 2 Slice: 1 to 119 Columns: 119 Strand: + Mean pairwise identity: 78.15 Mean single sequence MFE: -52.70 Consensus MFE: -44.65 Energy contribution: -45.90 Covariance contribution: 1.25 Mean z-score: -3.28 Structure conservation index: 0.85 SVM decision value: 3.34 SVM RNA-class probability: 0.999043 Prediction: RNA ###################################################################### >hg17.chr6/35568251-35568364 CAGGCUGGGGAGGGCUUCCCUCCUUCCUGGAACAGGGUCUCAAUUUUUACAGGAGGAAGCAAUUUGCAGAGCCCACUAGGAGGGAGGUGGGGGCCCCUCCACUCUCUCCCCAC .....(((((((((.....(((((((((((....(((.(((..(((((....))))).((.....)).)))))).)))))))))))((((((....)))))).))))))))). ( -54.30) >canFam1.chr12/7549728-7549839 CAGGCUGGGGAGGGAGUACCCUCCUCCCUGGAGCAGGGUAGAGAUUUUUACAGGAGGAAGCAAUUUGCAGAGCCCACUAGGAGGGAGGUGGGGAGGCCUCCUCCCCGCUCU ..(((.(((((((..((.(((.(((((((..((..((((.....(((((....))))).((.....))...)))).))...))))))).)))...))..)))))))))).. ( -51.10) >consensus CAGGCUGGGGAGGGAGU_CCCUCCUCCCUGGAACAGGGUAGAAAUUUUUACAGGAGGAAGCAAUUUGCAGAGCCCACUAGGAGGGAGGUGGGGA_____CCCCCCCACUCU________ ((((..((((((((....)))))))))))).....((((.....(((((....))))).((.....))...))))....((((((((.(((((((.....))))))))))))))).... (-44.65 = -45.90 + 1.25)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
