Structure #158730
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr6 |
| Strand | - |
| Position | 35,568,251 - 35,568,364 |
| Number of sequences | 2 |
| Organisms | human, dog |
| Mean pairwise identity | 78.15 |
| Columns | 119 |
| Mean single MFE | -45.78 |
| Consensus MFE | -34.01 |
| Combinations/base pair | 32 / 29 = 1.10 |
| SCI | 0.74 |
| z-score | -2.44 |
| RNA class probability | 0.984225 |
This structure is part of cluster 87908
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 2 Slice: 1 to 119 Columns: 119 Strand: + Mean pairwise identity: 78.15 Mean single sequence MFE: -45.78 Consensus MFE: -34.01 Energy contribution: -34.26 Covariance contribution: 0.25 Mean z-score: -2.44 Structure conservation index: 0.74 SVM decision value: 1.97 SVM RNA-class probability: 0.984225 Prediction: RNA ###################################################################### >hg17.chr6/35568364-35568251 GUGGGGAGAGAGUGGAGGGGCCCCCACCUCCCUCCUAGUGGGCUCUGCAAAUUGCUUCCUCCUGUAAAAAUUGAGACCCUGUUCCAGGAAGGAGGGAAGCCCUCCCCAGCCUG .((((((..(((.(((((((...)).)))))))).....(((((..((.....))((((((((..............((((...)))).)))))))))))))))))))..... ( -45.96) >canFam1.chr12/7549839-7549728 AGAGCGGGGAGGAGGCCUCCCCACCUCCCUCCUAGUGGGCUCUGCAAAUUGCUUCCUCCUGUAAAAAUCUCUACCCUGCUCCAGGGAGGAGGGUACUCCCUCCCCAGCCUG .((((((((.((((((...(((((..........)))))....))...((((........))))....)))).))))))))((((..((((((....))))))....)))) ( -45.60) >consensus ________AGAGCGGAGAGG_____CCCCCACCUCCCUCCUAGUGGGCUCUGCAAAUUGCUUCCUCCUGUAAAAAUCGAGACCCUGCUCCAGGAAGGAGGG_AAGCCCUCCCCAGCCUG ........((.(((((((((.......(((.(((((((...((..((.........((((........))))..........))..))..))))))).))).....))))))).)))). (-34.01 = -34.26 + 0.25)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
