Structure #158732
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr6 |
| Strand | + |
| Position | 35,568,290 - 35,568,396 |
| Number of sequences | 2 |
| Organisms | human, dog |
| Mean pairwise identity | 73.87 |
| Columns | 111 |
| Mean single MFE | -40.99 |
| Consensus MFE | -30.74 |
| Combinations/base pair | 25 / 22 = 1.14 |
| SCI | 0.75 |
| z-score | -4.05 |
| RNA class probability | 0.99962 |
This structure is part of cluster 87908
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 2 Slice: 1 to 111 Columns: 111 Strand: + Mean pairwise identity: 73.87 Mean single sequence MFE: -40.99 Consensus MFE: -30.74 Energy contribution: -30.24 Covariance contribution: -0.50 Mean z-score: -4.05 Structure conservation index: 0.75 SVM decision value: 3.79 SVM RNA-class probability: 0.999620 Prediction: RNA ###################################################################### >hg17.chr6/35568290-35568396 UCAAUUUUUACAGGAGGAAGCAAUUUGCAGAGCCCACUAGGAGGGAGGUGGGGGCCCCUCCACUCUCUCCCCACCCCCCGCCCUGCUUAUUAAUGUGCUUCCAAUU ...............(((((((....((((.((((....)).(((.((((((((.............)))))))).))))).)))).........))))))).... ( -40.34) >canFam1.chr12/7549768-7549864 GAGAUUUUUACAGGAGGAAGCAAUUUGCAGAGCCCACUAGGAGGGAGGUGGGGAGGCCUCCUCCCCGCUCUCCCACUUAUUAAUGUGCUUCCAAUU ...............(((((((.......(((.((....)).((((((((((((((...))))))))).))))).))).......))))))).... ( -41.64) >consensus GAAAUUUUUACAGGAGGAAGCAAUUUGCAGAGCCCACUAGGAGGGAGGUGGGGA_____CCCCCCCACUCU_______________CCCACUUAUUAAUGUGCUUCCAAUU ...............(((((((.......((((((.......))).(((((((((.....))))))))).....................))).......))))))).... (-30.74 = -30.24 + -0.50)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
