Structure #158734
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr6 |
| Strand | - |
| Position | 35,568,290 - 35,568,396 |
| Number of sequences | 2 |
| Organisms | human, dog |
| Mean pairwise identity | 73.87 |
| Columns | 111 |
| Mean single MFE | -41.73 |
| Consensus MFE | -26.65 |
| Combinations/base pair | 33 / 30 = 1.10 |
| SCI | 0.64 |
| z-score | -3.64 |
| RNA class probability | 0.99849 |
This structure is part of cluster 87908
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 2 Slice: 1 to 111 Columns: 111 Strand: + Mean pairwise identity: 73.87 Mean single sequence MFE: -41.73 Consensus MFE: -26.65 Energy contribution: -28.65 Covariance contribution: 2.00 Mean z-score: -3.64 Structure conservation index: 0.64 SVM decision value: 3.12 SVM RNA-class probability: 0.998490 Prediction: RNA ###################################################################### >hg17.chr6/35568396-35568290 AAUUGGAAGCACAUUAAUAAGCAGGGCGGGGGGUGGGGAGAGAGUGGAGGGGCCCCCACCUCCCUCCUAGUGGGCUCUGCAAAUUGCUUCCUCCUGUAAAAAUUGA ....(((((((.(((.....((((((((((((((((((...............))))))))))).((....))))))))).))))))))))............... ( -46.36) >canFam1.chr12/7549864-7549768 AAUUGGAAGCACAUUAAUAAGUGGGAGAGCGGGGAGGAGGCCUCCCCACCUCCCUCCUAGUGGGCUCUGCAAAUUGCUUCCUCCUGUAAAAAUCUC ....(((((((((((....))))(.((((((((((((.((.....)).)))))))((....))))))).)....)))))))............... ( -37.10) >consensus AAUUGGAAGCACAUUAAUAAGCAGG_______________AGAGCGGAGAGG_____CCCCCACCUCCCUCCUAGUGGGCUCUGCAAAUUGCUUCCUCCUGUAAAAAUCGA ....(((((((.(((.....(((((((............(((.((((((((.....)))))))))))...((....))))))))).))))))))))............... (-26.65 = -28.65 + 2.00)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
