Structure #181889
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr8 |
| Strand | + |
| Position | 107,819,050 - 107,819,116 |
| Number of sequences | 5 |
| Organisms | human, dog, mouse, rat, chicken |
| Mean pairwise identity | 74.72 |
| Columns | 74 |
| Mean single MFE | -24.86 |
| Consensus MFE | -19.4 |
| Combinations/base pair | 31 / 22 = 1.41 |
| SCI | 0.78 |
| z-score | -5.64 |
| RNA class probability | 0.995656 |
This structure is part of cluster 101221
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 5 Slice: 1 to 74 Columns: 74 Strand: + Mean pairwise identity: 74.72 Mean single sequence MFE: -24.86 Consensus MFE: -19.40 Energy contribution: -18.60 Covariance contribution: -0.80 Mean z-score: -5.64 Structure conservation index: 0.78 SVM decision value: 2.60 SVM RNA-class probability: 0.995656 Prediction: RNA ###################################################################### >hg17.chr8/107819050-107819116 UGUUUUUAGUGUUCUUUGUCAUGGCAAAUCUCAUUUGAAGAAUUUGCUUUGACUGCAGCACUAAAA ...(((((((((((...((((.((((((((((....).)).))))))).)))).).)))))))))) ( -21.50) >canFam1.chr13/10578419-10578487 UGUUUUUAGUGUCUCUCGUCAGGGCAAAUCUCAUUUUUAAAGGAUUUGUCUUGACUGCAGCACUAAAA ...(((((((((..(..((((((((((((((..........)))))))))))))).)..))))))))) ( -26.00) >mm5.chr15/41823089-41823157 UGUUUUUAGUGUCCUUUCUCAAGACAAAUCUCACAUUAGAAGGAUUUGCCUUGAAUGAAACACUAAAA ...(((((((((..((..(((((.(((((((..(....)..))))))).)))))..)).))))))))) ( -19.40) >rn3.chr7/77510991-77511059 UGUUUUUAGUGUCCUUUCUCAAGACAAAUCUUACGUUAAAAGGAUUUGUCUUGAAUGAAGCACUAAAA ...(((((((((..((..((((((((((((((........))))))))))))))..)).))))))))) ( -26.00) >galGal2.chr2/129925776-129925848 UUUGUAGUGUCUUUGAUCAGGGCAAGUCCCACUCUUAAGGUGGGUUUGUCUUGUCUACAAACAACACUACAA .(((((((((.((((..(((((((((.((((((.....)))))))))))))))....))))..))))))))) ( -31.40) >consensus UGUUUUUAGUGUCCUUUCUCAAGGCAAAUCUCACAUUUAAA__GGAUUUGUCUUGACU____GCAGCACUAAAA ...(((((((((......(((((((((((((............))))))))))))).........))))))))) (-19.40 = -18.60 + -0.80)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
