Structure #181890
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr8 |
| Strand | - |
| Position | 107,819,050 - 107,819,116 |
| Number of sequences | 5 |
| Organisms | human, dog, mouse, rat, chicken |
| Mean pairwise identity | 74.72 |
| Columns | 74 |
| Mean single MFE | -22.18 |
| Consensus MFE | -13.54 |
| Combinations/base pair | 26 / 20 = 1.30 |
| SCI | 0.61 |
| z-score | -5.08 |
| RNA class probability | 0.999672 |
This structure is part of cluster 101221
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 5 Slice: 1 to 74 Columns: 74 Strand: + Mean pairwise identity: 74.72 Mean single sequence MFE: -22.18 Consensus MFE: -13.54 Energy contribution: -13.54 Covariance contribution: 0.00 Mean z-score: -5.08 Structure conservation index: 0.61 SVM decision value: 3.87 SVM RNA-class probability: 0.999672 Prediction: RNA ###################################################################### >hg17.chr8/107819116-107819050 UUUUAGUGCUGCAGUCAAAGCAAAUUCUUCAAAUGAGAUUUGCCAUGACAAAGAACACUAAAAACA ((((((((((...((((..((((((.(((.....)))))))))..))))..))..))))))))... ( -17.70) >canFam1.chr13/10578487-10578419 UUUUAGUGCUGCAGUCAAGACAAAUCCUUUAAAAAUGAGAUUUGCCCUGACGAGAGACACUAAAAACA ((((((((((...((((.(.(((((((.........).)))))).).))))...)).))))))))... ( -18.50) >mm5.chr15/41823157-41823089 UUUUAGUGUUUCAUUCAAGGCAAAUCCUUCUAAUGUGAGAUUUGUCUUGAGAAAGGACACUAAAAACA (((((((((((..(((((((((((((..((......)))))))))))))))...)))))))))))... ( -26.20) >rn3.chr7/77511059-77510991 UUUUAGUGCUUCAUUCAAGACAAAUCCUUUUAACGUAAGAUUUGUCUUGAGAAAGGACACUAAAAACA (((((((((((..(((((((((((((............)))))))))))))..))).))))))))... ( -25.10) >galGal2.chr2/129925848-129925776 UUGUAGUGUUGUUUGUAGACAAGACAAACCCACCUUAAGAGUGGGACUUGCCCUGAUCAAAGACACUACAAA ((((((((((.....(((.((((.....((((((....).))))).))))..)))......)))))))))). ( -23.40) >consensus UUUUAGUGCUGC____AGUCAAGACAAAUCC__UUUAAAAGUGAGAUUUGCCCUGACAAAGGACACUAAAAACA ((((((((.........((((.((((((((..............)))))))).))))......))))))))... (-13.54 = -13.54 + 0.00)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
