Structure #183234
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chr8 |
| Strand | - |
| Position | 128,168,676 - 128,168,768 |
| Number of sequences | 3 |
| Organisms | human, mouse, rat |
| Mean pairwise identity | 77.61 |
| Columns | 109 |
| Mean single MFE | -26.9 |
| Consensus MFE | -17.87 |
| Combinations/base pair | 17 / 17 = 1.00 |
| SCI | 0.66 |
| z-score | -2.19 |
| RNA class probability | 0.975801 |
This structure is part of cluster 101980
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 3 Slice: 1 to 109 Columns: 109 Strand: + Mean pairwise identity: 77.61 Mean single sequence MFE: -26.90 Consensus MFE: -17.87 Energy contribution: -18.20 Covariance contribution: 0.33 Mean z-score: -2.19 Structure conservation index: 0.66 SVM decision value: 1.76 SVM RNA-class probability: 0.975801 Prediction: RNA ###################################################################### >hg17.chr8/128168768-128168676 ACCAAAAAGAGACUUCCCCUCAUGGUAGACGGAGGAGAAGUCCAUCCCCACCACCCACCAGAAGGCGACGGUCUCCUUCUCCCGCCCCUCA ........((((((((.(((..((((.(..((.((.((......)).)).))..).))))..))).)).))))))................ ( -23.80) >mm5.chr4/910-801 GCCAGAAAGAGACUUCCCCUCUAGUAGAAGGAGGAGAAGUCCCUCUCCCCCUCCUGCCAGAAGGCGAAGGUCUCCUUCUCCAGCCCCUCCGCCGCCACCUCCCCCUCC ((.((((.((((((((((.(((.((((.(((.(((((......))))).))).)))).))).)).))).))))).))))...))........................ ( -35.80) >rn3.chr5/916-807 GCCAAAAAGAGACUUCCCCUCUAGUAGAAGGAGGAGAAGUCCUUCCCCACCUCCUGCCAGAAGACGACGAUCUCCUUCUCCAGCCCCUCCUCCCCCUCCUCCCCCACC ......(((.((((((.(((((.......))))).))))))))).........(((..(((((..(.....)..))))).)))......................... ( -21.10) >consensus GCCAAAAAGAGACUUCCCCUC_UAGUAGAAGGAGGAGAAGUCCAUCCCCACCUCCUGCCAGAAGGCGACGGUCUCCUUCUCCAGCCCCUCC_CC_CC_CCUCCCCC_CC ..........((((((.((((..........)))).)))))).................((((((.(.....).))))))............................. (-17.87 = -18.20 + 0.33)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
