Structure #196510
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chrX |
| Strand | + |
| Position | 40,146,901 - 40,146,982 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 86.3 |
| Columns | 82 |
| Mean single MFE | -24.7 |
| Consensus MFE | -21.26 |
| Combinations/base pair | 26 / 23 = 1.13 |
| SCI | 0.86 |
| z-score | -3.49 |
| RNA class probability | 0.997582 |
This structure is part of cluster 109345
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 82 Columns: 82 Strand: + Mean pairwise identity: 86.30 Mean single sequence MFE: -24.70 Consensus MFE: -21.26 Energy contribution: -22.32 Covariance contribution: 1.06 Mean z-score: -3.49 Structure conservation index: 0.86 SVM decision value: 2.89 SVM RNA-class probability: 0.997582 Prediction: RNA ###################################################################### >hg17.chrX/40146901-40146982 ACCCAGAAACUGACUGGCCUCAAUUUGCCUUGUGAUUUGUUUGUUAGCUUUACAAAUGGCUUUUGAGGCCAGACAACCCCU ..........((.((((((((((...(((((((((...(((....))).))))))..)))..)))))))))).))...... ( -29.00) >mm5.chrX/10857132-10857213 GACCUAAAACAGCCUGGCUUCAAAUUGCCUCAUGAUCUGUUUGUUAGCUUUACAAAUGGCUCUUAAGGCCAGACUGCCCCU .........(((.(((((((.((...(((.........((((((.......)))))))))..)).))))))).)))..... ( -19.00) >rn3.chrX/138366961-138366879 AACCUAAAACAGCCUGGCCUCAAAUUGCCUCAUGAUCUGUUUGUUAGCUUUACAGAUGGCUUUUGAGGCCAAACUGCCCCCU .........(((..((((((((((..(((.....((((((..(....)...))))))))).))))))))))..)))...... ( -29.00) >canFam1.chrX/34821354-34821435 ACCCAGAAACAGACUGGACUCAAUUUGCCUUGUGAUUUGUUUGUUAGCUUUACAAAUGGCUUUUGAGGCCAGACAACCCCU .............((((.(((((...(((((((((...(((....))).))))))..)))..))))).))))......... ( -21.80) >consensus AACCAAAAACAGACUGGCCUCAAAUUGCCUCAUGAUCUGUUUGUUAGCUUUACAAAUGGCUUUUGAGGCCAGACAA_CCCCU .........(((.((((((((((...(((.....((((((..(....)...)))))))))..)))))))))).)))...... (-21.26 = -22.32 + 1.06)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
