Structure #196511
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chrX |
| Strand | - |
| Position | 40,146,901 - 40,146,982 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 86.3 |
| Columns | 82 |
| Mean single MFE | -28.52 |
| Consensus MFE | -24.59 |
| Combinations/base pair | 33 / 26 = 1.27 |
| SCI | 0.86 |
| z-score | -3.67 |
| RNA class probability | 0.997816 |
This structure is part of cluster 109345
Alignment
RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 82 Columns: 82 Strand: + Mean pairwise identity: 86.30 Mean single sequence MFE: -28.53 Consensus MFE: -24.59 Energy contribution: -24.27 Covariance contribution: -0.31 Mean z-score: -3.67 Structure conservation index: 0.86 SVM decision value: 2.94 SVM RNA-class probability: 0.997816 Prediction: RNA ###################################################################### >hg17.chrX/40146982-40146901 AGGGGUUGUCUGGCCUCAAAAGCCAUUUGUAAAGCUAACAAACAAAUCACAAGGCAAAUUGAGGCCAGUCAGUUUCUGGGU (((..(((.((((((((((..(((((((((...........)))))).....)))...)))))))))).)))..))).... ( -30.30) >mm5.chrX/10857213-10857132 AGGGGCAGUCUGGCCUUAAGAGCCAUUUGUAAAGCUAACAAACAGAUCAUGAGGCAAUUUGAAGCCAGGCUGUUUUAGGUC .(((((((((((((.(((((.(((.(((((.......)))))((.....)).)))..))))).)))))))))))))..... ( -27.30) >rn3.chrX/138366879-138366961 AGGGGGCAGUUUGGCCUCAAAAGCCAUCUGUAAAGCUAACAAACAGAUCAUGAGGCAAUUUGAGGCCAGGCUGUUUUAGGUU ..(((((((((((((((((((.(((((((((...........)))))).....)))..)))))))))))))))))))..... ( -35.70) >canFam1.chrX/34821435-34821354 AGGGGUUGUCUGGCCUCAAAAGCCAUUUGUAAAGCUAACAAACAAAUCACAAGGCAAAUUGAGUCCAGUCUGUUUCUGGGU ((..(..(.((((.(((((..(((((((((...........)))))).....)))...))))).)))).)..)..)).... ( -20.80) >consensus AGGGG_CAGUCUGGCCUCAAAAGCCAUUUGUAAAGCUAACAAACAAAUCACAAGGCAAAUUGAGGCCAGGCUGUUUCAGGGU ..(((.((((((((((((((..(((((((((...........)))))).....)))...)))))))))))))).)))..... (-24.59 = -24.27 + -0.31)
Consensus structure
Secondary structure graph
Montain plot
Dotplot
