Structure #197020
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chrX |
| Strand | - |
| Position | 48,556,034 - 48,556,105 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 80.96 |
| Columns | 73 |
| Mean single MFE | -19.5 |
| Consensus MFE | -17.35 |
| Combinations/base pair | 26 / 19 = 1.37 |
| SCI | 0.89 |
| z-score | -3.09 |
| RNA class probability | 0.999002 |
This structure is part of cluster 109650
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 73 Columns: 73 Strand: + Mean pairwise identity: 80.96 Mean single sequence MFE: -19.50 Consensus MFE: -17.35 Energy contribution: -17.60 Covariance contribution: 0.25 Mean z-score: -3.09 Structure conservation index: 0.89 SVM decision value: 3.32 SVM RNA-class probability: 0.999002 Prediction: RNA ###################################################################### >hg17.chrX/48556105-48556034 UCCCUGGGAUGUUUCCCAGAGGAAGAGCUGGGUUUCGGGGCAUCUUGGACAAAAGAAAGGCAAAGAAAGAA (((((((((....)))))).))).........((((...((.((((......))))...))...))))... ( -21.60) >mm5.chrX/154486821-154486894 UCCCUGGGAAAUUUACUAGAGAAAGACCUGAGUUUGGAAAUAUCUUAGGGAUAAAAGGAAAGCAGAGAAUGAA (((((((((.((((.(((((............))))))))).)))))))))...................... ( -15.50) >rn3.chrX/26729913-26729840 UCCCUGGGAUACUUACUAGAGAAAGACCUGGGUUUGGAAGUAUCUUAGGGAUAAAAAGAAAGCAGAGAAUGAA ((((((((((((((.((((........))))......))))))))))))))...................... ( -22.70) >canFam1.chrX/41910360-41910289 UCCCUGGGAUGUUUCCUAGAGAAAGAACUGGGUUUUGGGGCAUCUUGGGCCAAAGGAAAGCAAAGAAAGAA ..((..(((((((((((((........))))).....))))))))..))...................... ( -18.20) >consensus UCCCUGGGAUAUUUACUAGAGAAAGACCUGGGUUUGGAAGCAUCUU__GGACAAAAGGAAAGCAAAGAAAGAA (((((((((((((((((((........))))).....))))))))))))))...................... (-17.35 = -17.60 + 0.25)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
