Structure #198749
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chrX |
| Strand | + |
| Position | 71,398,031 - 71,398,095 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 80.29 |
| Columns | 71 |
| Mean single MFE | -21.28 |
| Consensus MFE | -17.19 |
| Combinations/base pair | 22 / 16 = 1.38 |
| SCI | 0.81 |
| z-score | -3.1 |
| RNA class probability | 0.999133 |
This structure is part of cluster 110447
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 71 Columns: 71 Strand: + Mean pairwise identity: 80.29 Mean single sequence MFE: -21.27 Consensus MFE: -17.19 Energy contribution: -16.38 Covariance contribution: -0.81 Mean z-score: -3.10 Structure conservation index: 0.81 SVM decision value: 3.39 SVM RNA-class probability: 0.999133 Prediction: RNA ###################################################################### >hg17.chrX/71398031-71398095 AAGGAAAGGGUGAUUAUCUGCAAGUGAAAAAGUAGUUUGUACAUUUUAGAUUUCCUUUCCAGUU ..((((((((.....(((((.(((((..(((....)))...)))))))))).)))))))).... ( -15.90) >mm5.chrX/93754285-93754354 AAGGAGAGGAUGAAGAUGGGGCUGCAAGUGAUGAAAGUGGUCUGCACUUUUCAGAUUUCCUCUCCAGUU ..((((((((((((((((((((..(...........)..)))).)).))))))....)))))))).... ( -25.10) >rn3.chrX/90465458-90465527 AAGGAGAGGAUGAAGAUGGGGCUGCAAGUGAUGAAAGUGGUUUGCACUUUUCCGAUUUCCUCUCUAGUU ..((((((((....(..((((.((((((..((....))..))))))))))..)....)))))))).... ( -23.60) >canFam1.chrX/59289890-59289957 AAGGAGAGGGUGAUCAUCUGCAAGUGAUGAAAAAGUGGCUUGUACAUUUUACAUUUCCUUUCCGGUU ..(((((((((((.....(((((((.((......)).)))))))....))))....))))))).... ( -20.50) >consensus AAGGAGAGGAUGAAGAU____CUGCAAGUGAU__AAAAGUGGUUUGCACAUUUCAGAUUUCCUCUCCAGUU ..((((((((............((((((..((......))..))))))...........)))))))).... (-17.19 = -16.38 + -0.81)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
