Structure #198750
Summary
| Genome/Assembly | hg17 |
| Chromosome/Contig | chrX |
| Strand | - |
| Position | 71,398,031 - 71,398,095 |
| Number of sequences | 4 |
| Organisms | human, mouse, rat, dog |
| Mean pairwise identity | 80.29 |
| Columns | 71 |
| Mean single MFE | -13.43 |
| Consensus MFE | -7.91 |
| Combinations/base pair | 14 / 12 = 1.17 |
| SCI | 0.59 |
| z-score | -2.55 |
| RNA class probability | 0.951543 |
This structure is part of cluster 110447
Alignment

RNAz output
########################### RNAz 0.1.1 ############################# Sequences: 4 Slice: 1 to 71 Columns: 71 Strand: + Mean pairwise identity: 80.29 Mean single sequence MFE: -13.43 Consensus MFE: -7.91 Energy contribution: -8.47 Covariance contribution: 0.56 Mean z-score: -2.55 Structure conservation index: 0.59 SVM decision value: 1.39 SVM RNA-class probability: 0.951543 Prediction: RNA ###################################################################### >hg17.chrX/71398095-71398031 AACUGGAAAGGAAAUCUAAAAUGUACAAACUACUUUUUCACUUGCAGAUAAUCACCCUUUCCUU ....(((((((..........((((.................)))).........))))))).. ( -9.54) >mm5.chrX/93754354-93754285 AACUGGAGAGGAAAUCUGAAAAGUGCAGACCACUUUCAUCACUUGCAGCCCCAUCUUCAUCCUCUCCUU ....((((((((....(((((.(((.....)))))))).....((.((......)).)))))))))).. ( -17.90) >rn3.chrX/90465527-90465458 AACUAGAGAGGAAAUCGGAAAAGUGCAAACCACUUUCAUCACUUGCAGCCCCAUCUUCAUCCUCUCCUU .....(((((((.....((((.(((.....)))))))......((.((......)).)))))))))... ( -13.80) >canFam1.chrX/59289957-59289890 AACCGGAAAGGAAAUGUAAAAUGUACAAGCCACUUUUUCAUCACUUGCAGAUGAUCACCCUCUCCUU ....(((.(((...((((.....))))..........(((((.......)))))....))).))).. ( -12.50) >consensus AACUGGAAAGGAAAUCUAAAAAGUACAAACCACUUUC__AUCACUUGCAG____AUCAUCACCCUCUCCUU ....(((((((............(((((................))))).............))))))).. ( -7.91 = -8.47 + 0.56)
Consensus structure
Secondary structure graph

Montain plot

Dotplot
