MFE structure of a single sequence

1. Use a text editor (emacs, vi, nano, gedit) to prepare an input file by pasting the text below and save it under the name test.seq in your data folder.

     > test
     CCGCACAGCGGGCAGUGCCCA
   

2. Compute the best (MFE) structure for this sequence

     $ RNAfold < test.seq 
     CCGCACAGCGGGCAGUGCCCA
     .........((((...)))). ( -5.70)
   

The last line of the text output contains the predicted MFE structure as dot-bracket notation and its free energy in kcal/mol. A dot in the dot-bracket notation represents an unpaired position, while a base pair (i, j) is represented by a pair of matching parentheses at position i and j.

RNAfold created a file named test_ss.ps. Let's take a look at it with gv, a PostScript² viewer. The & at the end starts the program in the background.

  $ gv test_ss.ps &

Compare the dot-bracket notation to the PostScript drawing shown in the file test_ss.ps.

The calculation above does not tell us whether the predicted structure is the only possibility or not, so let's look at the equilibrium ensemble instead.