$ RNAsubopt -e 1 -s < test.seq CCGCACAGCGGGCAGUGCCCA -570 100 .........((((...)))). -5.70 ((((...)))).......... -5.40 ((((...))))((...))... -4.90 ..((...))((((...)))). -4.80
MFE folding alone gives no
indication that there are actually a number of plausible structures.
Remember that RNAsubopt cannot automatically plot structures, therefore
you can use the tool RNAplot.
Note that the number of suboptimal structures grows exponentially with
sequence length and therefore this approach is only tractable for
sequences with less than 100 nt. To keep the number of suboptimal
structures manageable the option -noLP can be used, forcing
RNAsubopt to produce only structures without isolated base
pairs. While RNAsubopt produces all structures within an
energy range, mfold produces only a few, hopefully representative,
structures. Try folding the sequence on the mfold
server at
http://mfold.rna.albany.edu/?q=mfold.
Sometimes you want to get information about unusual properties of the Boltzmann ensemble (the sum of all RNA structures possible) for which no specialized program exists. For example you want to know all fractions of a bacterial mRNA in the Boltzmann ensemble where the Shine-Dalgarno (SD) sequence is unpaired. If the SD sequence is concealed by secondary structure the translation efficiency is reduced.
In such cases you can resort to drawing a representative sample of
structures from the Boltzmann ensemble by using the option
-p. Now you can simply count how many structures in the sample
possess the feature you are looking for. This number divided by the
size of your sample gives you the desired fraction.
The following example calculates the fraction of structures in the ensemble that have bases 6 to 8 unpaired.
Sven Findeiss 2013-11-22