Theoretical Biochemistry Group

Institute for Theoretical Chemistry

Font size: Increase font size Decrease font size Switch style sheet from default to highcontrast and back

RNAFOLD

NAME
SYNOPSIS
DESCRIPTION
EXAMPLES
AUTHOR
REFERENCES
REPORTING BUGS


2.1.7

NAME

RNAfold − manual page for RNAfold 2.1.7

SYNOPSIS

RNAfold [OPTIONS]...

DESCRIPTION

RNAfold 2.1.7

Calculate minimum free energy secondary structures and partition function of RNAs

The program reads RNA sequences from stdin, calculates their minimum free energy (mfe) structure and prints to stdout the mfe structure in bracket notation and its free energy. If the −p option was given it also computes the partition function (pf) and base pairing probability matrix, and prints the free energy of the thermodynamic ensemble, the frequency of the mfe structure in the ensemble, and the ensemble diversity to stdout.

It also produces PostScript files with plots of the resulting secondary structure graph and a "dot plot" of the base pairing matrix. The dot plot shows a matrix of squares with area proportional to the pairing probability in the upper right half, and one square for each pair in the minimum free energy structure in the lower left half. For each pair i−j with probability p>10E−6 there is a line of the form

i j sqrt(p) ubox

in the PostScript file, so that the pair probabilities can be easily extracted.

Sequences may be provided in a simple text format where each sequence occupies a single line. Output files are named "rna.ps" and "dot.ps". Existing files of the same name will be overwritten. It is also possible to provide sequence data in FASTA format. In this case, the first word (max. 42 char) of the FASTA header will be used for output file names. PostScript files "name_ss.ps" and "name_dp.ps" are produced for the structure and dot plot, respectively. Once FASTA input was provided all following sequences must be in FASTA format too. The program will continue to read new sequences until a line consisting of the single character @ or an end of file condition is encountered.
−h
, −−help

Print help and exit

−−detailed−help

Print help, including all details and hidden options, and exit

−−full−help

Print help, including hidden options, and exit

−V, −−version

Print version and exit

General Options:

Below are command line options which alter the general behavior of this program

−C, −−constraint

Calculate structures subject to constraints. (default=off)

The program reads first the sequence, then a string containing constraints on the structure encoded with the symbols:

. (no constraint for this base)

| (the corresponding base has to be paired

x (the base is unpaired)

< (base i is paired with a base j>i)

> (base i is paired with a base j<i)

and matching brackets ( ) (base i pairs base j)

With the exception of "|", constraints will disallow all pairs conflicting with the constraint. This is usually sufficient to enforce the constraint, but occasionally a base may stay unpaired in spite of constraints. PF folding ignores constraints of type "|".

−−canonicalBPonly

Remove non−canonical base pairs from the structure constraint

(default=off)

−−noconv

Do not automatically substitude nucleotide "T" with "U"

(default=off)

−−noPS

Do not produce postscript drawing of the mfe structure.

(default=off)

−t, −−layout−type=INT

Choose the layout algorithm. Simple radial layout if 0, or naview if 1

(default=‘1’)

Algorithms:

Select additional algorithms which should be included in the calculations. The Minimum free energy (MFE) and a structure representative are calculated in any case.

−p, −−partfunc[=INT]

Calculate the partition function and base pairing probability matrix.

(default=‘1’)

In addition to the MFE structure we print a coarse representation of the pair probabilities in form of a pseudo bracket notation, followed by the ensemble free energy, as well as the centroid structure derived from the pair probabilities together with its free energy and distance to the ensemble. Finally it prints the frequency of the mfe structure, and the structural diversity (mean distance between the structures in the ensemble). See the description of pf_fold() and mean_bp_dist() and centroid() in the RNAlib documentation for details. Note that unless you also specify −d2 or −d0, the partition function and mfe calculations will use a slightly different energy model. See the discussion of dangling end options below.

An additionally passed value to this option changes the behavior of partition function calculation: −p0 Calculate the partition function but not the pair probabilities, saving about 50% in runtime. This prints the ensemble free energy −kT ln(Z). −p2 Compute stack probabilities, i.e. the probability that a pair (i,j) and the immediately interior pair (i+1,j−1) are formed simultaneously in addition to pair probabilities. A second postscript dot plot called "name_dp2.ps", or "dot2.ps" (if the sequence does not have a name), is produced that contains pair probabilities in the upper right half and stack probabilities in the lower left.

−−MEA[=gamma]

Calculate an MEA (maximum expected accuracy) structure, where the expected accuracy is computed from the pair probabilities: each base pair (i,j) gets a score 2*gamma*p_ij and the score of an unpaired base is given by the probability of not forming a pair.

(default=‘1.’)

The parameter gamma tunes the importance of correctly predicted pairs versus unpaired bases. Thus, for small values of gamma the MEA structure will contain only pairs with very high probability. Using −−MEA implies −p for computing the pair probabilities.

−S, −−pfScale=scaling factor

In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows).

The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences. You can also recompile the program to use double precision (see the README file).

−c, −−circ

Assume a circular (instead of linear) RNA molecule.

(default=off)

−−ImFeelingLucky

Return exactly one stochastically backtracked structure

(default=off)

This function computes the partition function and returns exactly one secondary structure stochastically sampled from the Boltzmann equilibrium according to its probability in the ensemble

−−bppmThreshold=<value>

Set the threshold for base pair probabilities included in the postscript output

(default=‘1e−5’)

By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data.

−g, −−gquad

Incoorporate G−Quadruplex formation into the structure prediction algorithm

(default=off)

Model Details:
−T
, −−temp=DOUBLE

Rescale energy parameters to a temperature of temp C. Default is 37C.

−4, −−noTetra

Do not include special tabulated stabilizing energies for tri−, tetra− and hexaloop hairpins. Mostly for testing.

(default=off)

−d, −−dangles=INT

How to treat "dangling end" energies for bases adjacent to helices in free ends and multi−loops

(default=‘2’)

With −d1 only unpaired bases can participate in at most one dangling end, this is the default for mfe folding but unsupported for the partition function folding.

With −d2 this check is ignored, dangling energies will be added for the bases adjacent to a helix on both sides in any case; this is the default for partition function folding (−p). The option −d0 ignores dangling ends altogether (mostly for debugging). With −d3 mfe folding will allow coaxial stacking of adjacent helices in multi−loops. At the moment the implementation will not allow coaxial stacking of the two interior pairs in a loop of degree 3 and works only for mfe folding.

Note that by default (as well as with −d1 and −d3) pf and mfe folding treat dangling ends differently. Use −d2 in addition to −p to ensure that both algorithms use the same energy model.

−−noLP

Produce structures without lonely pairs (helices of length 1).

(default=off)

For partition function folding this only disallows pairs that can only occur isolated. Other pairs may still occasionally occur as helices of length 1.

−−noGU

Do not allow GU pairs

(default=off)

−−noClosingGU

Do not allow GU pairs at the end of helices

(default=off)

−P, −−paramFile=paramfile

Read energy parameters from paramfile, instead of using the default parameter set.

A sample parameter file should accompany your distribution. See the RNAlib documentation for details on the file format.

−−nsp=STRING

Allow other pairs in addition to the usual AU,GC,and GU pairs.

Its argument is a comma separated list of additionally allowed pairs. If the first character is a "−" then AB will imply that AB and BA are allowed pairs. e.g. RNAfold −nsp −GA will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy.

−e, −−energyModel=INT

Rarely used option to fold sequences from the artificial ABCD... alphabet, where A pairs B, C−D etc. Use the energy parameters for GC (−e 1) or AU (−e 2) pairs.

−−betaScale=DOUBLE

Set the scaling of the Boltzmann factors (default=‘1.’)

The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types. The Boltzmann factors then become exp(−dG/(kT*betaScale)) where k is the Boltzmann constant, dG the free energy contribution of the state and T the absolute temperature.

EXAMPLES

Single line sequence input and calculation of partition function and MEA structure

  $ RNAfold --MEA -d2 -p

The program will then prompt for sequence input. Using the example sequence "CGACGTAGATGCTAGCTGACTCGATGC" and pressing ENTER the output of the program will be similar to

  CGACGUAGAUGCUAGCUGACUCGAUGC
  (((.((((.......)).)))))....
   minimum free energy =  -1.90 kcal/mol
  (((.((((.......))},})))....
   free energy of ensemble =  -2.86 kcal/mol
  (((.(.((.......))..)))).... {  0.80 d=2.81}
  (((.((((.......))).)))).... { -1.90 MEA=22.32}
   frequency of mfe structure in ensemble 0.20997; ensemble diversity 4.19

Here, the first line just repeats the sequence input. The second line contains a MFE structure in dot bracket notation followed by the minimum free energy. After this, the pairing probabilities for each nucleotide are shown in a pseudo dot-bracket notation followed by the free energy of ensemble. The next two lines show the centroid structure with its free energy and its distance to the ensemble as well as the MEA structure, its free energy and the maximum expected accuracy, respectively. The last line finally contains the frequency of the MFE representative in the complete ensemble of secondary structures and the ensemble diversity. For further details about the calculation and interpretation of the given output refer to the reference manual of RNAlib.

Since version 2.0 it is also possible to provide FASTA file sequence input. Assume you have a file containing two sequences in FASTA format, e.g

  $ cat sequences.fa
  >seq1
  CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
  GAACGAUCUAUAACACGACUUCACUCUU
  >seq2
  GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUA
  UAACACGACUUCACUCUU

In order to compute the MFE for the two sequences the user can use the following command

  $ RNAfold < sequences.fa

which would result in an output like this

  >seq1
  CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
  .((.(((...((((..(((((........)))))))))...))).))................... ( -5.40)
  >seq2
  GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
  .......((((..............))))........................... ( -2.00)

Secondary structure constraints may be given in addition to the sequence information, too. Using the first sequence of the previous example and restricting the nucleotides of the outermost helix to be unpaired, i.e. base pairs (2,47) and (3,46) the input file should have the following form

  $ cat sequence_unpaired.fa
  >seq1
  CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
  GAACGAUCUAUAACACGACUUCACUCUU
  .xx...................................
  .......xx...................

Calling RNAfold with the structure constraint option -C it shows the following result

  $ RNAfold -C < sequence_unpaired.fa
  >seq1
  CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
  ....(((...((((..(((((........)))))))))...)))...................... ( -4.20)

This represents the minimum free energy and a structure representative of the RNA sequence given that nucleotides 2,3,46 and 47 must not be involved in any base pair. For further information about constrained folding refer to the details of the -C option and the reference manual of RNAlib.

AUTHOR

Ivo L Hofacker, Walter Fontana, Sebastian Bonhoeffer, Peter F Stadler, Ronny Lorenz

REFERENCES

If you use this program in your work you might want to cite:

R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and I.L. Hofacker (2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26

I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994), "Fast Folding and Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp 167-188

M. Zuker, P. Stiegler (1981), "Optimal computer folding of large RNA sequences using thermodynamic and auxiliary information", Nucl Acid Res: 9, pp 133-148

J.S. McCaskill (1990), "The equilibrium partition function and base pair binding probabilities for RNA secondary structures", Biopolymers: 29, pp 1105-1119

I.L. Hofacker & P.F. Stadler (2006), "Memory Efficient Folding Algorithms for Circular RNA Secondary Structures", Bioinformatics

A.F. Bompfuenewerer, R. Backofen, S.H. Bernhart, J. Hertel, I.L. Hofacker, P.F. Stadler, S. Will (2007), "Variations on {RNA} Folding and Alignment: Lessons from Benasque", J. Math. Biol.

D. Adams (1979), "The hitchhiker’s guide to the galaxy", Pan Books, London

The calculation of mfe structures is based on dynamic programming algorithm originally developed by M. Zuker and P. Stiegler. The partition function algorithm is based on work by J.S. McCaskill.

The energy parameters are taken from:

D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker, D.H. Turner (2004), "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292

D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter database for predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38, pp 280-282

REPORTING BUGS

If in doubt our program is right, nature is at fault.
Comments should be sent to rna@tbi.univie.ac.at.