BARRIERS

NAME

barriers − Compute local minima and energy barriers of a landscape

SYNOPSIS

barriers [options]

DESCRIPTION

barriers reads an energy sorted list of conformations of a landscape, and computes local minima and energy barriers of the landscape. For RNA secondary structures, suitable input is produced by RNAsubopt. For each local minimum found it prints to stdout, the conformation of the minimum, its energy, the number of the "parent"-minimum it merges with, and the height of the energy barrier. Additional information on each minimum, such as saddle point conformation and basin sizes can be included via options. A PostScript drawing of the resulting tree is written to "tree.ps" in the current directory.

OPTIONS

barriers accepts the following options:

-q, --quiet, --silent

be quiet, don’t do PostScript output.

-v, --verbose

Print more information.

−h, −−help

Show summary of options.

−V, −−version

Show version of program.

−−bsize

Print the size of of each basin in output.

−−max num

compute only the lowest num local minima.

−−minh delta

print only minima with energy barrier greater than delta (default 0)

−−saddle

print the saddle point conformations in output

−−rates

compute rates between macro states (basins) for use with treekin

−T temp

Set temperature in centigrade. Used to compute Boltzmann fators in conjunction with --rates. (default = 37)

−−poset n

input landscape is a poset with n objective functions

−P l1=l2

Compute a minimal barrier path between local minima l1 and l2. The result will be written to the file "path.l1.l2.txt"

−G graph

Set the type of configuration space, where graph can be one of:

RNA		RNA secondary structures (default)
RNA-noLP		canonical RNA structures (i.e. without isolated pairs)
Q2		Spin glass (strings of "+-")
Qa	a-letter hamming graph (e.g. Q3 strings of "ABC").
T		Phylogenetic Trees in bracket notation, e.g.
		((1)(((2)(3))(5))(4))
P		Permutations (as comma separated list), e.g.
		5,1,4,2,3

The type of landscape may also be set by the input file using the fourth word on first line. E.g.:
AUCGUGAGCUGUGUAGCUUAGCUAGCUAGC -610 100 :: RNA-noLP
for an landscape of canonical RNA structures

−M move-set

Set the moveset for generating neighbors of a configuration. For RNA possible values are Shift (default) or noShift. For Permutations possibilities are, T for transpositions (default), C for canonical transpositions, and R for reversal moves. Spin Glass always uses point mutations (single spin flip), Trees use NNI (Nearest Neighbour Interchange).

AUTHOR